Delimitation of cryptic species inside Claviceps purpurea.

f u n g a l b i o l o g y 1 1 9 ( 2 0 1 5 ) 7 e2 6

journal homepage: www.elsevier.com/locate/funbio

Delimitation of cryptic species inside Claviceps purpurea a,y, Kamila PESICOV a,b, Milada CHUDICKOV a, Sylvie PAZOUTOV A A A IKa,* Petr SR UTKAc, Miroslav KOLAR ska 1083, 142 20 Prague 4, Czech Republic Institute of Microbiology of the ASCR, v.v.i., Vıden tska 2, 128 01 Prague 2, Department of Botany, Faculty of Science, Charles University in Prague, Bena Czech Republic c 129, 165 21 Prague 6, cka Faculty of Forestry and Wood Sciences, Czech University of Life Sciences, Kamy Czech Republic a

b

article info

abstract

Article history:

Claviceps purpurea is an ovarian parasite infecting grasses (Poaceae) including cereals and

Received 9 June 2014

forage plants. This fungus produces toxic alkaloids and consumption of contaminated

Received in revised form

grains can cause ergotism in humans and other mammals. Recent molecular genetics stud-

7 October 2014

ies have indicated that it included three cryptic species (G1, G2, G3). In this study, reproduc-

Accepted 13 October 2014

tive isolation amongst these groups and among material from Phragmites and Molinia was

Available online 22 October 2014

tested using gene flow statistics for five polymorphic loci, and to support these data, phy-

Corresponding Editor:

logenetic affiliations based on gene trees and a multigene phylogeny were used. The four

Geoffrey Michael Gadd

recognized species are characterized based on morphology and host spectrum and formal taxonomic names are proposed. Claviceps purpurea sensu stricto (G1 group) represents a typ-

Keywords:

ical rye ergot, but infects various other grasses. Typical hosts of Claviceps humidiphila (new

C. arundinis

name for G2 species), like Phalaris arundinacea, belong to grasses preferring humid loca-

C. humidiphila

tions. Claviceps spartinae (G3) is specific to chloridoid grasses from salt barches. The mate-

C. microcephala

rial from Phragmites and Molinia can be authenticated with the species Claviceps

Clavicipitaceae

microcephala for which the new name Claviceps arundinis is proposed here. The divergence

Ergot

time between species was estimated and the tools for species identification are discussed.

Molecular clocks

ª 2014 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Taxonomy

Claviceps purpurea (Fr.) Tul. (ergot fungus) occurs predominantly in Northern temperate regions and has the widest host range of any Claviceps species. It was found that C. purpurea from various hosts differs greatly by their conidia size (Loveless 1971), ascospore size (Loveless & Peach 1986) and € ger 1922). These conspicuous the ability of sclerotia to float (Sta differences provoked a creation of numerous new names (for & outova review of these attempts see Atanasoff 1920; Paz

Parbery 1998). The narrowest species concept based mostly on conidia size, was used by S. Tanda (Tanda 1978, 1979, 1981a, b), who described several C. purpurea varieties; however, the wide spectrum of hosts and morphologies led to early speculations about putative host-specific races hidden inside C. purpurea (Frank 1896). Furthermore, their existence € ger was tested using cross e inoculation experiments (Sta 1903, 1906).

* Corresponding author. E-mail address: [email protected] (M. Kolarık). y , who died suddenly on 6th September 2013. outova This paper is dedicated to Dr. Sylvie Paz http://dx.doi.org/10.1016/j.funbio.2014.10.003 1878-6146/ª 2014 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

et al. outova S. Paz

8

At the same time as C. purpurea, Tulasne (1853) described Claviceps microcephala, a species specific to Phragmites australis and Molinia. The outstanding characters were long filiform stipes with very small (0.5 mm) moriform capitula. Petch (1935) performed a large scale germination study of sclerotia collected on various host grasses including Phragmites. He did not find stable morphological differences between the sexual state of both species and thus put Claviceps microcephala under the synonymy of Claviceps purpurea; this opinion has been accepted by most authors until now. Recent molecular studies of C. purpurea infraspecific variation revealed ecological speciation. Population studies based on RAPD fingerprinting and nrDNA sequences obtained from predominantly European and American isolates et al. 2000) € lsing & Tudzynski 1997; Paz outova (Jungehu detected three groups that differed in their habitat preferences and partially also in conidial size (G1 e open fields, G2 e damp and shady locations, and G3 e Spartina salt marshes). The lat et al. outova ter two groups were also distinct chemoraces (Paz 2000). The host specificity was actually a certain preference for grasses occurring in a given habitat, whereas ubiquitous grass genera and species (Poa spp., Dactylis spp.) appeared as universal hosts for both G1 and G2. These three groups overlapped partially with those delimited by Loveless (1971) based on conidial size and were later confirmed by a multilocus genealogical approach (Douhan et al. 2008) using mostly American isolates. This study also suggested that the groups are genetically isolated enough to comprise separate species. However, so far only the group G3 obtained a taxonomical status as C. purpurea var. spartinae (Duncan et al. 2002); Douhan et al. (2008) confirmed its occurrence also on Distichlis spicata, yet another chloridoid salt marsh species. In this study, we investigated divergence between the three so far established habitat-specific cryptic species G1 e G3 and the historical C. microcephala concept represented here by isolates from Phragmites and Molinia. This is the first study revealing C. microcephala species status using molecular methods and representative sampling covering large geographical area and different habitats. For this purpose, we use Phylogenetic species concept (Taylor et al. 2000) based on multiple gene phylogeny and the application of genealogical sorting index ( gsi) (Cummings et al. 2008). The degree of isolation of the above groups was established using population genetic analysis. In addition, the divergence time and the historical demography of the cryptic species were estimated. Variation in morphology of asexual state and culture growth, together with host preference was compared with species boundaries defined based on molecular data.

Material and methods Isolates and their characterization In total 666 isolates were used in this study. The assignment to populations G1, G2, G3, and the newly defined G2a (PhragmitesMolinia) was based on DNA fingerprints obtained with ERIC 1R primer (Versalovic et al. 1991) (Table S1 in Supplement material). A subset of 69 specimens (G1 ¼ 17 specimens, G2 ¼ 16 specimens, G2a ¼ 22 specimens, G3 ¼ 14 specimens) was

selected from the collection to cover the whole sampled area (Eurasia, North and South America, 17 countries) and habitats (Table 1). Preference was given to locations, where isolates from different cryptic species have been found in close vicinity or even at the same host plant. This subset also included € lsing & Tudzynski representative isolates used by Jungehu (1997) and Fisher et al. (2005). Sclerotia from all Claviceps purpurea collections were sub et al. 2000). Then the outova jected first to floating test (Paz sclerotia were revitalized and the isolates were plated on et al. 2000). Someoutova sucroseeasparagine medium T2 (Paz times, the isolates were obtained directly from plated honeydew drops. Conidia were washed from the proximal parts of sclerotia, or obtained from honeydew drops. Microscopic preparations were made in water and observed with an Axio Scope.A1 microscope (Carl Zeiss, Jena) using differential interference contrast (DIC) illumination. The measurements were done on photos recorded with a ProgRes SpeedXTcore 5 digital camera (Jenoptik Optical Systems, Jena) using the ProgRes imageprocessing software. At least 30 conidia measurements per specimen were performed. Because the sclerotium used for the culture isolation could not be used for further morphological examinations, the adjacent sclerotia were studied. Multiple ergot species could be presented in a single flower head and thus 2e5 adjacent sclerotia were measured to find variability in conidia size suggesting presence of more species. Conidia dimensions are given as “minimum e (mean, standard deviation) e maximum”. For production of sexual state, sclerotia formed during the year 2009 were collected from Phragmites and Molinia plants in August 2010. Phragmites dead flower heads carrying sclerotia were incubated suspended in an Erlenmeyer flask (1 L) over 1 cm of water in the bottom, similarly to a procedure described by Tulasne (1853). All cultures and associated sclerotia were deposited in the Culture Collection of Clavicipitaceae (CCC) in the Institute of Microbiology, Prague. The representative material was deposited in the Mycological Herbarium of the National Museum in Prague (PRM). Dried cultures on agar plates were used for epitype specimens.

Growth tests Growth response to cultivation temperature of the above selected isolates was assessed in order to find potential differences reflecting habitat specificities of all studied species. Three cultivation temperatures were tested: 16, 24, and 30 C. Diameters of three colonies per each isolate and each temperature were measured on T2 plates for 19 d and the means for each isolate were calculated. The radial growth rate Kr of each species was obtained as a slope of the leastsquares regression line of the mean colony radii versus time. The rates and their 95 % confidence limits were calculated in Kyplot 2.0 beta 15 (Yoshioka 2002).

DNA preparation and amplification DNA was purified from young cultures grown on cellophane discs plated over T2 medium. Mycelial cell walls were partially disintegrated through pre-incubation with Lytic Enzyme

Cryptic species in Claviceps purpurea

9

Table 1 e Isolates used in this study and their origin. Group G1

G2

G2a

G3

No.

Host a

198 (W3) 504 533 583 590 597 685 734 747 763 767 771 825 899 949 954 1013 434 503 518 588 691 728 (WAB1)b 735 741 745 755 824 978 981 983 1020 1090 473 933 956 968 970 974 1031 1094 1102 1107 1125 1162 196 (W12)a 236 480 739 902 1019 1110 1123 1136 197 (T8)a 501 510 513 535 539 562 565 CDE1b

Agropyron repens Ammophila arenaria Festuca arundinacea Lolium sp. Glyceria fluitans Leymus arenarius Alopecurus pratensis Bromus inermis Festuca arundinacea Avenella flexuosa Elymus athericus Secale cereale Glyceria fluitans Briza media Arrhenatherum elatius Poa compressa Briza media Dactylis sp. Ammophila arenaria Phalaris arundinacea Phleum pratense Phalaris arundinacea Ammophila brevigulata Festuca cf. rubra Calamagrostis sp. Dactylis sp. Alopecurus myosuroides Deschampsia caespitosa Deschampsia caespitosa Phragmites australis Calamagrostis epigeios Molinia coerulea Alopecurus pratensis Phragmites australis Phragmites australis Phragmites australis Phragmites australis Phragmites australis Phragmites australis Phragmites australis Phragmites australis Phragmites australis Phragmites australis Phragmites australis Phragmites australis Molinia sp. Molinia coerulea Molinia coerulea Molinia coerulea Molinia coerulea Molinia coerulea Molinia coerulea Molinia coerulea Molinia coerulea Agrostis sp. Spartina alterniflora Spartina anglica Spartina anglica Spartina anglica Spartina alterniflora Spartina anglica Spartina anglica Spartina foliosa

Location UK, Devon, Budleigh BE, Zeebrugge, dunes IT, Sardinia ska la Reserve CZ, Panska ska la Reserve CZ, Panska GR, Korfu, beach Agios Stefanos KZ, Dzungar Alatau Mts. NO, river Otta FR, Argonne, La Vignette siva hill SK, NP Nizke Tatry, Pra FR, Bretagne, Mont St. Michel dice CZ, Bezde DE, Bavaria, near Philippsreut ıjiste CZ, Sumava, R FR, Lille, Citadelle FR, Vosges, Le Markstein ıjiste CZ, Sumava, R DE, Bavaria, near Philippsreut BE, Zeebrugge, dunes PL, Szklarska Poremba ska la Reserve CZ, Panska KZ, Dzungar Alatau Mts. USA, WA, Longbeach NO, NP Rondane CZ, Rosec FR, Argonne, La Vignette TR, Erzurum DE, Bavaria, near Phillipsreut _ Kosy most PL, Bia1owieza, _ PL, Bia1owieza bsko, Nerestec pond CZ, Vra ı Dar, moor CZ, Boz CZ, Petrovice u Susice - Vojetice CZ, Sobotka, Slejferna pond Vrbensky pond CZ, Haklovy Dvory, Stary LT, National Park Aukstaitija € rv lake € haja FI, Pu € , sea coast FI, Svino _ near lake PL, Bia1owieza, CH, Basel, Arlesheim, Eremitage CZ, Libice nad Cidlinou FR, Labergement-les-Seurre ky, Kotvice pond CZ, Albrechtic SK, Vydrnık BE, Loppen UK, Exeter ı Pole near Bousov CZ, Vlc CZ, Grassland Station Zubrı CZ, Rosec ıjiste CZ, Sumava, R ı Dar, moor CZ, Boz les CZ, Reserve Slavkovsky CZ, Prague, Botanical garden Troja DE, near Karlsfried BE, Hohes Venn USA, NJ, Southriver UK, Skeffling, Humber estuary UK, Isle of Wight, Newtown Harbour UK, Marchwood UK, Marchwood UK, Wales, Dovey estuary UK, Essex, Stour estuary USA, California, Point Reyes National Seashore

Year 1983 1999 1998 2000 2000 2000 2001 2002 2002 2003 2003 2003 2004 2007 2008 2008 2008 1998 1999 1998 2000 2001 2002 2002 2002 2002 2003 2004 2008 2008 2008 2008 2009 1998 2008 2008 2008 2008 2008 2008 2008 2009 2009 2009 2010 1983 1996 1998 2002 2007 2008 2009 2009 2009 1998 1998 1998 1998 1999 1999 1999 2002

Collector B. Cagas L. Riccione outova S. Paz outova S. Paz M. Kolarık A. Chlebicki M. Kolarık outova S. Paz M. Sukova outova S. Paz outova S. Paz outova S. Paz P. Sr utka outova S. Paz outova S. Paz P. Sr utka outova S. Paz B. Cagas outova S. Paz outova S. Paz A. Chlebicki A. Fisher M. Kolarık D. Sztachova outova S. Paz C. Eken outova S. Paz M. Kolarık M. Kolarık outova S. Paz M. Kolarık J. Markova outova S. Paz M. Kolarık M. Kolarık M. Kolarık M. Kolarık M. Kolarık M. Kolarık M. Kolarık outova S. Paz M. Kolarık a k Martin Pastirc M. Kolarık B. Bradna B. Cagas D. Sztachova P. Sr utka M. Kolarık ar Pavel Spry n outova S. Paz tova A. Kuba R.A. Duncan A. Raybould A. Raybould A. Raybould A. Raybould A. Raybould A. Raybould A. Fisher (continued on next page)


10

Table 1 e (continued ) Group

No. b

FSA1 GML1b RIH1b IRE1b ARG1b WLT1b

Host Spartina alterniflora Spartina alterniflora Spartina alterniflora Spartina anglica Spartina densiflora Spartina alterniflora

Location USA, Florida, San Augustine USA, Georgia, Marsh Landing USA, Rhode Island Ireland, Dublin Argentina, Celpa Marsh USA, WA, Leadbetter State Park

Year 2000 2000 2001 2001 2002 2001

Collector A. A. A. A. A. A.

Fisher Fisher Fisher Fisher Fisher Fisher

€ lsing & Tudzynski (1997). a Jungehu b Fisher et al. (2005).

Solution (#2301430, 5 PRIME, Hamburg) at 37 C for several hours to overnight at 500 rpm on mixing thermoblock MB102 (Bioer Technology, Hangzhou). The DNA was then isolated using ArchivePure DNA Yeast & Gram-þ Kit (5 PRIME, Hamburg). Five loci were amplified using PCR and sequenced. Nuclear rDNA ITS-LSU was amplified with the forward primer ITS1F combined with NL4 (White et al. 1990; Gardes & Bruns 1993). Part of the b-tubulin (benA, Tub2) gene was amplified with the primers T1 and T22 and sequenced with primers T1, T22, T2 and T12 (O’Donnell & Cigelnik 1997). Part of the RNA polymerase II gene (RPB2) was amplified with primers fRPB2-5F and fRPB2-7cR (Liu et al. 1999); for the samples that did not amplify with fRPB2-5F, a specific forward primer (TTTCGTGGTATTGTTCGCAGA) was designed. Primers EF1983F (GCYCCYGGHCAYCGTGAYTTYATR) and EF1-2218R (ATGACACCRACRGCRACRGTYTG) were used for obtaining a region of EF-1a gene (Rehner & Buckley 2005). Fragment of the Mcm7 gene (Aguileta et al. 2008) was amplified using forward primer GGCTCACTACATTCGTCAACAC and reverse primer AGCAAATGCCATTGTCAGC designed for this study. For most of the PCR reactions PerfectTaq DNA polymerase was used; difficult samples were amplified using PerfectTaq Plus DNA Polymerase together with 5P solution (all from 5 PRIME, Hamburg) according to the manufacturer’s instructions. On an Eppendorf Mastercycler Gradient (Eppendorf, Hamburg), two types of touchdown cycling conditions were used. The run involved an initial 2 min denaturation step at 93 C, followed by five cycles in which the DNA samples were denatured at 93 C for 30 s and annealed for 30 s with a decrease in 1 C in each successive cycle. The stringent regime started with annealing temperature 65 C decreasing to 60 C, the relaxed regime started with 58 C decreasing to 53 C; in both cases extension proceeded at 72 C for 1 min. Annealing at the lower temperature was then used for further 33 cycles with a final extension for 10 min. Tubulin fragments were obtained using the relaxed regime. Amplicons were custompurified and sequenced with the same primers at Macrogen Inc. (Seoul); the sequences were deposited in the public databases (JX083474eJX083750, Table S2 in Supplement material). Sequences were aligned in MAFFT with a E-ins-i option (protein genes) or Q-ins-i option (nrDNA) (Katoh & Toh 2008).

Congruence test Maximum likelihood (ML) analyses of single loci were performed on datasets containing all isolates (full) using RaxML (Stamatakis 2006) with raxmlGUI 0.9 beta (Silvestro &

Michalak 2010) under GTRGAMMA substitution model (see the RAxML manual for the rationale behind model choice). The congruence of these phylogenies was assessed using the index Icong (de Vienne et al. 2007). The hypothesis tested is that there is a higher congruence between single-locus trees than expected by chance. The index was calculated via the webpage provided by the same authors (http://www.ese.upsud.fr/bases/upresa/pages/devienne/).

Genealogical sorting index For phylogenetic species delimitation, gsi (Cummings et al. 2008) was applied, testing the null hypothesis that the degree of exclusive ancestry of branch tips observed is that which might be observed at random. The monophyly is measured on a scale 0e1. Ensembles containing hundred trees were generated by the bootstrap option in the RaxML. The calculation of gsi for each node containing a putative species was performed on both single locus and concatenated datasets as implemented at the website http://www.genealogicalsorting.org, with 10 000 permutations of each tree.

Phylogenetic analyses After establishing congruence, the alignments were concatenated and collapsed to unique haplotypes. For each locus, a suitable model was selected according to its Akaike Information Criterion (corrected) value using MEGA5 (Tamura et al. 2011). The models selected were TrNþGþI (Mcm7), K80þG (RPB2), TrNþG (EF-1a, benA), and GTRþG (nrDNA). Maximum likelihood (ML) phylogenetic analysis and bootstrapping were performed in Garli 2.0 (Zwickl 2006) that allows use of partitioned data with different substitution models. A total of 1000 bootstrap samples were collected and the support values were mapped on the best tree using SumTrees program of the DendroPy package (Sukumaran & Holder 2010). Single locus haplotype trees were obtained by RaxML (Stamatakis 2006) with raxmlGUI 0.9 beta (Silvestro & Michalak 2010) under GTRþGþI substitution model with 100 bootstrap.

DNA polymorphism and nucleotide divergence Estimates of nucleotide polymorphism for each species (Table 2), i.e., number of haplotypes and segregating sites, haplotypic diversity, average number of nucleotide substitutions per site (nucleotide diversity p, Nei 1987), the average number of pairwise nucleotide differences (k, Tajima 1983)


11

Table 2 e Nucleotide polymorphism of four Claviceps species. Group G1

G2

G2a

G3

Locus

N

h

S

Hd

p

k

U

Rmin

Mcm7 RPB2 EF-1a benA nrDNA Combined Mcm7 RPB2 EF-1a benA nrDNA Combined Mcm7 RPB2 EF-1a benA nrDNA Combined Mcm7 RPB2 EF-1a benA nrDNA Combined

17

1 7 10 8 14 17 5 8 8 12 5 17 2 7 9 13 5 20 1 5 5 8 3 9

0 12 27 18 9 66 8 16 13 34 5 76 1 10 15 14 4 44 0 7 7 15 2 31

0 0.824 0.794 0.875 0.904 1 0.662 0.669 0.816 0.919 0.426 1 0.091 0.723 0.81 0.84 0.701 0.99 0 0.78 0.78 0.857 0.538 0.879

0 0.00185 0.00556 0.00263 0.00208 0.00272 0.00417 0.00265 0.00195 0.00367 0.00053 0.00246 0.00022 0.0254 0.0035 0.00262 0.00079 0.00218 0 0.00242 0.00295 0.00415 0.00052 0.0024

0 2.074 5.485 3.941 2.323 13.823 1.7059 2.9706 1.9265 5.3382 0.5882 12.5294 0.0909 2.8485 3.4502 3.8095 0.8831 11.0823 0 2.703 2.901 6.011 0.5824 12.198

6 13 8 36 4 67 2 1 1 0 0 4 2 1 1 1 0 5 2 4 9 3 1 19

0 0 3 2 2

17

22

14

0 1 0 2 0 0 3 0 2 0 0 0 0 1 0

N, number of sequenced isolates. h, number of haplotypes. S, number of segregating sites. Hd, haplotypic diversity. p e nucleotide diversity (average number of nucleotide differences per site). k e average number of nucleotide differences. U e nucleotide substitutions unique for the group and found in all its members. Rmin e minimum number of recombination events in the locus.

were detected using DNASP 5.10 (Librado & Rozas 2009). In addition, nucleotide substitutions unique for each group (U ) and found in all its members were counted manually. Nucleotide divergence between species (Table 3) was estimated as the number of fixed nucleotide differences between populations, the number of polymorphic mutations that occur in one population but are monomorphic in the second, the number of shared mutations, average number of nucleotide differences between populations (K), nucleotide divergence (p), average number of nucleotide substitutions per site between populations (DXY), and the number of net nucleotide substitutions per site between populations (DA) (Nei 1987). The calculations were again conducted using DNASP 5.10. For general species divergence measures, the concatenated full dataset was used (Table 5). Average pairwise number of nucleotide differences per site (DXY) and the number of net nucleotide substitutions per site between clades, DA, were calculated in DNASP 5.10. Values of FST (Hudson et al. 1992), related Nm (number of effective migrants among populations) were calculated in Arlequin 3.5.1.2 (Excoffier & Lischer 2010) using substitution model TN93þG (a ¼ 0.148) selected by MEGA5 (Tamura et al. 2011) under AICc criterion. The significance of FST values was determined by performing 10 000 permutations.

Species tree and divergence time estimates *BEAST is a Markov Chain Monte Carlo (MCMC) method that is based on joint estimates of multiple gene trees embedded in a species tree under the coalescent and implemented in BEAST 1.7.4 package (Heled & Drummond 2010; Drummond et al. 2012). It assumes that any incongruence among the gene trees is caused by incomplete lineage sorting and not gene flow. The FST and related Nm values have shown that the gene flow between the groups is almost nonexistent, therefore a *BEAST analysis is applicable. *BEAST also assumes that no recombination occurs in the analysed sequences. Therefore the optimum recombination-filtered block was extracted from each single-locus alignment using the IMgc program (Woerner et al. 2007) under the option removing haplotypes that represent putative recombinant sequences as well as possibly recombined parts of alignment. From the benA dataset, only the exons were used. The five reduced datasets were loaded separately into BEAUti 1.7.4 under the *BEAST option unlinking all models. In the Traits panel, group identity (G1, G2, G2a, G3) of the isolates was entered as ‘species’ trait. The clock-like properties of the filtered datasets and their optimum substitution models were tested in MEGA5 (Tamura et al. 2011). Only for EF-1a the


12

Table 3 e Nucleotide divergence in loci between four Claviceps species.

G1eG3

G1eG2

G1eG2a

G3eG2

G2eG2a

G3eG2a

Locus

Polymorphic sites

Fixed differences

P1

P2

Shared mutations

Mcm7 RPB2 EF-1a benA nrDNA Mcm7 RPB2 EF-1a benA nrDNA Mcm7 RPB2 EF-1a benA nrDNA Mcm7 RPB2 EF-1a benA nrDNA Mcm7 RPB2 EF-1a benA nrDNA Mcm7 RPB2 EF-1a benA nrDNA

9 39 50 70 15 8 52 50 85 19 9 46 52 70 17 10 42 33 52 11 8 21 23 43 7 8 36 37 35 9

9 22 17 39 5 5 27 11 36 6 8 28 13 39 6 2 20 15 3 4 0 0 0 0 0 7 19 15 6 3

0 12 27 17 9 0 12 27 15 9 0 11 26 17 8 0 7 6 15 2 7 11 8 31 3 0 7 7 15 2

0 7 7 15 2 8 16 16 34 5 1 9 14 14 3 8 16 12 32 5 0 5 10 9 2 1 10 15 14 4

0 0 0 0 0 0 0 0 2 0 0 1 1 0 1 0 0 1 0 0 1 5 5 5 2 0 0 0 0 0

p

K

Dxy

DA

0.01126 0.01304 0.01618 0.01885 0.00409 0.01131 0.0161 0.0133 0.01746 0.00438 0.01 0.01604 0.0158 0.01793 0.00462 0.00623 0.01341 0.0113 0.00582 0.00239 0.0072 0.00421 0.00647 0.00424 0.001 0.0085 0.01232 0.01361 0.00657 0.00255

9 26.294 26.966 49.021 7.357 8.176 32.588 22 44.879 8.118 8.045 33.043 26.767 47.781 8.834 4 26.639 19.588 11.181 4.651 5.158 6.503 9.816 7.909 1.46 7.045 25.286 24.032 14.903 4.994

0.0223 0.0239 0.0278 0.0345 0.0066 0.0203 0.0297 0.0226 0.0316 0.0073 0.0199 0.0301 0.0276 0.0337 0.0080 0.0099 0.0242 0.0201 0.0077 0.0042 0.0127 0.0058 0.0100 0.0055 0.0013 0.0174 0.0229 0.0248 0.0103 0.0045

0.0223 0.0217 0.0236 0.0311 0.0053 0.0182 0.0274 0.0189 0.0284 0.0060 0.0198 0.0279 0.0231 0.0311 0.0065 0.0078 0.0216 0.0177 0.0038 0.0037 0.0105 0.0032 0.0073 0.0023 0.0007 0.0173 0.0204 0.0215 0.0069 0.0038

SD (DA) 0.0078 0.0041 0.0050 0.0053 0.0013 0.0056 0.0054 0.0038 0.0041 0.0015 0.0061 0.0050 0.0044 0.0046 0.0013 0.0029 0.0048 0.0035 0.0013 0.0011 0.0037 0.0012 0.0019 0.0009 0.0004 0.0056 0.0042 0.0042 0.0016 0.0010

P1, sites polymorphic in the population 1 and monomorphic in the population 2. P2, sites polymorphic in the population 2 and monomorphic in the population 1. p e nucleotide diversity (average number of nucleotide differences per site between populations). K e average number of nucleotide differences between populations. Dxy, average number of nucleotide substitutions per site between populations with Jukes-Cantor correction. DA, number of net substitutions per site between populations with Jukes-Cantor correction. SD (DA), standard deviation of DA.

Table 4 e Estimates of genetic differentiation between four Claviceps species.

G1 G1 G1 G2 G2 G2a

G2 G2a G3 G2a G3 G3

DXY

DA

SD of DA

FST

Nm

0.02314 0.02491 0.02371 0.00609 0.0131 0.01515

0.02055 0.02246 0.02115 0.00377 0.01067 0.01285

0.0016 0.00187 0.00281 0.00063 0.00157 0.00163

0.90049 0.91374 0.90559 0.62705 0.82545 0.85965

0.05525 0.0472 0.05212 0.29738 0.10573 0.08163

The values were calculated from the complete concatenated dataset (5109 positions). DXY, average number of nucleotide substitutions per site between populations with Jukes-Cantor correction. DA, number of net substitutions per site between populations with Jukes-Cantor correction. Nm, effective number of individuals multiplied by migration rate. For all Fst values p < 1e-5.

strict clock hypothesis was rejected and therefore an uncorrelated lognormal relaxed clock was applied. Mean substitution rates were modelled on a normally distributed prior derived from the recent studies on Lecanoromycetes. Amo de Paz et al. (2011) calibrated their analysis of parmelioid Lecanoromycetes on the split of LecanoromyceteseChaethothyriomycetidae (Eurotiomycetes) (ca 300 Ma)

Table 5 e Estimates of substitution rates from *BEAST analysis. Locus ITS1þ5.8S Mcm7 RPB2 EF-1a benA

Length Pi Substitution Mean rate 95 % HPD model 404 409 1080 987 891

7 13 44 48 22

JC K2 K2þG TN93þG TN93þG

0.79 1.15 1.7 2.42 1.13

0.29e1.42 0.48e1.94 1.18e2.26 1.25e3.73 0.56e1.84

Pi, parsimony-informative sites; Rate, substitutions/site/ year 109; HPD, highest posterior density interval.


taken from and the age of two fossils: Parmelia ambra (15e45 Ma) and Alectoria succini (35e40 Ma). Their analysis in BEAST produced substitution rates for RPB1, mtSSU, and nuLSU. Further studies on the genera Melanohalea and Oropogon based on this calibration yielded values for substitution rates of mtSSU, Mcm7, RPB1, RPB2 for the genus Melanohalea and ITS, nuLSU, and benA for Oropogon (Leavitt et al. 2012a,b). As the Wang et al. (2010) study suggested similar evolutionary rates of protein-coding loci for Sordariomycetes and Lecanoromycetes, we used the RPB2 substitution rate value 1.51 109 substitutions per site per year (s s1 y) (Leavitt et al. 2012a) as a prior of mean rate with normal distribution and S.D. 3 1010. Substitution rates for the nrDNA, Mcm7, EF-1a, and benA markers were co-estimated along the run under a normal prior 1 109 s s1 y, S.D. 5 109. A Yule process speciation prior was used for the branching rates. The analysis was performed with UPGMA starting trees for each locus and 50 millions of MCMC steps. The stationarity and ESS values >200 were checked in Tracer 1.5 after discarding 10 % of burn-in. Results of two runs were combined using LogCombiner 1.7.4 and the combined tree file was imported into TreeAnnotator 1.7.4. The summary species tree was visualized in FigTree 1.3.1.

Historical demography and mismatch analysis The recombination-filtered datasets were concatenated and used for the following calculations. Selective neutrality tests were performed in DNASP 5.10 and Arlequin 3.5 (Excoffier & Lischer 2010). The values of FS (Fu 1997), and D (Tajima 1989) were calculated in Arlequin and their significance tested with 1000 replicates. A negative value of FS is evidence for an excess number of alleles from a recent population expansion, whereas a positive value of FS points to a deficiency of alleles resulting from a recent population bottleneck or from an overdominant selection. Significant negative values of Tajima’s D indicate demographic expansion or purifying selection, whereas values significantly greater than zero suggest a population bottleneck or a balancing selection. The values of R2 (Ramos-Onsins & Rozas 2002) and D* and F* statistics (Fu & Li 1993) were calculated in DNASP. Low values of R2 indicate demographic expansion. The observed distribution of pairwise nucleotide differences (mismatch distribution) was compared with distributions expected under models of sudden demographic expansion (Rogers & Harpending 1992) and spatial expansion with high levels of migration between neighbouring demes (Excoffier 2004) implemented in Arlequin. Both expansion distributions are unimodal, whereas for the population in equilibrium the distribution should be multimodal. The statistical significance of the raggedness index (Harpending 1994) and the sums of squared deviations (SSD) of the observed data from both models were obtained from a parametric bootstrap with 5000 replicates. The timing of the expansion was calculated from values of s using the equation s ¼ 2Tu. In this equation, u is the mutation rate for the whole locus length per generation under study (here m length of the respective alignment) and T is the time measured in years since expansion. The mean substitution rate m per site per year was calculated from the values obtained in the *BEAST analysis for each locus and weighted by the length of the respective loci.

13

Results Molecular data Five loci were sequenced for this study across 69 isolates. All representative haplotypes of the five loci were submitted to public databases (Table 1, Table S2 in Supplement material). The concatenated aligned matrix contained 5109 characters and 186 parsimony-informative positions (Mcm7: 409, RPB2: 1119, EF-1a: 986, benA: 1470, ITS: 524, LSU: 597 positions). For *BEAST analysis, recombination-filtered datasets were used containing 64 isolates, 3362 characters and 135 parsimonyinformative positions.

Phylogeny Single locus analyses All single locus haplotype trees were concordant in separating the land grass clade G1 (bootstrap values 96e100) from the second clade containing the three populations from wet and/or shady habitat preferences (G2, G3, G2a). The group G3 was also markedly separated from the groups G2 and G2a and highly supported with bootstrap values 75e100 (Figure S1 in Supplement material). The G2a group appeared mostly as a well resolved monophyletic clade derived from within a paraphyletic G2. Both groups were resolved better by protein-coding genes. In the analysis of nrDNA the most frequent haplotype Rib3 was found in twelve G2 and three G2a isolates. Other than that, no haplotypes were shared between any of the groups. Douhan et al. (2008) noted two copies of the motif AACTG in benA typical of his G2 isolates; groups G1, G2a, and G3 contained a single copy. In our dataset the motif was found only in 9 out of 17 G2 isolates (starting at the position 571) so it is obviously not a universal G2 character.

Multilocus analysis The single-locus phylogenies containing all isolates (data not shown) were found congruent as the indices Icong (de Vienne et al. 2007) supported the high degree of similarity with values between 1.356 and 2.079 and significant p values (from 1.63 106 to 0.0017). Phylogenetic reconstruction (Fig 1) yielded better resolution of the “wet” clade than single locus trees. Again, G3 clade of Spartina-Distichlis salty wetlands specialists was monophyletic. The G2 population appeared in ML trees either paraphyletic with G2a Phragmites-Molinia emerging as a new specialized lineage or as a monophyletic clade, but without bootstrap support. The results from the genealogical sorting analysis of the combined dataset are presented in Fig 1 with high gsiT values between 0.94 and 1.0 (p < 0.0001) for all four groups. The values from single-locus trees for each of the groups ranged also between 0.9 and 1.0 (p < 0.0001) (data not shown). The gsi results confirm that Claviceps purpurea includes four putative species.

Genetic diversity The number of haplotypes per locus and group varied from 1 to 14 (Table 2). In the G3 group, most of the European isolates

14


Fig 1 e Maximum likelihood phylogenetic tree of the multigene dataset (Mcm7, RPB2, EF-1a, benA) constructed in Garli 2.0.


15

Table 6 e Divergence time estimates from *BEAST analysis. Species/populations

Time (Ma)

95 % HPD

7.83 2.9 1.17

4.36e12.4 1.24e5.14 0.52e2.07

G1 vs G3, G2, G2a G3 vs G2, G2a G2 vs G2a

HPD, highest posterior density interval.

The separation of the lineages was also confirmed by high FST values calculated from the concatenated dataset (Table 4). FST between the closest groups G2 and G2a was 0.63 and values 0.88e0.94 were found between the remaining ones. The FSTderived effective numbers of migrants, Nm, was 0.3 between G2 and G2a and ranged from 0.05 to 0.1 for the remaining lineages confirming thus extremely limited gene flow bordering with isolation for all groups.

Species tree and divergence time estimates belonged to the same haplotype due to the relatively recent introduction from the North America in the early 1960s (Gray et al. 1990). In the group G2a, only isolates 1125 and 1162 belonged to the same haplotype. With the exception of Mcm7, where only eight haplotypes were found in all four groups, the haplotype diversity Hd was moderate to high in every population, ranging from Hd ¼ 0.47 to Hd ¼ 0.97 for single loci and Hd ¼ 0.99 to Hd ¼ 1.0 for combined loci. In contrast, nucleotide diversity was low, ranging between p ¼ 0.00185 and p ¼ 0.0027 for combined loci (Table 2), indicating only small differences between haplotypes inside groups. The lowest values for molecular diversity statistics were found in the nrDNA locus.

Genetic differentiation The four lineages did not share any haplotypes in the four protein-coding loci (Table 3, Table S2 in Supplement material). Only for the nrDNA, the most frequent haplotype Rib3 found in twelve isolates of the G2 group was also observed in three isolates from Phragmites (1094, 1125, and 1162), whose four other loci and DNA fingerprinting pattern with the primer ERIC 1R placed them firmly with the G2a population. Fixed differences in all loci have been observed between all groups except for G2 and G2a pair, where also the highest number of shared mutations was found (Table 3). The differing values of DA obtained from each of the loci for the same divergence suggested heterogeneity of their substitution rates. The polymorphism within G2 and G2a pair confirms close relativity of both groups. From a total of 4503 concatenated nucleotides, the degree of polymorphism was 2.2 % (97 positions). Five positions (5.2 %) were found to be shared, nine positions (9.3 %) represents a polymorphism fixed within group. The rest of variability were mostly sites polymorphic in one of the populations and monomorphic in other. In Mcm7 gene the half of the polymorphic sites were fixed and this gene has the strongest discriminative power (Table S3 in Supplement material).

Unlike the tree obtained by phylogenetic reconstruction, the species tree has shown a strong support for G2-G2a divergence. The posterior probabilities of all nodes were >0.99. The estimates of substitution rates and divergence times obtained by *BEAST from recombination-free data of five loci are shown in Tables 5 and 6. The mean rates of coding region of tubulin and Mcm7 were lower than those of EF-1a and RPB2. The ITS1-5.8S rate was the lowest and resembled more the published values for nuLSU because in the recombinationfree alignment conservative regions prevailed. The divergence times have wide ranges of 95 % highest posterior density intervals. The oldest split between the land grass group G1 and the “wet” clade was 7.8 Ma, the G2-G3 split was dated to 2.9 Ma, whereas G2 and G2a may have diverged around 1.2 Ma.

Historical demography According to Avise (2000), the combination of high haplotype diversity and the lower nucleotide diversity generally points to a bottleneck followed by population expansion. Therefore, the selection neutrality tests were performed for each group on concatenated recombination-free dataset (3771 positions); the measures of genetic diversity of the dataset are also given (Table 7). For the groups G1, G2, and G2a the values of the criterion FS were negative and significant, whereas D*, F* and Tajima’s D were negative and non-significant. If FS is significant and F* and D* are not, then population growth or range expansion is indicated, whereas the reverse suggests selection (Fu 1997). Value of R2 of the G2 group was very small, suggesting expansion, but also non-significant. For G3 group, the values of FS, D*, F* and Tajima’s D were positive and nonsignificant, also the R2 value was the highest of all groups. The fit of the observed mismatch data to the simulated distributions expected under both demographic and spatial expansion model is shown on Fig 2. The observed data of G1, G2, and

Table 7 e Genetic polymorphism and tests of species expansions for recombination-filtered subset of data. Species

N

h

S

Hd

p

k

Tajima D

P

Fu’s Fs

P

D*

G1 G3 G2 G2a

14 14 16 20

12 7 15 15

39 15 30 27

0.978 0.813 0.992 0.942

0.00237 0.00148 0.00152 0.00184

8.912 5.582 5.733 6.942

1.187 0.748 L1.513 0.22

0.1148 0.8079 0.049 0.455

L2.674 1.071 L9.045 L6.986

0.0905 0.707 0.0002 0.004

1.707 ns 0.617 ns 2.0796 ns 1.430 ns

F* 1.797 0.747 2.216 1.288

R2 ns ns ns ns

0.1275 ns 0.174 ns 0.0653 ns 0.1153 ns

N, number of isolates; h, number of haplotypes; S, number of segregating sites; Hd, haplotypic diversity; p e nucleotide diversity (average number of nucleotide differences per site); k e average number of nucleotide differences; R2 e Ramos-Onsins and Rozas’ statistics; ns, not significant. Values with p > 0.1 are in bold.

16


Fig 2 e The fit of the observed mismatch data to the simulated distributions expected under both demographic and spatial expansion model.

G2a were unimodal, whereas in G3 group a rough, multimodal distribution was found and the demographical expansion model was rejected (p < 0.1). The p-values of Harpending’s raggedness index and SSD for all three cases of the unimodal distribution were non-significant (Table 8), which indicates a good fit. It was not possible to discriminate between demographic or range expansion, as the p-values of the modeled curves did not exclude either of the models. However, in conjunction

with negative although non-significant values obtained in neutrality tests, the demographic expansion is more plausible. Multimodal distribution of the G3 group can also indicate infraspecific structuring (Castoe et al. 2007) visible in the highly supported G3 e subclades in the multilocus tree (Fig 1). The time of expansion and its 95 % CI were calculated for both expansion models (Table 8). In G1, the expansion was the youngest, about 360 Ka for both models. G2 demographic


17

Table 8 e Expansion times from mismatch analysis performed in Arlequin. Population G1 G2 G2a G3

Demographic expansion (Kya)

95 % C.I. (Kya)

Model (SSD) p-value

Spatial expansion (Kya)

95 % C.I. (Kya)

M

Model (SSD) p-value

366 503 736 multimodal

141e1070 273e652 275e1317

0.497 0.812 0.818 0.076*

364 386 400 multimodal

164e1227 210e676 184e1137

41.78142 459.3568 24.61182 4.67574

0.643 0.816 0.522 0.209

*Significant at p < 0.1; M ¼ Nm for haploid populations (Excoffier 2004).

expansion might have occurred 503 Ka and in G2a the expansion date 711 Ka is closer to the G2eG2a divergence point 1.17 Ma. The estimates of spatial expansion dates for the groups G2 and G2a were younger than those for the demographic ones.

Host and habitat preferences The overview of host species is given in the Table S1 in Supplement material. The isolates were assigned to species according to their DNA fingerprints and/or sequences. Host affinities of isolates that were characterized by DNA in the studies of Douhan et al. (2008), Tanaka (2008), and € lsing & Tudzynski (1997) were also included. Jungehu Only the G1 group was found on Brachypodium sylvaticum (Brachypodieae), Bromus spp. (Bromeae) and with the exception of Hordeum violaceum and Elymus repens also in Triticeae. In Poeae, most G1 isolates was found on Loliinae, but also G2 was found on both Festuca and Lolium. On the other hand, in Agrostidinae, G2 prevailed. Phalaris arundinacea from European shady habitats was colonized exclusively by G2, whereas drought-tolerant Phalaris aquatica from Australia harboured G1. Alopecurus, Phleum, Dactylis, and Poa spp. were colonized by both G1 and G2, depending on the type of the habitat. Similarly, Nardus stricta (Nardeae) from alpine grasslands was colonized by G1, whereas G2 was found on a wet meadow. Isolates from the G2a group were found only on Phragmites and Molinia (Arundinoidae) with the exception of one finding on Agrostis sp. in Belgium (Table 1). No G2a isolates were obtained from Calamagrostis and Nardus. However in two cases, G2 isolates were also found on the arundinoids infecting the same flower heads as G2a (Table 1). G3 group occurred only on chloridoid hosts Spartina and Distichlis.

however, the DNA fingerprint patterns and DNA sequences placed the isolates unequivocally inside G1 group. All sinking sclerotia belonged to G1 species, whereas all G2, G2a and G3 sclerotia floated. The conidia size of 52 G1, 28 G2, and 23 G2a specimens (Fig 4, Table S3 in Supplement material) was compared to resolve usability of this character for the species differentiation. Size ranges of G2 (7.1e11.6 3.3e5.3 mm) and G2a (6.0e11.1 2.8e5.2 mm) were almost identical. The conidia of the G1 group were in average shorter (3.8e9.8 2.2e4.5 mm) but the upper size ranges overlapped. Long conidia of G1 specimens have been found especially on Nardus and Briza. When these specimens were omitted, size range of G1 conidia was 3.8e8.5 2.2e4.5 mm. Therefore the conidial size cannot be used as a single discriminating marker among these species.

Taxonomy Ergot, the C. purpurea sclerotium, was firstly described as Sclerotium clavus DC (de Candolle 1815) and later combined in a new genus Spermoedia by Fries (1823). The conidial stage v. (1827). was further described as Sphacelia segetum Le Guibourt (1848) marked connection of both asexual stages

Growth tests, floating test and conidia size Radial growth rates (Kr) were linear over the 19 d of cultivation except for rapidly growing G3 isolates at 24 and 30 C, where the value for Kr was calculated from the first 14 d. The radial growth rates at 24 and 30 C in all groups were similar (Fig 3) and their confidence intervals overlapped. Growth rates at 16 C were lowered to 50e63 % of the rate at 24 C. The most vigorous growth was observed in G3 isolates. Growth rates of G1 and G2 isolates were similar at 24 and 30 C, whereas G2 was slower at 16 C. The slowest growth at 24 and 30 C was observed in the isolates of the G2a group, but their growth rate at 16 C was similar to that of G2. et al. 2000), sclerotia of outova As published previously (Paz the G1 collections did not float on water. An exception was found in the collections from Meliceae. Sclerotia collected on Glyceria and Melica (both from wet habitats) were floating;

Fig 3 e The radial growth rates at 24 and 30 C in four Claviceps species.


18

Width (μm)

6

Width (μm)

Briza

Nardus

5 4 3 2

G2

5 4 3 2

Width (μm)

G1

G2a

5 4 3 2

4

6

8

10

12

Length (μm) Fig 4 e The conidia size of 52 C. purpurea (G1), C. humidiphila (G2), and 23 C. arundinis (G2a) specimens.

with the sexual stage, but without a valid description. C. purpurea life cycle was firstly fully described by Tulasne (1853). All the names mentioned are linked with rye ergot and therefore represent G1 species. In the same publication, Tulasne created name C. microcephala, ergot specific to Phragmites and Molinia, whose description fully corresponds to G2a species. Although Tulasne’s concept of C. purpurea and C. microcephala is clear and correct in the light of our data, he unfortunately used older epithets taken from poorly documented taxa, where the lack of existing specimens, host plant records and conidia description disable a link with the species treated here. Sphaeria purpurea Fr., a basionym of C. purpurea, was described based on H. C. F. Schumacher collection of stromata growing from sclerotia detached from an unidentified host grass (Fries 1823). We did not find Schumacher’s specimen in public herbaria and any of the species G1, G2 and G2a can be potentially represented under the name S. purpurea. Kentrosporium mitratum and K. microcephalum were described by Wallroth (1842) for stromata growing out of insect

larvae. K. microcephalum specimen was found at the site of an old charcoal kiln among colonist liverwort and mosses. However, Tulasne (1853), without having studied the actual specimens, suspected that Wallroth mistook sclerotia for larvae and based solely on the drawings in the Wallroth’s paper he synonymized K. mitratum with Claviceps purpurea and created a new combination, C. microcephala for his new species from arundinaceous grasses. We enquired at the National Museum in Prague and at the Institut de Botanique, Universite de Strasbourg harbouring the main parts of the Wallroth’s herbarium, but no such specimens have been found. No other details about K. microcephalum were published by Wallroth, but his contemporary colleague Kirchner (1862) reported the substrate of this specimen as a larva of Tinea (¼Phyllonorycter) cavella e a small moth with pupae similar to Claviceps sclerotia. The name K. microcephalum therefore refers most probably to unrelated genus Ophiocordyceps. Consequently, the name C. microcephala is excluded from Claviceps and we propose here a new name for this fungus. There are several taxa described from potential G2 hosts, having large conidia and in some cases also floating sclerotia, all attributes often found in G2 species. The only one pertaining to G2 species without any doubts is C. purpurea var. phalaridis (see below). Nevertheless, combination C. phalaridis is occupied by another name, C. phalaridis (Walker 2004) and therefore we are proposing a new name, C. humidiphila. The genus name itself is also not without problems. The Melbourne Botanical Congress has approved important changes to process of naming fungi, including the abolition of Article 59, that affect all pleomorphic fungi including Claviceps. Asexual morph-typified and sexual morph-typified names compete on an equal nomenclatural footing and the correct name should be selected based on the priority rule, but also following the key guidance to maintain “existing usage as far as possible” (Hawksworth 2011; McNeill et al. 2011). The valid names Spermoedia Fr. (1822) and Sphacelia v. (1827) typified by an asexual stage of C. purpurea have priLe ority against sexual genus Claviceps Tul. (1853). Consequently, sanctioned name Spermoedia clavus (DC.) Fr. (1822) has priority against Claviceps purpurea (Fr.) Tul. Hence, Spermoedia would be an older name for Claviceps, and Spermoedia clavus would be the correct name for the rye ergot; however, this is unacceptable for obvious reasons. Claviceps purpurea will be put on a proposed List of accepted names according to the new provisions of the Melbourne Code (Art. 14). r. 3 20: 45 Claviceps purpurea (Fr.) Tul. Ann. Sci. Nat. Bot. se (1853) MB#162059. Basionym: Sphaeria purpurea Fr., Syst. Mycol. (Lundae) 2: 325 (1823) Synonyms (the most important): Sclerotium clavus DC., in de Candolle & Lamarck, Fl. franc¸., Edn 3 (Paris) 5/6: 115 (1815) Spermoedia clavus (DC.) Fr., Syst. Mycol. (Lundae) 2(1): 268 (1822) v., Me m. Soc. Linn. Paris 5: 587 (1827) Sphacelia segetum Le Claviceps purpurea var. agropyri Tanda, J. Agric. Sci. Tokyo Nogyo Daigaku, Special Issue 5: 99 (1981) Neotype designated here: Czech Republic: Bohemia, dice, Lat. 50.48576056, Long. 14.70364667, on Secale Bezde


, PRM922706 (neotype, dried outova cereale, 2003, Coll. S. Paz culture on T2 agar), culture ex-epitype CCC771, PRM922707 (isoneotype). As E. M. Fries did not designated the type or provided an illustration of S. purpurea, we selected a dried culture for neotype. Habitat: The typical host of C. purpurea is Secale cereale and land grasses of the subfamily Pooideae (for e.g., Elymus, Bromus, and Lolium) growing in fields and open meadows or grasslands in temperate regions. Its occurrence was not confirmed on arundinoid grasses (Table S1 in Supplement material). There is a need for the revision of the host range using reliably identified C. purpurea collections. Distribution: Cosmopolite, it follows the distribution of Pooideae. It is reported from Eurasia, North and South Amer et al. 2000, this outova ica, South Africa and Australia (Paz study), and Japan (Tanaka 2008). Morphological description. The original description was provided by Tulasne (1853) and Tanda (1979, 81a,). Our description is based on sclerotia and conidia of 52 specimens (Table 1, Table S3 in Supplement material). Sclerotia dark brown to black with purple shades, very variable in length 3e400 mm in length (depending on the size of the host florets), often subulate or curved, typically not floating in fresh water, but small proportion floated (specimens from Glyceria and Melica) interior white. Sphacelia morph: conidia cylindrical to oval, average size very variable, 3.8e9.8 2.2e4.5 mm. Notable is a common presence of larger conidia on Briza media and on Nardus stricta (Fig 4).

19

Cultural characteristics: colonies (14 d, 24 C) on T2 medium average 57 mm in diameter (53e62 mm) with narrow and diffuse margin, plane, velvety, whitish, often with purple to lilac central zone in freshly isolated cultures, reverse ochre, later may be also lilac from the centre. Soluble pigments produced in both media. Notes. Although the species often has smaller conidia, larger dimensions matching the range of C. arundinis (G2a species, see below), C. spartinae and C. humidiphila can be found (Fig 4). Similarly, the sclerotia not floating on fresh water are a common feature, but exceptions can be found. Specimens that have non-floating sclerotia and small spores (˂ 7 mm), or those originating from the typical host genera (see above) seem to be the only ones ascribable to C. purpurea with some certainty, but molecular typing is necessary in other cases. C. purpurea var. agropyri Tanda is synonymized here with C. purpurea based on host species and conidia size (mean 5.7 3.0 mm). Other most important synonyms are listed above. et M. Kolarık, nom. nov. outova Claviceps humidiphila Paz (Fig 5) MB# 809157. Replaced synonym: Claviceps purpurea var. phalaridis Tanda, J. Agric. Sci. Tokyo Nogyo Daigaku 24: 84 (1979) MB#809155. Holotype: TUAMH PA820 (Tokyo University of Agriculture Mycological Herbarium, see Tanda 1979). Epitype designated here: Germany: Bavaria, Philippsreut, Lat. 48.856434, Long. , outova 13.676332, on Dactylis sp., 1998, Collector S. Paz PRM922708 (epitype, dried culture cultivated on T2 agar), culture ex-epitype CCC434, PRM922709 (sclerotia from the same collection).

Fig 5 e C. humidiphila. (A) CCC434, culture on T2 medium after 2 weeks AT 25 C. (B) PRM922709 conidia from Sphacelia morph. (C) PRM922709 sclerotia. Scale bar [ 10 mm.

20

Habitat: Various grasses from the subfamily Pooideae growing on meadows, wet meadows, river banks, and in forests. Typical hosts are Calamagrostis, Deschampsia caespitosa and Phalaris arundinacea. It was found also on Phragmites and Molinia which are typical C. arundinis hosts (Table S1 in Supplement material). Distribution: Europe from England to Turkey, USA and Japan (Tanaka 2008) (Table S1 in Supplement material), probably the same as C. purpurea. Uhlig et al. (2004) collected ergotized common grasses in Norway and DNA analysis confirmed that most of them were hosts of C. humidiphila. Morphological description. The description of sexual state was provided by Tanda (1979). Our description is based on sclerotia and conidia of 28 specimens (Table 1, Fig 4, Table S3 in Supplement material). Sclerotia dark brown to black, size depends on the host species, 0.2e15 0.3e1.4 mm, narrow or curved, often subulate, floating in fresh water, interior white. Sphacelia morph: cylindrical, average size very variable, 7.1e11.6 3.3e5.3 mm. Cultural characteristics: colonies (21 d, 24 C) on T2 medium average 54 mm (49e60 mm) in diameter with narrow and diffuse margin, plane, velvety, whitish with purple to lilac central zone in freshly isolated cultures, reverse ochre. Soluble pigments produced in both media. Notes. The species tends to have larger spores than C. purpurea, but conidia size is not a good predictor of species identity, without presence of other characters like typical hosts, habitat, and floating sclerotia. It generally overlaps with C. arundinis and C. spartinae in conidia size, ability of sclerotia to float, and colony appearance. In our study, we did not systematically study the sexual state and its usability for species differentiation is unclear. C. humidiphila as described by Tanda (1979) showed 1e11 stromata per sclerotium, stipe reddish orange or light red, 2e13 0.1e0.9 mm, capitulum deep purplish red, 0.1e1.6 mm; perithecium 161e217 91e13 mm, ascus 74e133 1.8e4.2 mm, ascospores 72e129 mm (mean. 97 mm) in length. It corresponds to the reliable descriptions of C. purpurea (Tulasne 1853; Tanda 1981a,b) and both species seems to be morphologically indistinguishable. Several names were used for ergot with floating sclerotia and/or larger conidia. Claviceps purpurea f. b. natans Phalaridis € ger (1922) was the name created for all species arundinaceae Sta with floating sclerotia (e.g., from Phalaris, Phragmites and Molinia) covering our concept of C. humidiphila and C. arundinis. € ger described Claviceps sesleriae, on Sesleria coerulea Later Sta and proved that it infected Melica nutans and M. uniflora but none of 16 grass species, representing typical or potential C. purpurea hosts (e.g., Secale cereale). The differentiating character was the conidial size (10.5e14 3.5e5.2 e 7 mm); therefore € ger set this species as an opposite to C. purpurea from Secale Sta cereale with smaller conidia. However, C. sesleriae cannot be synonymized with C. humidiphila, because its sclerotia lack € ger 1922). Our material from Sesleria the floating ability (Sta and Melica belongs to C. purpurea and has smaller conidia (mean 7.7e8.0 mm). Very large conidia are good indication of G2 species, but measurements can be also affected by contamination of the Sphacelia morph by Fusarium microconidia. Given the lack of other indicative characters and authentic deposited specimens we conclude, that C. sesleriae is not a welldocumented species and thus doubtful. The other names


potentially applicable to G2 species, having large conidia and suitable host species are C. purpurea var. alopecuri Tanda (1978) (Alopecurus, mean conidia size 8.1 3.7 mm), C. purpurea var. phalaridis Tanda (1979) (Phalaris and Calamagrostis, mean conidia size 10.3 4.3 mm), and C. purpurea var. dactylidis Tanda (1981b) (Dactylis, mean conidia size 9 3.2 mm). Nonauthentic recent specimens collected in Japan and determined as var. alopecuri and var. phalaridis belonged to G2 species based on ITS rDNA sequences (Tanaka 2008). In C. purpurea var. alopecuri and var. dactylidis the host species and conidia size fall within the range of both C. humidiphila and C. purpurea (Table S1 and S3 in Supplement material) and its identity is thus uncertain. Very large conidia and association with Phalaris, an exclusive G2 host, suggests C. purpurea var. phalaridis as an only proper name for G2 species. The name was already used for another ergot species (Claviceps phalaridis J. Walker 1957) therefore new name was created here. et M. Kolarık, sp. nov. (Fig 6) otouva Claviceps arundinis Paz MB# 809156. Etymology: from the Latin arundo, reed. Bude jovice, Haklovy Holotype: Czech Republic: Cesk e Vrbensky rybnık, Lat. 49.011779, Long. 14.433136, Dvory, Stary on Phragmites australis, 11. Jan. 2008, Coll. M. Kolarık, PRM922710 (holotype, dried culture on T2 agar), culture extype: CCC933, PRM922711 (isotype). Other representative material: PRM922712 (sclerotia and dried culture of CCC 1110), rybnık, on P. australis, PRM922713 (Czech R., Cernousy, Dubovy 2010, coll. M. Kolarık, sexual stage and sclerotia), PRM922714 € , on P. australis, 2008, coll. M. Kolarık, sexual (Finland, Svino stage and sclerotia). Habitat: Arundinoid grasses Phragmites and Molinia. Tanda (1977b) reported it also from another arundinoid grasss, Hakonechloa macra in Japan, based on morphological resemblance. This record was not proven by inoculation test or any other study and remains uncertain. The host grass Calamagrostis reported by Tulasne (1853) and repeated by other authors originated from mistaken identification of C. arundinis with Cordyceps purpurea var. acus Desm. (see ‘Other names linked € lsing & Tudzynski (1997) distinwith C. purpurea’). Jungehu guished a RAPD group consisted of collections from Phragmites, Molinia and Agrostis sp. We studied the authentic Agrostis isolate and confirmed its identity with C. arundinis and Agrostis represents thus yet another possible host. Distribution: Europe and probably also Japan and USA. Claviceps has been reported from Phragmites in the USA in Iowa, New Jersey. North Dakota, Oklahoma, and District of Columbia, where it was also recorded on Molinia, but no further details were given (Alderman et al. 2004); Tanda (1977a) reported it also from Japan. Morphological description. The original description was provided by Tulasne (1853). Our description is based on sclerotia and conidia of 24 specimens (Table 1, Table S3 in Supplement material) and on sex€, ual stage specimens from Phragmites (PRM922714, Svino near Cernousy, Finland; PRM922713, pond Dubovy CZ) and in les, 2009). a Molinia (CZ, Svatojirsky Sclerotia dark brown to black, 2e10 0.5e1 mm on Phragmites or more robust, 4e15 1e2.3 mm on Molinia, narrow or curved, often subulate, floating in fresh water, interior white. Stromata from Phragmites simple to two-forked; 1-6 per


21

Fig 6 e C. arundinis. (AeF) PRM922713 stromata. (G) PRM922714 stromata in situ on Phragmites inflorescence. PRM922713. (H) Ascospores. (I) Ascus. (J) Pallisade cells on the perithecium surface. (K) Perithecia. (L) conidia from the Spacelia morph. (M) CCC1111, conidia from the Sphacelia morph. (N) CCC933, obverse and reverse of the culture on T2 after 20 d at 25 C. (O) PRM922711, sclerotia. (P) CCC1136, sclerotia. (Q) CCC1110, sclerotia. Scale bar: AeB, EeG, OeQ [ 1 mm; C, D [ 0.5 mm; HeJ, L, M [ 10 mm, K [ 100 mm.


22

sclerotium, stipe 2e10 0.2e0.4 mm, straight or twisted, ochre to red, fleshy to purple-brown; capitulum 0.6e1.0 mm in diameter, globose, varies from cream, pale rosaceous, ochraceous to reddish brown, with reddish to purple ostioles making the whole head tuberculate or even moriform after desiccation; surface of the capitulum covered by a layer consisting of palisade cells (in 1e2 layers), which are transparent and responsible for the pale colour, palisade cells are cylindrical or clavate cells with irregular margin and thin cell wall, 10e20 8e12 mm; parenchymatic cells filling the interior of the stroma are smaller, with irregular shape and thick with cell walls encrusted and yellowish; perithecia ovoid. 156e227 74e125 mm; asci hyaline, cylindrical 82e120 2.5e3.5 mm with eight ascospores; acospores hyaline, filiform, 4e5 septa, 89e92 0.7e0.8 mm; stromata from Molinia differed by red-brown stipe, 6 0.3 mm and red-brown perithecial heads of 0.45e0.53 in diam. Sphacelia morph: conidia cylindrical, average size very variable, 6.0e11.1 2.8e5.2 (Fig 4). Cultural characteristics: colonies (21 d, 24 C) on T2 medium average diameter 44 mm (40e47 mm) with narrow and diffuse margin, plane, velvety, whitish with purple to lilac central zone in freshly isolated cultures, reverse ochraceous, sporulation abundant. Notes. This species corresponds with concept of Claviceps microcephala (Wallr.) Tul. This name was based on Kentrosporium microcephalum Wallr., fungus growing from the insect larva. Thus the new name is proposed here for the reed ergot. This species resembles C. humidiphila by its similarly sized and floating sclerotia, conidia size and shape and partial host overlap. We observed remarkably small capitula in our collections from both Phragmites and Molinia never exceeding 1 mm. Small capitulum size (0.1e1.6 mm) was reported by Tanda (1978, 1979) on C. purpurea var. phalaridis and on C. purpurea var. alopecuri (0.4e0.9). Overall coloration, presence of the mycelium at the stipe base and number of stromata per sclerotium were supposed to be differential characters from ‘C. purpurea’ by Tulasne (1853), but their significance was refuted by Petch (1935, 1937). Petch’s concept merging C. microcephala with ‘C. purpurea’, even when based on shallow proofs, was often used by other authors. Regarding the life cycle of C. arundinis, there was another €ger (1903), and € hn (1856), Sta question that Tulasne (1853), Ku Petch (1937) tried to address. Phragmites blooms from August to September (Haslam 1970) and Molinia from July to September, whereas the overwintering Phragmites sclerotia placed on the ground produced capitula and mature ascospores in the middle of July (Tulasne 1853). The development of capitula continued for several weeks or, in case of bigger Molinia scle€ hn rotia, up to two months after the germination started (Ku 1856). Petch (1937) observed in June germination of sclerotia from Phragmites that were laid out on sand in April, again producing ascospores long before the blooming of their natural hosts. We have observed the overwintering of inflorescences of a Phragmites stands in the Czech R. monthly in the years 2011e2014. Most of the seeds and sclerotia were still inside the glumes in May, even at the beginning of June. Therefore it is possible that the overlooked germination-delaying mechanism is the persistence of sclerotia in the dry inflorescences. et outova Claviceps spartinae (R. A. Duncan & J. F. White) Paz M. Kolarık stat. nov. MB#809158.

Basionym: Claviceps purpurea var. spartinae R. A. Duncan & J. F. White, Mycotaxon 81: 18 (2002) Type: Rutgers University Mycological Herbarium RUTPP3419 (see Duncan et al. 2002). Host spectrum: Host specific parasite of grasses from the tribe Chloridoidae (Spartina and Distichlis). See Duncan et al. (2002) for other details. Distribution: Coastal salt marshes of North America, Argentina, Uruguay (Duncan et al. 2002), introduced to British Isles (Raybould et al. 1998) and recently to continental Europe (Nehring et al. 2012) Morphology. From Duncan et al. (2002). Sclerotia 17.2 3.92 1.7 0.5 mm, purple brown or dark brown; Stromata 1e10 per stipe; stipe 4.6 3.5 1.2.5 1.73 mm, purple-brown; capitulum 1.3e0.4 mm in diameter, white to slightly tan, with reddish ostioles; perithecia 144.2 23.9 91.8 11.2 mm; ascospores 84.4 4.5 8 mm; conidia cylindrical, 8.1 1.8 4.1 1.3 mm.

Other names connected with C. purpurea r. III Cordyceps purpurea var. acus Desm., Ann Sci. Nat., Bot., se 14: 116 (1850). Doubtful name. No herbarium specimen exists, host identity is unclear. Description is based on small germinated sclerotia with tiny perithecial heads. Claviceps setulosa (Quel). Sacc. In Syll. Fung. 2. 564 (1883). Doubtful name. No herbarium specimen exists (see Langdon (1952) for discussion). Name created for a specimen originating probably from Poa was later synonymized with ‘C. purpurea’ by Grasso (1952). Its morphology fits both to C. purpurea and C. humidiphila. Claviceps purpurea var. wilsonii (Cooke) W.G. Sm., currently placed to Neobarya aurantiaca (Plowr. & A.S. Wilson) Samuels & Cand. (Candoussau et al. 2007) € ger Zbl. Bakt. II Natur Abt 17: 784 (1906). Claviceps sesleriae Sta Doubtful name. No herbarium specimen exists. Its identity with C. purpurea or C. humidiphila is unclear (see above). Claviceps purpurea f. b. poae Zbl. Bakt. II Natur Abt 20: 279 € ger (1903, 1908) erected this biological form for Poa (1908). Sta annua ergot, which failed to infect various grass genera (eg. Bromus, Deschampsia, Hordeum, Poa alpina). No herbarium specimens or morphological details were mentioned. Our collection from this grass belonged to C. humidiphila. Its identity with C. purpurea or C. humidiphila is unclear. Claviceps litoralis Kawat., Bot. Mag., Tokyo 59: 90 (1946) A doubtful name and species represents most probably C. purpurea or C. humidiphila. It was described from Elymus mollis (¼ Leymus mollis) in Japan (Kawatani 1946). The host grass occurs in Asia and North America. The morphological diagnosis of the species fully corresponds to both C. purpurea and C. humidiphila. Kawatani (1944) reported conidia size 3.118.5 2.3e7.1 mm and later Tanda & Kawatani (1980) provided dimensions of conidia from more specimens (average length ranges from 6.5 to 9.1 mm) and declared their ability to infect various land grasses. Langdon (1952) studied the original specimens (sclerotia only) and suspected their conspecificity with C. purpurea, but did not propose any taxonomic changes. We studied five collections from E. mollis sampled on the Pacific coast (British Columbia, Sargeant Bay) with conidia mean dimensions 7.4 3.4 and 6.6 3.3 mm. Based on PCR fingerprinting, ITS and RPB2


sequences (Genbank Acession no. LN626653-LN626656) they belonged to C. purpurea (see Analysis of ergot from E. mollis in Supplement material). Claviceps purpurea var. sasae Tanda, Bulletin of the Fuji Bamboo Gardens, 18: 34 (1973). This species described from the Sasa iwakiana and S. nikkoensis (Poaceae: Bambusoideae) differs by light orange capitulum, remarkably long ascospores (avg. 145 mm), long and sometimes also triangular conidia (avg. 12 5 mm) from all species of C. purpurea group. The host affinity and morphology suggests it to be a separate species. Claviceps purpurea var. alopecuri Tanda, J. Agric. Sci. Tokyo Nogyo Daigaku, 22: 295 (1978). Doubtful name. Its identity with C. purpurea or C. humidiphila is unclear (see above). Claviceps purpurea var. dactylidis Tanda, J. Agric. Sci. Tokyo Nogyo Daigaku 25: 266 (1981). Its identity with C. purpurea or C. humidiphila is unclear (see above). Claviceps microcephala (Wallr.) Tul., Annls. Sci. Nat., Bot., r. 3 20. 49 (1853). Identity of the basionyme, Kentrosporium se microcephalum Wallr., is unclear and this fungus should be excluded from Claviceps (see above).

Discussion The introduction of DNA analysis has shown that four species differing to various extent in their habitat preferences exist within Claviceps purpurea, a taxon formerly considered a wide-ranging and morphologically variable single species. Phylogenetic analyses have been used to resolve the species together with population genetic approach, as recommended € nig et al. (2007). The multilocus phylogenetic analysis by Gru with concatenated data (GCPSR), which is sensitive to shared sequence haplotypes between species, did not entirely resolve Claviceps humidiphila and Claviceps arundinis. However, the gsi (Cummings et al. 2008) and coalescent approach implemented in *BEAST (Heled & Drummond 2010) unequivocally separated these species. Population genetic analysis confirmed the recognition of four species with fixed differences and unique polymorphisms. High FST values documented the reproductive isolation and the absence of gene flow between the species. The number of fixed nucleotide positions (9.3 %) differentiating C. humidiphila and C. arundinis is similar to those found in cryptic species inside Paracoccidioides brasiliensis (Matute et al. 2006), Neofusicoccum parvum (Pavlic et al. 2009) or Penicillium chrysogenum (Henk et al. 2011). These values are relatively low in comparison with most other published cases such as Grosmannia clavigera or Blastomyces dermatitidis (Alamouti et al. 2011; Brown et al. 2013) where the level of fixed polymorphism was higher than 25 %. This suggests that C. arundinis, which is still sharing polymorphism in rDNA with C. humidiphila, is an incipient species. Closely related Claviceps species, i.e., Claviceps nigricans, Claviceps grohii, Claviceps zizaniae and Claviceps cyperi, occur in wet habitats and their host plants belong mostly to Cyper et al. 2008). As the newly described sister outova aceae (Paz species of C. purpurea also prefer humid or shady locations, it is probably the ancestral habitat of the whole group. The habitat preferences are reflected by a certain degree of host preferences which may be wide (C. purpurea on Triticeae,

23

Bromus, and Lolium spp., C. humidiphila preferring Agrostidinae) or narrow, as for the two arundinoid species colonized by C. arundinis. Similarly, only two chloridoid host genera, Distichlis and Spartina, have been confirmed for C. spartinae. Despite sharing the salt marsh habitat, these hosts are quite distant phylogenetically (Peterson et al. 2010). Due to the overlapping size ranges of conidia and host species it is difficult to assess the geographic distributions of C. purpurea and especially C. humidiphila without DNA analysis. However, also in the large-scale studies containing data about host and spore size from the UK (Loveless 1971) and USA (Alderman et al. 2004), longer conidia prevailed on Agrostidinae and Phalaridinae and shorter conidia occurred mostly on Triticeae, Bromus and Lolium. This suggests that the habitat/host preferences of C. purpurea and C. humidiphila are alike throughout Europe and North America. There were differences in the size of conidia from Meliceae between the European and US specimens. We have shown that despite the wet habitat, Meliceae was colonized by C. purpurea and the spore length was 6.6e8.3 mm (6.1e6.9 mm in Loveless’ papers), but Alderman et al. (2004) obtained values between 10.1 and 11.3 mm, which may point to a different population or presence of C. humidiphila. Long conidia in European C. purpurea have been also observed on Nardus (Loveless 1971) and Briza in this study; these species are not native to the North America. € ger (1903), many attempts at establishing Starting with Sta the host specificity groups have been published (for e.g., Baldacci & Forlani 1950; Mastenbroek & Oort 1941) but there was no general consensus (for review see Barger 1931; & Parbery 1998). The only way of outova Loveless 1971; Paz testing available at that time was a cross-inoculation experiment but Campbell (1957) has shown that an application of aggressive inoculation methods (clipping of glumes before spraying, direct injection) can even produce an infection of Sporobolus and Setaria with an isolate from rye. Formation of sphacelia and honeydew on an untypical host is quite common, as it may increase dispersal chances, but the production of mature sclerotia on such a host often fails (Tanda 1979; et al. 2002). outova Paz Molecular dating placed the divergence (7.83 Ma) between the “wet” clade and C. purpurea in the Late Miocene. At that time, major climatic and vegetative changes were occurring worldwide. Climate cooling was accompanied by formation of North Hemisphere ice sheets and increased aridity, in Europe also seasonality (Mosbrugger et al. 2005; Utescher et al. 2011). The cooling continued through Pliocene. These conditions promoted the expansion of grasslands (Edwards et al. 2010; € mberg 2011) and reduction of freshwater wet habitats. Stro The emergence of C. purpurea lineage colonizing C3 land grasses as well as that of C. spartinae (2.9 Ma) originally occurring in salt marshes along the Atlantic coast of the Americas might have been responses to these changes. The expansion time of C. purpurea (360 Ka) coincides with the strong glacial period of the marine isotope stage (MIS) 10 (Lang & Wolff 2011) therefore any relationship to agriculture seems improbable. The divergence of C. humidiphila and C. arundinis (1.17 Ma) and their demographic expansions 503 Ky (MIS 13, weak interglacial) and 736 Ky (MIS 18, strong glacial), respectively, fall into the Mid-Pleistocene Revolution’ (MPR), occurring broadly

24

between 1.2 and 0.5 Ma (Head & Gibbard 2005). Leavitt et al. (2012a) found similar old demographic expansions predating the Last Glacial Maximum in various species of Melanohalea lichenized fungi. The MPR period witnessed changes of periodicity and amplitude of the glacialeinterglacial cycles from 41 Ka to ca 100 Ka and these oscillations forced populations to retreat to lower latitudes and altitudes and then again colonize newly deserted areas. We provided the first complex insight in the evolution of C. purpurea species complex and delimited four species using advanced population genetics analyses. We hope that our taxonomic analysis solve the chaos prevailing in this species group. We also showed that the host speciation take place here, similarly to the situation in other ergot species. I addition the combined effect of habitat and host speciation occurred in case of C. purpurea and C. humidiphila. Both species et al. 2000) but they outova produce dangerous alkaloids (Paz only partially overlap in the host species spectrum. The further study of the host preference of “rye ergot” C. purpurea can help in development of proper management against this pest affecting rye fields.

Acknowledgements Funding for this research has been provided through grants 13-00788S) and Texas from Czech Science Foundation (GACR, AgriLife Research (Research Subcontract 470222). We thank to , D. Stanc ık, and J. Malıc ek for the determination of J. Markova the grass species.

Appendix A. Supplementary data Supplementary data related to this article can be found at http://dx.doi.org/10.1016/j.funbio.2014.10.003.

references

Aguileta G, Marthey S, Chiapello H, Lebrun MH, Rodolphe F, Fournier E, Gendrault-Jacquemard A, Giraud T, 2008. Assessing the performance of single-copy genes for recovering robust phylogenies. Systematic Biology 57: 613e627. Alamouti SM, Wang V, DiGuistini S, Six DL, Bohlmann J, Hamelin RC, Feau N, Breuil C, 2011. Gene genealogies reveal cryptic species and host preferences for the pine fungal pathogen Grosmannia clavigera. Molecular Ecology 20: 2581e2602. Alderman SC, Halse RR, White JF, 2004. A reevaluation of the host range and geographical distribution of Claviceps species in the United States. Plant Disease 88: 63e81. Amo de Paz G, Cubas P, Divakar PK, Lumbsch HT, Crespo A, 2011. Origin and diversification of major clades in parmelioid lichens (Parmeliaceae, Ascomycota) during the Paleogene inferred by Bayesian analysis. PLoS ONE 6: e28161. Atanasoff D, 1920. Ergot of Grains and Grasses. Office of Cereal Investigations, Bureau of Plant Industry, United States Department of Agriculture. Avise JC, 2000. Phylogeography: the history and formation of species. Harvard University Press, Cambridge.


Baldacci E, Forlani R, 1950. Ricerche sulla spezializzazione della Claviceps purpurea. Phytopathologische Zeitschrift 17: 81e84. Barger G, 1931. Ergot and Ergotism. Gurney and Jackson. United Kingdom, London. Brown EM, McTaggart LR, Zhang SX, Low DE, Stevens DA, Richardson SE, 2013. Phylogenetic analysis reveals a cryptic species Blastomyces gilchristii, sp. nov. within the human pathogenic fungus Blastomyces dermatitidis. Plos One 8: e59237. Campbell WP, 1957. Studies on ergot infection in gramineous hosts. Canadian Journal of Botany/Revue Canadienne de Botanique 35: 315e320. mez-Bolea A, Læssøe T, Lowen R, Candoussau F, Boqueras M, Go Rogers JD, Rossman AY, Samuels GJ, 2007. Observations on Neobarya, including some new species and new combinations. Sydowia 59: 179e215. Castoe TA, Spencer CL, Parkinson CL, 2007. Phylogeographic structure and historical demography of the western diamondback rattlesnake (Crotalus atrox): A perspective on North American desert biogeography. Molecular Phylogenetics and Evolution 42: 193e212. Cummings MP, Neel MC, Shaw KL, 2008. A genealogical approach to quantifying lineage divergence. Evolution 62: 2411e2422. de Candolle AP, 1815. Flore franc¸aise, 3 edn. Desray, Paris. de Vienne DM, Giraud T, Martin OC, 2007. A congruence index for testing topological similarity between trees. Bioinformatics 23: 3119e3124. Douhan GW, Smith ME, Huyrn KL, Westbrook A, Beerli P, Fisher AJ, 2008. Multigene analysis suggests ecological speciation in the fungal pathogen Claviceps purpurea. Molecular Ecology 17: 2276e2286. Drummond AJ, Suchard MA, Dong X, Rambaut A, 2012. Bayesian phylogenetics with BEAUti and the BEAST 1.7. Molecular Biology and Evolution 29: 1969e1973. Duncan Jr RA, Sullivan R, Alderman SC, Spatafora JW, White Jr JF, 2002. Claviceps purpurea var. spartinae var. nov.: An ergot adapted to the aquatic environment. Mycotaxon 81: 11e25. € mberg C, Smith S, C4 Grasses ConEdwards E, Osborne C, Stro sortium, Bond W, Christin P, Cousins A, Duvall M, Fox D, Freckleton R, Ghannoum O, Hartwell J, Huang Y, Janis C, Keeley J, Kellogg E, Knapp A, Leakey A, Nelson D, Saarela J, Sage R, Sala O, Salamin N, Still C, Tipple B, 2010. The origins of C4 grasslands: integrating evolutionary and ecosystem science. Science 328: 587e591. Excoffier L, 2004. Patterns of DNA sequence diversity and genetic structure after a range expansion: lessons from the infiniteisland model. Molecular Ecology 13: 853e864. Excoffier L, Lischer HEL, 2010. Arlequin suite ver 3.5: a new series of programs to perform population genetics analyses under Linux and Windows. Molecular Ecology Resources 10: 564e567. Fisher AJ, Gordon TK, di Tomaso JM, 2005. Geographic distribution and diversity in Claviceps purpurea from salt marsh habitats and characterization of Pacific coast populations. Mycological Research 109: 439e446. €ren Krankheiten der Pflanzen. Frank AB, 1896. Die pilzparasita Trewendt, Breslau. Fries EM, 1823. Systema Mycologicum. Berling, Lund. Fu Y-X, 1997. Statistical tests of neutrality of mutations against population growth, hitchhiking and background selection. Genetics and Molecular Biology 147: 913e925. Fu Y-X, Li W-H, 1993. Statistical tests of neutrality of mutations. Genetics and Molecular Biology 133: 693e709. Gardes M, Bruns TD, 1993. ITS primers with enhanced specificity for basidiomycetes d application to the identification of mycorrhizae and rusts. Molecular Ecology 2: 113e118. Gray AJ, Drury M, Raybould AF (eds), 1990. Spartina and the Ergot Fungus Claviceps purpurea e a singular contest?. Blackwell Scientific, Oxford.


€ nig CR, Brunner PC, Duo A, Sieber TN, 2007. Suitability of Gru methods for species recognition in the Phialocephala fortiniiAcephala applanata species complex using DNA analysis. Fungal Genetics and Biology 44: 773e788. Guibourt N-J-B-G, 1848. Sur l’ergot du seigle. Journal de Pharmacie et de Chimie 13: 267e273. Harpending RC, 1994. Signature of ancient population growth in a low-resolution mitochondrial DNA mismatch distribution. Human Biology 66: 591e600. Haslam SM, 1970. The development of the annual population in Phragmites communis Trin. Annals of Botany 34: 571e591. Hawksworth DL, 2011. A new dawn for the naming of fungi: impacts of decisions made in Melbourne in July 2011 on the future publication and regulation of fungal names. MycoKeys 1: 7e20. Head MJ, Gibbard PL, 2005. Early-Middle Pleistocene transitions: an overview and recommendation for the defining boundary. In: Head MJ, Gibbard PL (eds), Early-Middle Pleistocene Transitions: The Land-Ocean Evidence. Special Publication. Geological Society of London, London, pp. 1e18. Heled J, Drummond AJ, 2010. Bayesian inference of species trees from multilocus data. Molecular Biology and Evolution 27: 570e580. Henk DA, Eagle CE, Brown K, Van Den Berg MA, Dyer PS, Peterson SW, Fisher MC, 2011. Speciation despite globally overlapping distributions in Penicillium chrysogenum: the population genetics of Alexander Fleming’s lucky fungus. Molecular Ecology 20: 4288e4301. Hudson RR, Slatkin M, Maddison WP, 1992. Estimation of levels of gene flow from DNA sequence data. Genetics 132: 583e589. € lsing U, Tudzynski P, 1997. Analysis of genetic diversity in Jungehu Claviceps purpurea by RAPD markers. Mycological Research 101: 1e6. Katoh K, Toh H, 2008. Improved accuracy of multiple ncRNA alignment by incorporating structural information into a MAFFT-based framework. BMC Bioinformatics 9: 212. Kawatani T, 1946. Clavicipitis species nova parasitica ad Elymum mollem Trin. Botanical Magazine, Tokyo 59: 90e91. Kirchner LA, 1862. Die Pilzsucht der Insecten. Lotos 12: 73e79. € € hn J, 1856. Uber Ku die Entwickelung der Claviceps aus ihren Sclerotien. Hedwigia 1: 109e112. Lang N, Wolff EW, 2011. Interglacial and glacial variability from the last 800 ka in marine ice and terrestrial archives. Climate of the Past 7: 361e380. Langdon RFN, 1952. Studies on Ergot. University of Queensland, Brisbane, Australia. Leavitt SD, Esslinger TL, Divakar PK, Lumbsch HT, 2012a. Miocene and Pliocene dominated diversification of the lichen-forming fungal genus Melanohalea (Parmeliaceae, Ascomycota) and Pleistocene population expansions. BMC Evolutionary Biology 12: 176. Leavitt SD, Esslinger TL, Lumbsch HT, 2012b. Neogene-dominated diversification in neotropical montane lichens: Dating divergence events in the lichen-forming fungal genus Oropogon (Parmeliaceae). American Journal of Botany 99: 1764e1777. veille MJH, 1827. Sur l’ergot, ou nouvelles recherches sur la Le re sous le triple rapport cause et les effets de l’ergot conside dicinal. Memoires de la Societe Linnebotanique, agricole et me enne de Paris 5: 565e579. Librado P, Rozas J, 2009. DnaSP v5: a software for comprehensive analysis of DNA polymorphism data. Bioinformatics 25: 1451e1452. Liu YJ, Whelen S, Hall BD, 1999. Phylogenetic relationships among ascomycetes: Evidence from an RNA polymerase II subunit. Molecular Biology and Evolution 16: 1799e1808.

25

Loveless AR, 1971. Conidial evidence for host restriction in Claviceps purpurea. Transactions of the British Mycological Society 56: 419e434. Loveless A, Peach JM, 1986. Evidence from ascospores for host restriction in Claviceps purpurea. Trans Br Mycol Soc 86: 603e610. Mastenbroek C, Oort AJP, 1941. Het voorkomen van moederkoren (Claviceps) op granen en grassen en de specialisatie van die moederkorenschimmel. Tijdschrift over Plantenziekten 47: 165e185. Matute DR, McEwen JG, Puccia R, Montes BA, San-Blas G, ~ o-Vega G, Bagagli E, Rauscher JT, Restrepo A, Morais F, Nin 2006. Cryptic speciation and recombination in the fungus Paracoccidioides brasiliensis as revealed by gene genealogies. Molecular Biology and Evolution 23: 65e73. McNeill J, Turland NJ, Monro AM, Lepschi BJ, 2011. XVIII International Botanical Congress: Preliminary mail vote and report of Congress action on nomenclature proposals. Taxon 12: 1507e1520. Mosbrugger V, Utescher T, Dilcher DL, 2005. Cenozoic continental climatic evolution of Central Europe. Proceedings of the National Academy of Sciences, USA 102: 14964e14969. Nehring S, Boestfleisch C, Buhmann A, Papenbrock J, 2012. The North American toxic fungal pathogen G3 Claviceps purpurea (Fries) Tulasne is established in the German Wadden Sea. BioInvasions Records 1: 5e10. Nei M, 1987. Molecular Evolutionary Genetics. Columbia University Press, New York. O’Donnell K, Cigelnik E, 1997. Two divergent intragenomic rDNA ITS2 types within a monophyletic lineage of the fungus Fusarium are nonorthologous. Molecular Phylogenetics and Evolution 7: 103e116. Pavlic D, Slippers B, Coutinho TA, Wingfield MJ, 2009. Multiple gene genealogies and phenotypic data reveal cryptic species of the Botryosphaeriaceae: A case study on the Neofusicoccum parvum/N. ribis complex. Molecular Phylogenetics and Evolution 51: 259e268. S, Caga R, Honza tko A, 2002. Host speoutova Paz s B, Kolınska cialization of different populations of ergot fungus (Claviceps purpurea). Czech Journal of Genetics and Plant Breeding 38: 75e81. S, Ol J, Linka M, Kolınska R, Flieger M, 2000. outova Paz sovska Chemoraces and habitat specialization of Claviceps purpurea populations. Applied and Environmental Microbiology 66: 5419e5425. S, Ol J, Sulc kova M, Flieger M, 2008. outova Paz sovska M, Chudıc Claviceps nigricans and Claviceps grohii: their alkaloids and phylogenetic placement. Journal of Natural Products 71: 1085e1188. S, Parbery DP, 1998. The phylogeny and taxonomy of outova Paz the genus Claviceps. In: Kren V, Cvak L (eds), The Genus Claviceps. Harwood Academic Publishers, Amsterdam, The Netherlands, pp. 57e77. Peterson PM, Romaschenko K, Johnson G, 2010. A classification of the Chloridoideae (Poaceae) based on multi-gene phylogenetic trees. Molecular Phylogenetics and Evolution 55: 580e598. Petch T, 1935. Claviceps. Naturalist (Hull) 942: 151e155. Petch T, 1937. More about Claviceps. Naturalist (Hull) 961: 25e28. Ramos-Onsins SE, Rozas J, 2002. Statistical properties of new neutrality tests against population growth. Molecular Biology and Evolution 19: 2092e2100. Rehner SA, Buckley E, 2005. A Beauveria phylogeny inferred from nuclear ITS and EF1-a sequences: evidence for cryptic diversification and links to Cordyceps teleomorphs. Mycologia 97: 84e98. Rogers AR, Harpending H, 1992. Population growth makes waves in the distribution of pairwise genetic differences. Molecular Biology and Evolution 9: 552e569.

26

Silvestro D, Michalak I, 2010. raxmlGUI: a graphical front-end for RAxML Available at: http: //sourceforge.net/projects/raxmlgui/.4 € ger R, 1903. Infectionsversuche mit Gramineen-bewohnenden Sta Claviceps-Arten. Botanisches Zeitung 61: 111e118. € ger R, 1906. Neuer Beitrag zur Biologie des Mutterkorns. ZenSta € r Bakteriologie, Parasitenkunde, Infektionkrankheiten und tralblatt fu Hygiene Abteilung II 17: 773e784. € ger R, 1922. Beitra € ge zur Verbreitungsbiologie der ClavicepsSta € r Bakteriologie, Parasitenkunde, InfekSklerotien. Zentralblatt fu tionkrankheiten und Hygiene Abteilung II 56: 329e339. Stamatakis A, 2006. RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 22: 2688e2690. € mberg CAE, 2011. Evolution of grasses and grassland Stro ecosystems. Annual Review of Earth and Planetary Sciences 39: 517e544. Sukumaran J, Holder MT, 2010. DendroPy: A Python library for phylogenetic computing. Bioinformatics 26: 1569e1571. Tajima F, 1983. Evolutionary relationships of DNA sequences in finite populations. Genetics 105: 437e460. Tajima F, 1989. Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics and Molecular Biology 123: 585e595. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S, 2011. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution 28: 2731e2739. Tanaka E, 2008. Molecular phylogenetic analysis of ergot fungi to presume the parasitic characteristics. Proceedings of the Association for Plant Protection of Hokuriku 57: 35e43. Tanda S, 1977a. Mycological studies on the ergot in Japan (1). Ergots on Phragmites spp. Journal of Agricultural Science e Tokyo Nogyo Daigaku 22: 193e203. Tanda S, 1977b. Mycological studies on the ergot in Japan. 2. Claviceps microcephala (Wallr.) Tul. parasitic on Hakonechloa macra Makino. Journal of Agricultural Science, Tokyo Nogyo Daigaku 22: 204e207. Tanda S, 1978. Mycological studies on the ergot in Japan (3). A new variety of Claviceps purpurea Tul. parasitic on Alopecurus aequalis Sobol. var. amurensis Ohwi. Journal of Agricultural Science e Tokyo Nogyo Daigaku 22: 293e299. Tanda S, 1979. Mycological studies of ergot in Japan. IX. Distinct variety of C. purpurea Tul. on Phalaris arundinacea L. and P. arundinacea var. picta L. Journal of Agricultural Sciences (Tokyo) 24: 79e95.


Tanda S, 1981a. Mycological studies on the ergot in Japan (14). Ergots on Agropyron spp. Journal of Agricultural Science e Tokyo Nogyo Daigaku Commemoration Number of the 90th Anniversary of Foundation 85e114. Tanda S, 1981b. Mycological studies on the ergot in Japan (16). Ergots on orchard grass, Dactylis glomerata L. Journal of Agricultural Science e Tokyo Nogyo Daigaku 25: 263e271. Tanda S, Kawatani T, 1980. Mycological studies on the ergot in Japan (12). Host range and morphology of Claviceps litoralis Kawatani. Journal of Agricultural Science e Tokyo Nogyo Daigaku 24: 281e292. Taylor JW, Jacobson DJ, Kroken S, Kasuga T, 2000. Phylogenetic species recognition and species concepts in fungi. Fungal Genetics and Biology 31: 21e32. moire sur l’ergot des Glumace es. Annales Tulasne ELR, 1853. Me des Sciences Naturelles Botanique, Serie 3 20: 5e56. € hme M, Mosbrugger V, 2011. The Neogene of Utescher T, Bo Eurasia: Spatial gradients and temporal trends e the second synthesis of NECLIME. Palaeogeography, Palaeoclimatology, Palaeoecology 304: 196e201. Versalovic J, Koeuth T, Lupski JR, 1991. Distribution of repetitive DNA sequences in eubacteria and application to fingerprinting of bacterial genomes. Nucleic Acids Research 19: 6823e6831. Walker J, 2004. Claviceps phalaridis in Australia: biology, pathology and taxonomy with a description of the new genus Cepsiclava (Hypocreales, Clavicipitaceae). Australasian Plant Pathology 33: 211e239. Wallroth KFW, 1842. Zur Naturgeschichte der myketischen Entomo€ge zur Botanik. Friedrich Hoffmeister, Leipzig, phyten, Beitra Germany 147e167. Wang H-Y, Guo S-Y, Huang M-R, Lumbsch HT, 2010. Ascomycota has a faster evolutionary rate and higher species diversity than Basidiomycota. Science China Life Sciences 53: 1163e1169. White TJ, Bruns T, Lee S, Taylor J, 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ (eds), PCR Protocols: a guide to methods and applications. Academic Press, San Diego, pp. 315e322. Woerner AE, Cox MP, Hammer MF, 2007. Recombination-filtered genomic datasets by information maximization. Bioinformatics 23: 1851e1853. Yoshioka K, 2002. KyPlot e a user-oriented tool for statistical data analysis and visualization. Computational Statistics 17: 425e437. Zwickl DJ, 2006. Genetic algorithm approaches for the phylogenetic analysis of large biological sequence datasets under the maximum likelihood criterion Ph.D. Dissertation. The University of Texas at Austin.

Variability of requirements to fermentation media in Claviceps purpurea strains.

Purification and characterization of dimethylallyl tryptophan synthase from Claviceps purpurea.

Metabolism of the germinating sclerotium of Claviceps purpurea.

Identification and characterization of the ergochrome gene cluster in the plant pathogenic fungus Claviceps purpurea.

De novo biosynthesis of cytokinins in the biotrophic fungus Claviceps purpurea.

Production of beta-ergokryptine by a strain of Claviceps purpurea (Fr.) Tul. in submerged culture.

Efficient transformation of Claviceps purpurea using pyrimidine auxotrophic mutants: cloning of the OMP decarboxylase gene.

Extrachromosomal genetics of Claviceps purpurea : I. Mitochondrial DNA and mitochondrial plasmids.

Activation of ergot alkaloid biosynthesis in prototrophic isolates by Claviceps purpurea protoplast fusion.

Coalescent-based species delimitation approach uncovers high cryptic diversity in the cosmopolitan lichen-forming fungal genus Protoparmelia (Lecanorales, Ascomycota).

Species delimitation using genome-wide SNP data.

Integrative taxonomy and phylogeny-based species delimitation of Philippine water monitor lizards (Varanus salvator Complex) with descriptions of two new cryptic species.

Simple sequence repeat markers that identify Claviceps species and strains.

The cellular role of nitrogen in the biosynthesis of alkaloids by submerged culture of Claviceps purpurea (Fr.) Tul.

Quantitative molecular diagnostic assays of grain washes for Claviceps purpurea are correlated with visual determinations of ergot contamination.

Phylogenetic species delimitation for crayfishes of the genus Pacifastacus.

The Epipolythiodiketopiperazine Gene Cluster in Claviceps purpurea: Dysfunctional Cytochrome P450 Enzyme Prevents Formation of the Previously Unknown Clapurines.

Characterization of the mitogenome of Uropsilus gracilis and species delimitation.

DNA barcoding and species delimitation of Chaitophorinae (Hemiptera, Aphididae).

Rarity and Incomplete Sampling in DNA-Based Species Delimitation.

Upstream analyses create problems with DNA-based species delimitation.

Treatment of infections by cryptic Aspergillus species.

Unguided species delimitation using DNA sequence data from multiple Loci.

Species Delimitation and Lineage Separation History of a Species Complex of Aspens in China.