Accepted Manuscript Title: Dehydration induces expression of GALACTINOL SYNTHASE and RAFFINOSE SYNTHASE in seedlings of pea (Pisum sativum L.) Author: Lesław B. Lahuta Wioletta E. Pluskota Joanna Stelmaszewska Joanna Szabli´nska PII: DOI: Reference:

S0176-1617(14)00119-9 http://dx.doi.org/doi:10.1016/j.jplph.2014.04.012 JPLPH 51940

To appear in: Received date: Revised date: Accepted date:

5-2-2014 17-3-2014 14-4-2014

Please cite this article as: Lahuta LB, Pluskota WE, Stelmaszewska J, Szabli´nska J, Dehydration induces expression of GALACTINOL SYNTHASE and RAFFINOSE SYNTHASE in seedlings of pea (Pisum sativum L.), Journal of Plant Physiology (2014), http://dx.doi.org/10.1016/j.jplph.2014.04.012 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Dehydration induces expression of GALACTINOL SYNTHASE and RAFFINOSE SYNTHASE in seedlings of pea (Pisum sativum L.)

ip t

Lesław B. Lahuta*, Wioletta E. Pluskota, Joanna Stelmaszewska, Joanna Szablińska University of Warmia and Mazury in Olsztyn, Department of Plant Physiology, Genetics and

cr

Biotechnology, 10-718 Olsztyn, ul. Oczapowskiego 1A/103, Poland

us

*Corresponding author: [email protected]

Summary

an

The exposition of 7-day-old pea seedlings to dehydration induced sudden changes in the

M

concentration of monosaccharides and sucrose in epicotyl and roots tissues. During 24h of dehydration, the concentration of glucose and, to a lesser extent, fructose in seedling tissues

d

decreased. The accumulation of sucrose was observed in roots after 4 h and in epicotyls after

te

8 h of stress. Epicotyls and roots also began to accumulate galactinol and raffinose after 8 h of stress, when small changes in the water content of tissues occurred. The accumulation of

Ac ce p

galactinol and raffinose progressed parallel to water withdrawal from tissues, but after seedling rehydration both galactosides disappeared. The synthesis of galactinol and raffinose by an early induction (during the first hour of treatment) of galactinol synthase (PsGolS) and raffinose synthase (PsRS) gene expression as well as a later increase in the activity of both enzymes was noted. Signals possibly triggering the induction of PsGolS and PsRS gene expression and accumulation of galactinol and raffinose in seedlings are discussed.

Key words: Pea; Seedling; Dehydration; Galactinol synthase; Raffinose synthase Abbreviations: RFOs – raffinose family oligosaccharides, GolS – galactinol synthase, RS – raffinose synthase

1 Page 1 of 33

Introduction Soluble carbohydrates, products of primary metabolism, play a variety of functions in plants. Among sugars, sucrose and raffinose family oligosaccharides (RFOs) represented by

ip t

raffinose, stachyose and verbascose are the focus of much attention, owing to their protective role in tissue tolerance to abiotic stresses. RFOs are ubiquitous storage material in seeds

cr

(Obendorf and Górecki, 2012) or in vegetative tissues (Bachmann and Keller, 1995; Nägele and Hayer, 2013), and in some plant species they are used for the transport of carbon

us

skeletons from source to sink tissues (Keller and Pharr, 1996). RFOs are not transported to developing seeds; instead, they are synthesized de novo in both embryonic and seed coat

an

tissues (Peterbauer and Richter, 2001). The biosynthesis of RFOs is initiated by the synthesis

M

of galactinol (1-O--D-galactopyranosyl-L-myo-inositol) from UDP-galactose and myoinositol (catalyzing by galactinol synthase, GolS, EC 2.4.1.123), an essential galactosyl

d

residues donor for the synthesis of RFOs. The RFOs biosynthetic pathway includes the

te

transfer of galactosyl residue from galactinol to sucrose by raffinose synthase (RS, EC 2.4.1.82), production of raffinose and transfer of galactose to raffinose and stachyose by

Ac ce p

multifunctional stachyose synthase (STS, EC 2.4.1.67), producing stachyose and verbascose, respectively (Peterbauer and Richter, 2001). Raffinose, stachyose and verbascose sequentially accumulate late in seed maturation, and their accumulation is accelerated by natural or precocious seed maturation drying (Górecki et al., 2000a). In developing and maturing seeds, the accumulation of RFOs during the drying process coincides with the acquisition of desiccation tolerance (Obendorf, 1997; Górecki et al., 2000b). RFOs in maturing seeds have been proposed to play various roles in desiccation tolerance as compatible solutes (Obendorf, 1997) involved in the osmotic potential of tissues, or agents stabilizing the macromolecules and glassy state in dry seeds (Hoekstra et al. 2001), which can be important for seed longevity (Horbowicz and Obendorf, 1994; Verdier et al., 2013). As storage material, RFOs are quickly

2 Page 2 of 33

degraded during seeds germination (Górecki et al., 2000b). In the embryonic axis, the disappearance of RFOs determinates the seedling’s initial growth rate (Blöchl et al., 2007; Lahuta and Goszczyńska, 2009) and coincides with the loss of tissue desiccation tolerance

ip t

(Obendorf, 1997). However, seedlings seem to retain their ability to synthesize raffinose and stachyose, which is revealed only under water stress conditions (Downie et al., 2003; Lahuta

cr

and Górecki, 2011; Brenac et al. 2013).

The accumulation of RFOs in vegetative tissues of different plant species in response

us

to abiotic stresses, like drought, salinity, cold, heat, osmotic and oxidative stress, discovered in the last decade, can be a promising goal for biotechnology of crops (Toldi et al., 2009), and

an

has recently been reviewed in detail (ElSayed et al., 2014). The biosynthesis of galactinol

M

(and raffinose) under stress conditions is triggered by the expression of galactinol synthase genes (Taji et al., 2002; Kant et al., 2008; Evers et al., 2010; Weston et al., 2011; Wang D et

d

al., 2012; Zhou et al., 2013) and expression of genes encoding UDP-glucose-4-epimerase,

te

catalyzing the formation of UDP-galactose, necessary for synthesis of galactinol (Liu et al., 2007; Evers et al., 2010). In effect, tissues accumulate increased amounts of galactinol and

Ac ce p

raffinose and indicate elevated tolerance to some abiotic stresses. The over-expression of galactinol synthase genes increases tolerance to multiple stresses in transgenic tobacco plants (Zhuo et al., 2013) and tolerance to drought (Taji et al., 2002), high salinity and osmotic stresses (Sun et al., 2013) in Arabidopsis thaliana. Moreover, the over-expression of myoinositol phosphate synthase gene (MIPS) in tobacco increases MIPS activity and levels of myo-inositol, galactinol and raffinose, resulting in enhanced resistance to chilling, drought and salt stresses in transgenic tobacco plants (Tan et al., 2013). Although increasing concentration of myo-inositol can stimulate the accumulation of RFOs in both seeds (Karner et al., 2004) and vegetative tissues (Valluru and van den Ende, 2011; Tan et al., 2013), the mechanism of this stimulation remains to be explained. Changes in the expression of raffinose

3 Page 3 of 33

synthase genes in vegetative tissues (mostly in leaves) under abiotic stresses have recently been demonstrated in rice (Wu et al., 2009; Saito and Yoshida, 2011), Arabidopsis (Kant et al., 2008; Egert et al., 2013), poplar (Ko et al., 2011), cucumber (Sui et al., 2012), maize

ip t

(Zhou M et al., 2012) and pea (Lucau-Danilla et al., 2012). The induced or increased accumulation of raffinose can reinforce plants’ stress tolerance (ElSayed et al., 2014).

cr

Mature or expanded leaves, shoots and roots are predominant objects in studies

concerning the participation of RFOs in abiotic stress tolerance of vegetative tissues (ElSayed

us

et al., 2014). However, during seed germination and seedling establishment, tissues are most susceptible to water stress, and the ability to survive stress reflects on the plant development.

an

Therefore, changes in metabolism during the early response of seedlings to dehydration need

M

deeper explanation.

Several-day-old seedlings are able to accumulate raffinose after 1-2 days of

d

dehydration (Bogdan and Zagdańska, 2006; Zhou M et al., 2012), chilling (Saito and Yoshida,

te

2011), salinity (Morsy et al., 2007) and osmotic stress (Lahuta and Górecki, 2011). Although the amounts of raffinose accumulated under stress conditions are low and insufficient for

Ac ce p

instilling stress tolerance in seedlings, seedlings can be a good object for study of mechanisms regulating synthesis of RFOs in response to abiotic stresses. In contrast to fully expanded leaves, shoots and roots, in which raffinose appear after a few days of stress duration (ElSayed et al., 2014), seedlings indicate the ability to an earlier response (Lahuta and Górecki, 2011). We have found that osmotic stress induces the activity of galactinol synthase and raffinose synthase in 7-day-old winter vetch seedlings during the first 6 h of treatment, and tissues transiently accumulated appropriate galactosides (Lahuta and Górecki, 2011). However, the expression levels of the genes involved in the above process during osmotic stress remained unexplained. The results of the present studies demonstrate, for the first time, the dynamic changes in concentrations of soluble carbohydrates, levels of the expression of

4 Page 4 of 33

pea GALACTINOL SYNTHASE (PsGolS) and RAFFINOSE SYNTHASE (PsRS) genes, activity of both enzymes and accumulation of galactinol and raffinose at early response of 7-day-old pea seedlings to dehydration.

ip t

Material and methods Plant material

cr

Seeds of pea (Pisum sativum L.) cv Ramzes were surface sterilized in 60% ethanol:water

solution for 1 min, rinsed several times in sterilized double distilled water, placed (25 seeds in

us

each of 20 replicates) on wet sheet germination paper (Eurochem BDG, Poland), rolled and transferred into 250 mL glass cylinders. After addition of 50 mL water, the cylinders were

an

incubated in a germination chamber (ILW 115-T STD, Pol-Eko-Aparatura, Poland) at 22°C in

M

the dark for 7 days. The content of soluble carbohydrates was monitored in the axis and cotyledons to assess the stage at which tissues did not contain any detectable amounts of

d

RFOs. Intact 7-day-old seedlings or excised epicotyls and roots (cotyledons were removed)

te

were transferred on open glass Petrie dishes (15 cm diameter, 10 seedlings per dish) and dried at laboratory conditions (22ºC and 28-30% air relative humidity, RH) for 24 hours. The intact

Ac ce p

seedlings after 24 h of dehydration were placed on wet sheet germination paper (Eurochem BGD, Poland), rolled and transferred into 250 mL glass cylinders. After addition of 50 mL of water, the cylinders were incubated in a germination chamber at 22ºC in the dark for 24 hours. Epicotyls and roots (10 in each of six replicates) dried separately were collected after 0, 1, 4, 8 and 24 hours of dehydration, immersed in liquid nitrogen and stored in an ultra-freezer at -76°C (PLATINUM 340V, Cheminst, Italy). Samples of epicotyls and roots for carbohydrate analysis and enzyme activity assay were lyophilized (freeze dryer Alpha 1-2LD, Christ, Germany), crushed in a mixed mill (MM200, Retsch, Verder Group, Netherlands) and stored (2 weeks) in a freezer (at -18°C) until extraction of sugars end enzymes.

5 Page 5 of 33

The water content in the epicotyl and roots was calculated as a difference between fresh and dry weight (after lyophylisation) of tissues. Analysis of soluble carbohydrates

ip t

Soluble carbohydrates were extracted from 40-45 mg of meal with 800 L of ethanol:water (1:1, v/v, at 90°C for 30 min), containing 100 g of xylitol (internal standard). Homogenates

cr

were centrifuged and aliquots of clear supernatant were deionized and dried in a speed

vacuum rotary evaporator to dryness. The content of soluble carbohydrates was analyzed by

us

high resolution gas chromatography on a ZEBRON ZB-1 capillary column (Phenomenex,

an

USA), according to the method described previously (Lahuta and Górecki, 2011). The carbohydrate content was calculated using the internal standard method. Standards of

M

carbohydrates were purchased from Sigma (USA). Results of analyses (in mg g-1 of dry weight, DW) are means of three independent replicates ± SE.

d

Enzymes activity assay

te

Extraction of enzymes from excised epicotyl and root tissues was carried out as described earlier (Lahuta and Górecki, 2011). The activity of galactinol synthase (GolS) and raffinose

Ac ce p

synthase (RS) was determined by the incubation of desalted tissue extract with appropriate substrates, according to the method described by Peterbauer et al. (2001). Products of reactions were determined by the gas chromatography method. All reactions were performed on three independent samples of epicotyl and root tissues. A unit of enzymatic activity corresponds to the amount of product (in picomoles) formed during 1 min of reaction by 1 mg of protein.

PsRS and PsGolS cloning Genomic DNA was extracted from epicotyls with an innuSPEED Plant DNA Kit (Analitik Jena, Jena, Germany). The PCR reaction consisted of 50 ng of template, 1 M each primers, 0.2 mM of each dNTPs, PfuPlus buffer and 2.5 U PfuPlus polymerase (Genoplast) in 50 L 6 Page 6 of 33

total volume. The primers used for cloning of genomic DNA sequences of GolS and RS genes from pea were the same as primers used in RT PCR analysis. The following condition were used for PCR: initial denaturation at 94°C (4 min); touchdown cycles [94°C (30 sec), 68 to

ip t

61°C (30 sec), 72°C (60 sec)] (one cycle for each temperature) and 30 cycles at 94°C (30 sec), 61°C (30 sec) and 72°C (60 sec) followed by extension at 72°C (10 min). Amplified products

cr

were cloned to pGEMT (Promega) and sequenced. The sequences obtained were aligned with the sequence available in GenBank (Geneious, Biomatters Inc, USA).

us

Southern blot hybridization

Genomic DNA was extracted from seedling leaves using the cetyl trimethyl ammonium

an

bromide (CTAB) technique (Rogers and Bendich, 1994). Ten microgram samples of pea

M

genomic DNA were digested with restriction enzymes, EcoRI and BamHI (Promega GmbH), which did not recognize the nucleotide sequences of the used probes. Digested DNA was

d

separated on 1% agarose gel and transferred to a positively charged nylon membrane

te

(ROCHE). The probe, GolS and RS, with digoxygenin-dUTP (DIG-11-dUTP, alkali-stable; ROCHE) using PCR was labeled. The membranes were hybridized overnight to probe at 42°C

Ac ce p

in Easy DIG Hyb buffer (ROCHE). The membranes were washed twice at room temperature in 2× SSC, 0.1% SDS each for 5min and twice in 2× SSC, 0.1% SDS at 68°C for 15 min. After washing, hybridization bands were visualized on X-ray film with CDP Star (ROCHE) used as chemiluminescent substrate for alkaline phosphate. RNA isolation and RT PCR

Total RNA, from control (0 h) and dehydrated (1, 4, 8 and 24 h) epicotyls (E) and roots (R) of 7-day-old pea seedlings stored in an ultra-freezer (10 in each of three replicates), was isolated according to the modified methods described by Wang G et al. (2012). At the same time, RNA extraction buffer (100 mM Tris-HCl pH 9.0, 2% β-mercaptoethanol, 1% SDS) and TriReagent were added to the samples homogenized in liquid nitrogen. RNA (5 g) for RT-PCR

7 Page 7 of 33

was first treated with DNase I (DNA-free, Promega) and then reversely transcribed using poly oligo dT (18) and Superscript II reverse transcriptase (Invitrogen) at 42°C for 1 h. Primers used for semi-quantitative PCR were: PsGolS (AJ243815: GenBank) - forward

ip t

5’CACGAAACTGAAACGTGCAT3’ /reverse 5’-TCAGTTAAGCTGCCGAAGGT-3’ and PsRS (AJ426475: GenBank) – forward 5’GGAACAAACGGACACGAACT3’ /reverse

cr

5’AACTGGTCCACCAGAGATGG3’. PCR reactions consisted of 5 l cDNA (equivalent to approximately 1.25 g starting RNA), 1 M each primers, 0.2 mM of each dNTPs, 2 mM

us

MgCl2, GoTaq buffer and 0.75 U GoTaq polymerase (Promega) in 30 L total volume. The

an

following conditions were used for PCR: initial denaturation at 94°C (4 min); touchdown cycles [94°C (30 sec), 68 to 61°C (30 sec), 72°C (60 sec)] (one cycle for each temperature)

M

and 28 cycles at 94°C (30 sec), 61°C (30 sec) and 72°C (60 sec) followed by extension at 72°C (10 min). A control gene for elongation factor 1-alpha (X96555: GenBank) was used as

d

the control in the semi-quantitative PCR with specific primers: forward

te

5’TTCCCTTCGTTCCCATCTCTG3’/reverse 5’TACAAGCATACCGGGCTTCA3’ (Okorska et al., 2014, in press). PCR reactions consisted of 2 L cDNA with the following

Ac ce p

conditions set for PCR: initial denaturation at 94°C (4 min); touchdown cycles [94°C (15 sec), 68 to 61°C (15 sec), 72°C (30 sec)] (one cycle for each temperature) and 20 cycles at 94°C (15 sec), 61°C (15 sec) and 72°C (30 sec) followed by extension at 72°C (5 min). The intensity of bands was evaluated in a gel image analysis system (Gene Tools, Syngene). Statistical analysis

The results of carbohydrate determination and enzyme assays were subjected to analysis of variance (ANOVA) and the Tukey’s post test (P

Dehydration induces expression of GALACTINOL SYNTHASE and RAFFINOSE SYNTHASE in seedlings of pea (Pisum sativum L.).

The exposition of 7-day-old pea seedlings to dehydration induced sudden changes in the concentration of monosaccharides and sucrose in epicotyl and ro...
357KB Sizes 2 Downloads 4 Views

Recommend Documents


Purification and properties of 5-enolpyruvylshikimate 3-phosphate synthase from seedlings of Pisum sativum L.
5-Enolpyruvylshikimate 3-phosphate synthase (3-phosphoshikimate 1-carboxyvinyltransferase; EC 2.5.1.19) from shoot tissue of pea seedlings was purified to apparent homogeneity by sequential ammonium-sulphate precipitation, ion-exchange and hydrophobi

Isolation and characterization of NADH-glutamate synthase from pea (Pisum sativum L.).
Both ferredoxin-glutamate synthase (EC 1.4.7.1) and NADH-glutamate synthase (EC 1.4.1.14) were isolated separately on DEAE-cellulose chromatography from etiolated pea shoots. The latter enzyme was purified 1,400-fold by ammonium sulfate fractionation

Lectin-gene expression in pea (Pisum sativum L.) roots.
The expression of a lectin gene in pea (Pisum sativum L.) roots has been investigated using the copy DNA of a pea seed lectin as a probe. An mRNA which has the same size as the seed mRNA but which is about 4000 times less abundant has been detected i

Effect of exogenous lead on growth and carbon metabolism of pea (Pisum sativum L) seedlings.
The present study investigated the effect of exogenous lead (Pb) on seedling growth, carbohydrate composition and vital enzymes of sucrose metabolism, starch degradation, pentose phosphate pathway and glycolysis in pea seedlings. With 0.5 mM Pb, redu

mannose-specific isolectins in pea (Pisum sativum L.) seedlings.
We report on the distribution and initial characterization of glucose/mannose-specific isolectins of 4- and 7-d-old pea (Pisum sativum L.) seedlings grown with or without nitrate supply. Particular attention was payed to root lectin, which probably f

Soluble and microsomal glutatione S-transferase activities in pea seedlings (Pisum sativum L.).
Epicotyl and primary leaves of pea seedlings (Pisum sativum L., var. Alaska) were found to contain soluble and microsomal enzymes catalyzing the addition of glutathione to the olefinic double bond of cinnamic acid. Glutathione S-cinnamoyl transfer wa

Inheritance and mapping of isoenzymes in pea (Pisum sativum L.).
Three isoenzyme systems (amylase, esterase and glutamate oxaloacetate transaminase) were examined in seeds of pea (Pisum sativum L.) and shown to give clear variation in their band patterns on gel electrophoresis between different lines. The inherita

Evidence that the "waxy" protein of pea (Pisum sativum L.) is not the major starch-granule-bound starch synthase.
The aim of this work was to identify the starch-granule-bound starch synthase of developing pea embryos. When starch-granule-bound proteins were solubilised by digestion of granules with α-amylase and fractionated on a Mono Q anion-exchange column, a

Immunolocalization of lipoxygenase in pea (Pisum sativum L.) carpels.
Polyclonal antibodies against a part of pea (Pisum sativum L.) LOXG protein have been raised to study the pattern of distribution of related lipoxygenases in pea carpels. The antiserum recognized three lipoxygenase polypeptides in carpels. One of the

Plasmatubules in transfer cells of pea (Pisum sativum L.).
Plasmatubules are tubular evaginations of the plasmalemma. They have previously been found at sites where high solute flux between apoplast and symplast occurs for a short period and where wall proliferations of the transfer cell type have not been d