Plant Biology ISSN 1435-8603
RESEARCH PAPER
Definition and stabilisation of the quiescent centre in rice roots J. Ni1,2, Y. Shen1, Y. Zhang1 & P. Wu2 1 College of Life and Environmental Sciences, Hangzhou Normal University, Hangzhou, China 2 State Key Laboratory of Plant Physiology and Biochemistry, College of Life Science, Zhejiang University, Hangzhou, China
Keywords Arabidopsis; ground tissue stem cell; quiescent centre; rice. Correspondence J. Ni, No. 16 Xuelin Street, Xiasha District, 310036 Hangzhou, China. E-mail: [email protected] Editor S. Wick
ABSTRACT The definition of a quiescent centre (QC) in Arabidopsis has been adequately demonstrated. However, the QC structure of rice has not yet been described in detail. In this research, using histological and marker gene expression analysis, we concluded that the rice QC is very small, and is similar to that of Arabidopsis. Next we investigated the stability of the rice QC during nutrient deficiencies or external hormone treatments, and found that nutrient deficiencies, auxin treatment and cytokinin treatment did not change the cell patterns of the QC. However, ethylene induced irregular transverse cell divisions in the QC and changed formative cell divisions of the ground tissue stem cells (GTSCs) in rice.
Received: 8 July 2013; Accepted: 7 November 2013 doi:10.1111/plb.12138
INTRODUCTION In the centre of the root tip there is a quiescent centre (QC), which is mitotically inactive and functions as organiser of the root stem cell niche. In Arabidopsis, almost all the cells in the root are derived from four types of stem cell (columella, epidermis/lateral root cap, cortex/endodermis and vascular initials), and these stem cells are controlled from the QC, which is composed of four mitotically inactive cells (Benfey & Scheres 2000). The QC acts to maintain the surrounding stem cells in an undifferentiated state, and destruction of the QC causes differentiation of stem cells (van den Berg et al. 1997). There are several differences in root structure between rice and Arabidopsis. For instance, cells in the root cap are entirely independent of other tissues in rice, while this is not the case in Arabidopsis, where the epidermis and lateral root cap differentiate from common initial cells (Dolan et al. 1993; Rebouillat et al. 2009). In contrast to the single layer of epidermis–endodermis structure in Arabidopsis, eight successive asymmetrical periclinal cell divisions follow the first anticlinal division in the rice root initial cell and finally generate the epidermis, exodermis, sclerenchyma cell layer, cortex and endodermis (Rebouillat et al. 2009). On the other hand, all root types found in rice have a radial organisation similar to that found in the Arabidopsis root, and the basic developmental model of cell types in the rice root is similar to that in Arabidopsis (Kamiya et al. 2003a,b). Although the definition of the QC in Arabidopsis is well known, the specification of the QC in rice is still unclear. Root architecture changes in response to various environmental stimuli. It is well accepted that the plant modifies its root system in response to nutrient and hormone cues (Ortega-Martinez et al. 2007). However, research on alterations of the QC structure in response to these environmental stimuli is limited. It has been reported that phosphate deficiency inhibits 1014
primary root growth and destroys the QC structure in Arabidopsis (Sanchez-Calderon et al. 2005); detailed analysis showed that this inhibition is the result of iron toxicity (Ward et al. 2008). Auxin is considered crucial for QC maintenance, where either blocking of auxin transport or inhibition of auxin signalling in the root tip results in alteration of the QC structure (Sabatini et al. 1999; Ni et al. 2011). Although high concentrations of auxin strongly inhibit root growth, the QC structure in response to this auxin signalling has not been reported. Ethylene signalling has been proved to induce cell division of the QC in Arabidopsis, although the QC identities were not changed (Ortega-Martinez et al. 2007). In this research, we investigated the rice QC structure in detail. Using histological and marker gene expression analysis, we concluded that the rice QC is very small, and similar to that of Arabidopsis. Further analysis showed that the rice QC is a relatively stable structure. Nutrient deficiencies, auxin treatment and cytokinin treatment did not change the cell patterns of the QC. Interestingly, ethylene induced irregular transverse cell divisions in the QC; furthermore, it also changed the formative cell division in the ground tissue stem cells (GTSC), which has never been described in Arabidopsis. MATERIAL AND METHODS Plant growth conditions Rice was grown in culture solution in a growth room under a temperature regime of 28/22 °C (day/night), 70% relative humidity and a 12-h photoperiod. For hormone treatment, plants were grown in culture solution with 0.1 lM naphthalene acetic acid (NAA), 0.1 lM 6-benzyladenine (6-BA) or 30 lM 1-aminocyclopropane-1-carboxylate (ACC) for 1 week. For the nutrient deficiency experiment, plants were grown in culture
Plant Biology 16 (2014) 1014–1019 © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands
The quiescent centre in rice roots
Ni, Shen, Zhang & Wu
solution without phosphate (-P), nitrate (-N) or potassium (-K) for 2 weeks. The primary roots of seedlings were harvest and analysed. We did not examine the QC at later development stages when seedlings grow for longer periods of time under conditions of nutrient deficiency because (a) plants cannot survive when nutrient deficiency treatments last for more than 2 weeks; (b) rice has a fibrous root system, and the primary root becomes senescent after 2 weeks, even in the nutrient sufficient controls. Incorporation of bromodeoxyuridine (BrdU) To observe the QC identity of the root, germinated seeds were cultured for 4 days, then 10 lM BrdU (Sigma-Aldrich, St. Louis, MI, USA) was added and the plants incubated for a further 24 h. For longer time BrdU treatment, 4-day-old plants were incubated for 48 h. The root tips were then excised, fixed, embedded and sectioned as described previously (Li et al. 2006). Construction of marker gene constructs To examine the expression pattern of OsSCR1, we made an OsSCR1-GFP fusion protein. To do this, we amplified the promoter plus gene sequence of OsSCR1 using the primers, TCATCTAGAATGGGAGGCACCTCTCTATTTTAA and TCA GGTACCACGTCCCGAAGCCTGAATTGGGCG, then cloned it into pBI 101.3 plasmid with green fluorescence protein (GFP). The restriction sites are underlined. To examine the expression pattern of QHB, the QHB promoter sequence containing the 5′-flanking plus 5′-non-coding region was amplified with PCR, using the primers, TTTTGTGACGCAGGGGAGTA and AGAGGCCGAAGCTGC AAAGCCTG, then cloned into the pBI 101.3 glucuronidase (GUS), as previously reported (Kamiya et al. 2003b). These constructs were transformed into the wild type (Nipponbare) via Agrobacterium tumefaciens EHA105. Histochemical analysis and GUS assay Histochemical GUS analysis was performed according to Jefferson et al. (1987). Transgenic plant root samples were incubated acid with 5-bromo-4-chloro-3-indolyl-beta-D-glucuronic cyclohexylammonium salt (X-gluc) at 37 °C. After staining, the tissues were rinsed and fixed in formalin acetic alcohol (FAA). The procedures for staining, dehydration, clearing, infiltration and embedding were performed as previously reported (Liu et al. 2005). The microtome sections were mounted on glass slides for imaging. All the results were repeated at least five times. RESULTS AND DISCUSSION Examination of a broad area with QC identity in rice Incorporation of BrdU can be used to monitor the mitotic activity of cells. The immunofluorescence signals mark cells that are in the active S-phase of the cell cycle during the labelling period (Kerk et al. 2000). Using this method, the QC cells, which are mitotically inactive, can be marked clearly (Li et al. 2006). In our experiment, an overall lower level of
immunofluorescence was observed in the root tip, which is generally accepted as the QC in rice (Fig. 1A). The WUSCHEL-RELATED HOMEOBOX 5 (WOX5) is expressed specifically in the QC and frequently used as a molecular marker to identify the QC in Arabidopsis (Sarkar et al. 2007). QUIESCENT-CENTER-SPECIFIC HOMEOBOX (QHB), the orthologue of WOX5, is expressed in cells located in the centre of the rice root meristem and is considered to be QC specific in rice (Kamiya et al. 2003b). To examine the QHB expression pattern in detail, medial longitudinal sections of the root of transgenic rice plants harbouring QHBp:GUS were made and the expression pattern of QHB characterised. GUS staining showed that QHB was expressed in a relatively large number of cells, similar to the BrdU results (Fig. 1B and C). Taken together, the BrdU incorporation and QHB expression results indicate a relatively broad area with QC identity in the rice root tip. Specification of a small QC area in rice The gene SCARECROW (SCR) is expressed in the QC, the stem cells for ground tissue (cortex and endodermis) and the endodermis in Arabidopsis (Di Laurenzio et al. 1996). We examined the expression pattern of OsSCR1, which is a homologue of SCR in rice, using transgenic rice plants harbouring OsSCR1p: OsSCR1:GFP (Cui et al. 2007). The GFP fluorescence signal showed a single cell layer expression pattern similar to that in Arabidopsis (Fig. 1D and E). Previous molecular evidence showed that SCR is required cell-autonomously for specification of the QC in Arabidopsis (Sabatini et al. 2003). Further studies also indicated an evolutionary conserved function between SCR in Arabidopsis and OsSCR1 in rice (Cui et al. 2007). These results indicate a similar number of QC cells in rice and Arabidopsis. In the Arabidopsis root meristem, the QC is flanked by GTSCs, which are the source of the endodermis and cortex through periclinal cell divisions (Dolan et al. 1993). The ground tissue in rice consists of four tissues: exodermis, sclerenchyma cell layer, cortex and endodermis (Rebouillat et al. 2009). In this study, we analysed a large number of medial longitudinal sections of the rice root tip, and successfully defined the GTSC as well as the index of its formative cell division patterns (Fig. 1F–J). The first round of asymmetric cell division started on the edge of the GTSC, resulting in a small daughter cell and an irregular-shaped large daughter cell (Fig. 1G). The second round of asymmetric cell division occurred in the irregular-shaped large daughter cell, resulting in two regular-shaped cells: a small cell and a large cell. The small cell was the initial cell of the exodermis and the large cell maintained the GTSC state (Fig. 1H). After expansion of the small daughter cell, which was produced in the first round of asymmetric cell division, a third round of asymmetric cell division occurred, generating two cells: the small one being the initial cell of the sclerenchyma cell layer and the large one being the initial cell of the cortex and endodermis (Fig. 1I). After definition of the GTSC and its formative cell division patterns in rice, the QC cells can be distinguished clearly according to expression of OsSCR1. The QC cells were marked by the expression domain of OsSCR1 and flanked by the GTSC (Fig. 1E). In this scenario, the number of QC cells in rice is very limited and similar to Arabidopsis.
Plant Biology 16 (2014) 1014–1019 © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands
1015
The quiescent centre in rice roots
A
B
D
F
Ni, Shen, Zhang & Wu
C
E
G
H
I
J
Definition of the QC in rice The QC cells in Arabidopsis are defined as four cells at the same state of quiescence, and surrounded by columella, epidermis/ lateral root cap, cortiex/endodermis and vascular initials (Dolan et al. 1993). Different markers can be used to identify the QC cells, and they cover the same QC area in Arabidopsis (Sarkar et al. 2007). However, in the case of rice, the QC area varies according to different markers used. The QHB expression pattern and BrdU incorporation analyses provided evidence of a larger QC area; while the OsSCR1 expression pattern together with definition of the GTSC provided evidence of a small QC area, which was similar to that in Arabidopsis. Analysis of incorporation of BrdU in the rice root tip showed a large area with a longer cell cycle period; these cells were located in the centre of the meristem and seemed to resemble QC cells in rice. While in the root meristem of Arabidopsis, the degree of cell division activity also varies: [3H]thymidine studies showed that stem cells near the QC divide less rapidly than cells in the upper meristem (Dolan et al. 1993); CycB1;2p:GUS analysis in Arabidopsis also showed a large area of cells with less cell division activity (Zhang et al. 2010). These results indicate that BrdU unlabelled cells may include both QC and nearby mitotically inactive stem cells. To verify our hypothesis, experiments with a longer feeding time of BrdU were carried out, and we found a relatively lower number of 1016
Fig. 1. Identification of the quiescent centre in rice. A: BrdU incorporation in the rice root tip (arrowhead indicates the region with reduced mitotic activity). B: The expression pattern of QHB in the root tip of rice. C: Schematic diagram of B: Different cell types are marked in different colours: epidermis (light blue), exodermis (red), sclerenchyma cell layer (dark blue), cortex (green), endodermis (dark yellow), lateral root cap (light yellow), collumela (grey), stele (white), QHB expressed cells (brown), QC (black). D: The expression of OsSCR1:GFP in rice. E: Longitudinal section of rice root tip. Green dashed line represents the boundary of the root cap and the meristem above; the red dashed line represents the boundary of the stele and ground tissue; yellow and black dots indicate OsSCR1 expressed cells, and black dots mark the QC cells according to OsSCR1 expression and anatomical analysis. F–I: Three rounds of asymmetric cell divisions of ground tissue stem cells in rice. Arrows indicate newly formed cell walls. G: First round of asymmetric cell division of the ground tissue stem cell, resulting in a small daughter cell and an irregular-shaped large daughter cell. H: Second round of asymmetric cell division of the irregular-shaped large daughter cell, resulting in the initial cell of the exodermis (indicated by red dot) and the new ground tissue stem cell. I: Third round of asymmetric cell division of the small daughter cell, produced in the first round of asymmetric cell division, resulting in the initial cell of the sclerenchyma cell layer (indicated by red dot) and the initial cell of the cortex and endodermis (indicated by black dot). J: Model for asymmetric cell divisions of the ground tissue stem cell in rice.
unlabelled cells (Figure S1). This result shows that the number of BrdU unlabelled cells varies according to different feeding times, and is not a suitable method to precisely define the QC. The expression of QHB is considered to be QC specific in rice (Kamiya et al. 2003b), but in our experiment the expression is broader, including stem cells near the QC. Considering the morphological differences between rice and Arabidopsis root tips, it seemed that some stem cells next to the QC (including GTSC) might have some QC identity in rice. Alternatively, considering that discovery of the QC marker WOX5 occurred long after characterisation of the QC (Dolan et al. 1993), observations of co-localisation between the QC and WOX5 would define WOX5 as a QC marker (Sarkar et al. 2007), but there is no evidence that this observation is true in other species, such as rice. Hence, there is no relationship between the function of the quiescent centre-specific homeobox (QHB) gene and the QC in rice. We suggest that rice has a small area of QC cells, and is similar to that in Arabidopsis. In Arabidopsis, the QC cells have clear morphological characteristics, and activity of the QC can be investigated directly in longitudinal sections (e.g. using confocal imaging) without any molecular markers (Ortega-Martinez et al. 2007; Zhang et al. 2010). In this research, we found that the rice QC can also be investigated using its morphological characteristics in longitudinal sections: the QC is composed of a single layer of cells flanked by two important boundary lines, one is the boundary
Plant Biology 16 (2014) 1014–1019 © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands
The quiescent centre in rice roots
Ni, Shen, Zhang & Wu
of the root cap and the meristem above, the other is the boundary of the stele and ground tissue (Fig. 1E). From this, we could directly study the stability of the QC in various conditions. The stability of QC in rice Phosphate, nitrate and potassium are three major nutrients for plants, and the ability of plants to respond appropriately to nutrient availability is of fundamental importance for their adaptation to the environment. Previous studies showed that phosphate or nitrate deficiency could change the root system architecture (Linkohr et al. 2002). In this research, we examined the QC of 2-week-old rice in phosphate, nitrate or potassium deficient conditions (-P, -N or -K). Both -P and -N induced root growth while -K reduced root growth (Figs 2A, S2A). In spite of root length changes caused by these nutrient deficiencies, section analysis showed similar cell arrangement patterns in the root tip (Fig. 2B–E). Detailed analysis focused on the QC showed single cell layers that were identical to untreated controls. These results show that although nutrient deficiencies alter root architecture, cell division activity of the QC does not change. Development of plant roots is regulated by phytohormones. Auxin and cytokinin are key hormones that regulate root development, vascular differentiation and root gravitropism (Aloni et al. 2006), and treatment with these hormones can dramatically change the root architecture. In this research, we examined the status of the QC in the presence of external auxin or cytokinin treatments. Both naphthalene acetic acid (NAA) and 6-benzylaminopurine (6-BA) seriously inhibited primary root growth. In addition, 6-BA completely inhibited the initiation of lateral root (Figs 3A, S2B). However, longitudinal section analysis of root tips showed that neither of these treatments changed the cell patterns of the QC (Fig. 3B–D). This indicates that the rice QC can tolerate high concentrations of auxin or cytokinin. Alternatively, rice might have an efficient degradation or transport system (e.g. PIN family in auxin transport) to dilute the high concentration of phytohormones. Ethylene was reported to induce cell divisions in the QC in Arabidopsis (Ortega-Martinez et al. 2007); therefore, we examined whether ethylene has similar effects on the QC in rice.
Treatment with the precursor of ethylene, 1-aminocyclopropane-1-carboxylate (ACC), significantly reduced root length, as also reported in Arabidopsis (Figs 4A, S2B), and longitudinal section analysis showed abnormal transverse cell divisions in the rice QC cells (3/10), similar to that found in Arabidopsis (Fig. 4C and D compare to 4B). Interestingly, detailed analysis of the cells around the QC showed a high frequency of abnormal cell divisions occurred in the GTSC (Fig. 4C–F). In the presence of ACC, the first round of asymmetric cell division often started in another edge of the GTSC (7/10), which never occurred in normal conditions (0/10). These results show that ethylene can induce cell divisions in the QC of rice, similar to results for Arabidopsis. Furthermore, ethylene also changed formative cell divisions in the GTSC of rice, which is not described for Arabidopsis. Our study revealed that rice has a small QC area similar to that of Arabidopsis, although BrdU incorporation and QHB expression results showed a relatively larger area. Longitudinal section analysis showed that the rice QC is composed of a single layer of cells, limited by two boundary lines lengthwise, one is the boundary of the root cap and the meristem above, while the other is the boundary of the stele and ground tissue cells. In cross-sections the QC is also flanked by the GTSC. Recently, a new technique has been developed to produce highresolution images that allow three-dimensional reconstruction of cellular organisation of plant organs (Truernit et al. 2008). In order to visualise the extensional three-dimensional organisation of the QC in rice, it is necessary to use this technique to visualise the whole-mount image of the root tip in rice. We studied the stability of the QC under various conditions, and found that although nutrient deficiencies altered root architecture, none of the treatments changed the cell patterns of the QC. This shows that the QC was not affected under nutrient deficiency conditions. Alternatively, considering the extensive rice endosperm in the seed that can sustain root growth for some time, it is possible that nutrients stored in the seeds may influence our results. Ethylene was reported to induce cell divisions in the QC of Arabidopsis (Ortega-Martinez et al. 2007). In our experiment, we found irregular transverse cell divisions in the rice QC, similar to those in Arabidopsis. Interestingly, we also found abnormal cell divisions occurred
A
B
C
D
Fig. 2. Nutrient deficiencies do not change the QC in rice. A: Nutrient deficiencies alter root length of rice: from left to right, CK, -P,-N,-K. Bar = 5 cm. B–E: Longitudinal sections of rice root tips, dots indicate the QC cells. B: CK; C: -P; D: -N; E: -K. Plant Biology 16 (2014) 1014–1019 © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands
E
1017
The quiescent centre in rice roots
Ni, Shen, Zhang & Wu
A B
C
D Fig. 3. Auxin or cytokinin treatments do not change the QC in rice. A: Auxin and cytokinin treatments alter the root architecture of rice. From left to right, CK (left), auxin treatment (middle), cytokinin treatment (right). Bar = 2 cm. B–E: Longitudinal sections of rice root tips, dots indicate QC cells. B: CK; C: auxin treatment; D: cytokinin treatment.
A
B
C
E
D
F
in the GTSC, which is not described for Arabidopsis. Formative cell division is important to specify and maintain pools of stem cells, and ACR4 signalling plays a key role in mediating formative divisions in pluripotent root tissues during organogenesis (De Smet et al. 2008). In this research, we defined the index of formative cell divisions in the GTSC. It with be interesting to investigate the relationship between ACR4 and ethylene signalling in the GTSC of rice. 1018
Fig. 4. Ethylene treatment induces irregular transverse cell divisions in the QC and changes formative cell divisions in the GTSC. A: Ethylene treatment alters the root architecture of rice. From left to right, CK (left), ethylene treatment (right). Bar = 2 cm. B–F: Longitudinal sections of rice root tips, dots indicate the QC cells. B: CK; C: and E: ethylene treatment; D: and F: are magnifications of C: and E:, respectively. Arrowhead indicates irregular transverse cell division in the QC; arrows indicate newly formed cell wall of the GTSC, which is in a different edge compared with normal conditions.
ACKNOWLEDGEMENTS We thank Dr Keke Yi (Zhejiang Academy of Agricultural Sciences) and Dr Feihua Wu (Hangzhou Normal University) for helpful comments. This work was supported by grants from the National Basic Research and Development Program of China (NO. 2011CB100300) and Zhejiang Provincial Natural Science Foundation of China (NO. LQ13C020005).
Plant Biology 16 (2014) 1014–1019 © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands
The quiescent centre in rice roots
Ni, Shen, Zhang & Wu
SUPPORTING INFORMATION Additional Supporting Information may be found in the online version of this article: Figure S1. BrdU incorporation in rice root tips at different feeding times. (A) Rice root tips incubated with BrdU for 24 h. (B) Rice root tips incubated with BrdU for 48 h; note: a relatively smaller number of unlabelled cells are shown compared with (A). REFERENCES Aloni R., Aloni E., Langhans M., Ullrich C.I. (2006) Role of cytokinin and auxin in shaping root architecture: regulating vascular differentiation, lateral root initiation, root apical dominance and root gravitropism. Annals of Botany, 97, 883–893. Benfey P.N., Scheres B. (2000) Root development. Current Biology, 10, R813–R815. van den Berg C., Willemsen V., Hendriks G., Weisbeek P., Scheres B. (1997) Short-range control of cell differentiation in the Arabidopsis root meristem. Nature, 390, 287–289. Cui H., Levesque M.P., Vernoux T., Jung J.W., Paquette A.J., Gallagher K.L., Wang J.Y., Blilou I., Scheres B., Benfey P.N. (2007) An evolutionarily conserved mechanism delimiting SHR movement defines a single layer of endodermis in plants. Science, 316, 421–425. De Smet I., Vassileva V., De Rybel B., Levesque M.P., Grunewald W., Van Damme D., Van Noorden G., Naudts M., Van Isterdael G., De Clercq R. (2008) Receptor-like kinase ACR4 restricts formative cell divisions in the Arabidopsis root. Science, 322, 594–597. Di Laurenzio L., Wysocka-Diller J., Malamy J.E., Pysh L., Helariutta Y., Freshour G., Hahn M.G., Feldmann K.A., Benfey P.N. (1996) The SCARECROW gene regulates an asymmetric cell division that is essential for generating the radial organization of the Arabidopsis root. Cell, 86, 423–433. Dolan L., Janmaat K., Willemsen V., Linstead P., Poethig S., Roberts K., Scheres B. (1993) Cellular organisation of the Arabidopsis thaliana root. Development, 119, 71–84. Jefferson R.A., Kavanagh T.A., Bevan M.W. (1987) GUS fusions: beta-glucuronidase as a sensitive and
Figure S2. Root length changes in response to nutrient deficiencies and hormone treatments. (A) Phosphate or nitrate deficiency (-P or -N) induced root growth while potassium deficiency (-K) reduced root growth in rice (n = 10). (B) NAA, 6-BA and ACC treatments reduced root growth in rice (n = 10). Asterisks indicate a statistically significant difference (P < 0.05) between the treatment and its relevant control.
versatile gene fusion marker in higher plants. EMBO Journal, 6, 3901–3907. Kamiya N., Itoh J., Morikami A., Nagato Y., Matsuoka M. (2003a) The SCARECROW gene’s role in asymmetric cell divisions in rice plants. The Plant Journal, 36, 45–54. Kamiya N., Nagasaki H., Morikami A., Sato Y., Matsuoka M. (2003b) Isolation and characterization of a rice WUSCHEL-type homeobox gene that is specifically expressed in the central cells of a quiescent center in the root apical meristem. The Plant Journal, 35, 429–441. Kerk N.M., Jiang K., Feldman L.J. (2000) Auxin metabolism in the root apical meristem. Plant Physiology, 122, 925–932. Li J., Zhu S., Song X., Shen Y., Chen H., Yu J., Yi K., Liu Y., Karplus V.J., Wu P., Deng X.W. (2006) A rice glutamate receptor-like gene is critical for the division and survival of individual cells in the root apical meristem. The Plant Cell, 18, 340–349. Linkohr B.I., Williamson L.C., Fitter A.H., Leyser H. (2002) Nitrate and phosphate availability and distribution have different effects on root system architecture of Arabidopsis. The Plant Journal, 29, 751–760. Liu H., Wang S., Yu X., Yu J., He X., Zhang S., Shou H., Wu P. (2005) ARL1, a LOB-domain protein required for adventitious root formation in rice. The Plant Journal, 43, 47–56. Ni J., Wang G., Zhu Z., Zhang H., Wu Y., Wu P. (2011) OsIAA23-mediated auxin signaling defines postembryonic maintenance of QC in rice. The Plant Journal, 68, 433–442. Ortega-Martinez O., Pernas M., Carol R.J., Dolan L. (2007) Ethylene modulates stem cell division in the Arabidopsis thaliana root. Science, 317, 507–510. Rebouillat J., Dievart A., Verdeil L., Escoute J., Giese G., Breitler C., Gantet P., Espeout S., Guiderdoni E.,
Plant Biology 16 (2014) 1014–1019 © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands
Perin C. (2009) Molecular Genetics of Rice Root Development. Rice, 2, 15–34. Sabatini S., Beis D., Wolkenfelt H., Murfett J., Guilfoyle T., Malamy J., Benfey P., Leyser O., Bechtold N., Weisbeek P., Scheres B. (1999) An auxin-dependent distal organizer of pattern and polarity in the Arabidopsis root. Cell, 99, 463–472. Sabatini S., Heidstra R., Wildwater M., Scheres B. (2003) SCARECROW is involved in positioning the stem cell niche in the Arabidopsis root meristem. Genes & Development, 17, 354–358. Sanchez-Calderon L., Lopez-Bucio J., Chacon-Lopez A., Cruz-Ramirez A., Nieto-Jacobo F., Dubrovsky J.G., Herrera-Estrella L. (2005) Phosphate starvation induces a determinate developmental program in the roots of Arabidopsis thaliana. Plant and Cell Physiology, 46, 174–184. Sarkar A.K., Luijten M., Miyashima S., Lenhard M., Hashimoto T., Nakajima K., Scheres B., Heidstra R., Laux T. (2007) Conserved factors regulate signalling in Arabidopsis thaliana shoot and root stem cell organizers. Nature, 446, 811–814. Truernit E., Bauby H., Dubreucq B., Grandjean O., Runions J., Barthelemy J., Palauqui J.C. (2008) High-resolution whole-mount imaging of threedimensional tissue organization and gene expression enables the study of phloem development and structure in Arabidopsis. The Plant Cell, 20, 1494–1503. Ward J.T., Lahner B., Yakubova E., Salt D.E., Raghothama K.G. (2008) The effect of iron on the primary root elongation of Arabidopsis during phosphate deficiency. Plant Physiology, 147, 1181–1191. Zhang H., Han W., De Smet I., Talboys P., Loya R., Hassan A., Rong H., Jurgens G., Paul Knox J., Wang M.H. (2010) ABA promotes quiescence of the quiescent centre and suppresses stem cell differentiation in the Arabidopsis primary root meristem. The Plant Journal, 64, 764–774.
1019
RESEARCH PAPER
Definition and stabilisation of the quiescent centre in rice roots J. Ni1,2, Y. Shen1, Y. Zhang1 & P. Wu2 1 College of Life and Environmental Sciences, Hangzhou Normal University, Hangzhou, China 2 State Key Laboratory of Plant Physiology and Biochemistry, College of Life Science, Zhejiang University, Hangzhou, China
Keywords Arabidopsis; ground tissue stem cell; quiescent centre; rice. Correspondence J. Ni, No. 16 Xuelin Street, Xiasha District, 310036 Hangzhou, China. E-mail: [email protected] Editor S. Wick
ABSTRACT The definition of a quiescent centre (QC) in Arabidopsis has been adequately demonstrated. However, the QC structure of rice has not yet been described in detail. In this research, using histological and marker gene expression analysis, we concluded that the rice QC is very small, and is similar to that of Arabidopsis. Next we investigated the stability of the rice QC during nutrient deficiencies or external hormone treatments, and found that nutrient deficiencies, auxin treatment and cytokinin treatment did not change the cell patterns of the QC. However, ethylene induced irregular transverse cell divisions in the QC and changed formative cell divisions of the ground tissue stem cells (GTSCs) in rice.
Received: 8 July 2013; Accepted: 7 November 2013 doi:10.1111/plb.12138
INTRODUCTION In the centre of the root tip there is a quiescent centre (QC), which is mitotically inactive and functions as organiser of the root stem cell niche. In Arabidopsis, almost all the cells in the root are derived from four types of stem cell (columella, epidermis/lateral root cap, cortex/endodermis and vascular initials), and these stem cells are controlled from the QC, which is composed of four mitotically inactive cells (Benfey & Scheres 2000). The QC acts to maintain the surrounding stem cells in an undifferentiated state, and destruction of the QC causes differentiation of stem cells (van den Berg et al. 1997). There are several differences in root structure between rice and Arabidopsis. For instance, cells in the root cap are entirely independent of other tissues in rice, while this is not the case in Arabidopsis, where the epidermis and lateral root cap differentiate from common initial cells (Dolan et al. 1993; Rebouillat et al. 2009). In contrast to the single layer of epidermis–endodermis structure in Arabidopsis, eight successive asymmetrical periclinal cell divisions follow the first anticlinal division in the rice root initial cell and finally generate the epidermis, exodermis, sclerenchyma cell layer, cortex and endodermis (Rebouillat et al. 2009). On the other hand, all root types found in rice have a radial organisation similar to that found in the Arabidopsis root, and the basic developmental model of cell types in the rice root is similar to that in Arabidopsis (Kamiya et al. 2003a,b). Although the definition of the QC in Arabidopsis is well known, the specification of the QC in rice is still unclear. Root architecture changes in response to various environmental stimuli. It is well accepted that the plant modifies its root system in response to nutrient and hormone cues (Ortega-Martinez et al. 2007). However, research on alterations of the QC structure in response to these environmental stimuli is limited. It has been reported that phosphate deficiency inhibits 1014
primary root growth and destroys the QC structure in Arabidopsis (Sanchez-Calderon et al. 2005); detailed analysis showed that this inhibition is the result of iron toxicity (Ward et al. 2008). Auxin is considered crucial for QC maintenance, where either blocking of auxin transport or inhibition of auxin signalling in the root tip results in alteration of the QC structure (Sabatini et al. 1999; Ni et al. 2011). Although high concentrations of auxin strongly inhibit root growth, the QC structure in response to this auxin signalling has not been reported. Ethylene signalling has been proved to induce cell division of the QC in Arabidopsis, although the QC identities were not changed (Ortega-Martinez et al. 2007). In this research, we investigated the rice QC structure in detail. Using histological and marker gene expression analysis, we concluded that the rice QC is very small, and similar to that of Arabidopsis. Further analysis showed that the rice QC is a relatively stable structure. Nutrient deficiencies, auxin treatment and cytokinin treatment did not change the cell patterns of the QC. Interestingly, ethylene induced irregular transverse cell divisions in the QC; furthermore, it also changed the formative cell division in the ground tissue stem cells (GTSC), which has never been described in Arabidopsis. MATERIAL AND METHODS Plant growth conditions Rice was grown in culture solution in a growth room under a temperature regime of 28/22 °C (day/night), 70% relative humidity and a 12-h photoperiod. For hormone treatment, plants were grown in culture solution with 0.1 lM naphthalene acetic acid (NAA), 0.1 lM 6-benzyladenine (6-BA) or 30 lM 1-aminocyclopropane-1-carboxylate (ACC) for 1 week. For the nutrient deficiency experiment, plants were grown in culture
Plant Biology 16 (2014) 1014–1019 © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands
The quiescent centre in rice roots
Ni, Shen, Zhang & Wu
solution without phosphate (-P), nitrate (-N) or potassium (-K) for 2 weeks. The primary roots of seedlings were harvest and analysed. We did not examine the QC at later development stages when seedlings grow for longer periods of time under conditions of nutrient deficiency because (a) plants cannot survive when nutrient deficiency treatments last for more than 2 weeks; (b) rice has a fibrous root system, and the primary root becomes senescent after 2 weeks, even in the nutrient sufficient controls. Incorporation of bromodeoxyuridine (BrdU) To observe the QC identity of the root, germinated seeds were cultured for 4 days, then 10 lM BrdU (Sigma-Aldrich, St. Louis, MI, USA) was added and the plants incubated for a further 24 h. For longer time BrdU treatment, 4-day-old plants were incubated for 48 h. The root tips were then excised, fixed, embedded and sectioned as described previously (Li et al. 2006). Construction of marker gene constructs To examine the expression pattern of OsSCR1, we made an OsSCR1-GFP fusion protein. To do this, we amplified the promoter plus gene sequence of OsSCR1 using the primers, TCATCTAGAATGGGAGGCACCTCTCTATTTTAA and TCA GGTACCACGTCCCGAAGCCTGAATTGGGCG, then cloned it into pBI 101.3 plasmid with green fluorescence protein (GFP). The restriction sites are underlined. To examine the expression pattern of QHB, the QHB promoter sequence containing the 5′-flanking plus 5′-non-coding region was amplified with PCR, using the primers, TTTTGTGACGCAGGGGAGTA and AGAGGCCGAAGCTGC AAAGCCTG, then cloned into the pBI 101.3 glucuronidase (GUS), as previously reported (Kamiya et al. 2003b). These constructs were transformed into the wild type (Nipponbare) via Agrobacterium tumefaciens EHA105. Histochemical analysis and GUS assay Histochemical GUS analysis was performed according to Jefferson et al. (1987). Transgenic plant root samples were incubated acid with 5-bromo-4-chloro-3-indolyl-beta-D-glucuronic cyclohexylammonium salt (X-gluc) at 37 °C. After staining, the tissues were rinsed and fixed in formalin acetic alcohol (FAA). The procedures for staining, dehydration, clearing, infiltration and embedding were performed as previously reported (Liu et al. 2005). The microtome sections were mounted on glass slides for imaging. All the results were repeated at least five times. RESULTS AND DISCUSSION Examination of a broad area with QC identity in rice Incorporation of BrdU can be used to monitor the mitotic activity of cells. The immunofluorescence signals mark cells that are in the active S-phase of the cell cycle during the labelling period (Kerk et al. 2000). Using this method, the QC cells, which are mitotically inactive, can be marked clearly (Li et al. 2006). In our experiment, an overall lower level of
immunofluorescence was observed in the root tip, which is generally accepted as the QC in rice (Fig. 1A). The WUSCHEL-RELATED HOMEOBOX 5 (WOX5) is expressed specifically in the QC and frequently used as a molecular marker to identify the QC in Arabidopsis (Sarkar et al. 2007). QUIESCENT-CENTER-SPECIFIC HOMEOBOX (QHB), the orthologue of WOX5, is expressed in cells located in the centre of the rice root meristem and is considered to be QC specific in rice (Kamiya et al. 2003b). To examine the QHB expression pattern in detail, medial longitudinal sections of the root of transgenic rice plants harbouring QHBp:GUS were made and the expression pattern of QHB characterised. GUS staining showed that QHB was expressed in a relatively large number of cells, similar to the BrdU results (Fig. 1B and C). Taken together, the BrdU incorporation and QHB expression results indicate a relatively broad area with QC identity in the rice root tip. Specification of a small QC area in rice The gene SCARECROW (SCR) is expressed in the QC, the stem cells for ground tissue (cortex and endodermis) and the endodermis in Arabidopsis (Di Laurenzio et al. 1996). We examined the expression pattern of OsSCR1, which is a homologue of SCR in rice, using transgenic rice plants harbouring OsSCR1p: OsSCR1:GFP (Cui et al. 2007). The GFP fluorescence signal showed a single cell layer expression pattern similar to that in Arabidopsis (Fig. 1D and E). Previous molecular evidence showed that SCR is required cell-autonomously for specification of the QC in Arabidopsis (Sabatini et al. 2003). Further studies also indicated an evolutionary conserved function between SCR in Arabidopsis and OsSCR1 in rice (Cui et al. 2007). These results indicate a similar number of QC cells in rice and Arabidopsis. In the Arabidopsis root meristem, the QC is flanked by GTSCs, which are the source of the endodermis and cortex through periclinal cell divisions (Dolan et al. 1993). The ground tissue in rice consists of four tissues: exodermis, sclerenchyma cell layer, cortex and endodermis (Rebouillat et al. 2009). In this study, we analysed a large number of medial longitudinal sections of the rice root tip, and successfully defined the GTSC as well as the index of its formative cell division patterns (Fig. 1F–J). The first round of asymmetric cell division started on the edge of the GTSC, resulting in a small daughter cell and an irregular-shaped large daughter cell (Fig. 1G). The second round of asymmetric cell division occurred in the irregular-shaped large daughter cell, resulting in two regular-shaped cells: a small cell and a large cell. The small cell was the initial cell of the exodermis and the large cell maintained the GTSC state (Fig. 1H). After expansion of the small daughter cell, which was produced in the first round of asymmetric cell division, a third round of asymmetric cell division occurred, generating two cells: the small one being the initial cell of the sclerenchyma cell layer and the large one being the initial cell of the cortex and endodermis (Fig. 1I). After definition of the GTSC and its formative cell division patterns in rice, the QC cells can be distinguished clearly according to expression of OsSCR1. The QC cells were marked by the expression domain of OsSCR1 and flanked by the GTSC (Fig. 1E). In this scenario, the number of QC cells in rice is very limited and similar to Arabidopsis.
Plant Biology 16 (2014) 1014–1019 © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands
1015
The quiescent centre in rice roots
A
B
D
F
Ni, Shen, Zhang & Wu
C
E
G
H
I
J
Definition of the QC in rice The QC cells in Arabidopsis are defined as four cells at the same state of quiescence, and surrounded by columella, epidermis/ lateral root cap, cortiex/endodermis and vascular initials (Dolan et al. 1993). Different markers can be used to identify the QC cells, and they cover the same QC area in Arabidopsis (Sarkar et al. 2007). However, in the case of rice, the QC area varies according to different markers used. The QHB expression pattern and BrdU incorporation analyses provided evidence of a larger QC area; while the OsSCR1 expression pattern together with definition of the GTSC provided evidence of a small QC area, which was similar to that in Arabidopsis. Analysis of incorporation of BrdU in the rice root tip showed a large area with a longer cell cycle period; these cells were located in the centre of the meristem and seemed to resemble QC cells in rice. While in the root meristem of Arabidopsis, the degree of cell division activity also varies: [3H]thymidine studies showed that stem cells near the QC divide less rapidly than cells in the upper meristem (Dolan et al. 1993); CycB1;2p:GUS analysis in Arabidopsis also showed a large area of cells with less cell division activity (Zhang et al. 2010). These results indicate that BrdU unlabelled cells may include both QC and nearby mitotically inactive stem cells. To verify our hypothesis, experiments with a longer feeding time of BrdU were carried out, and we found a relatively lower number of 1016
Fig. 1. Identification of the quiescent centre in rice. A: BrdU incorporation in the rice root tip (arrowhead indicates the region with reduced mitotic activity). B: The expression pattern of QHB in the root tip of rice. C: Schematic diagram of B: Different cell types are marked in different colours: epidermis (light blue), exodermis (red), sclerenchyma cell layer (dark blue), cortex (green), endodermis (dark yellow), lateral root cap (light yellow), collumela (grey), stele (white), QHB expressed cells (brown), QC (black). D: The expression of OsSCR1:GFP in rice. E: Longitudinal section of rice root tip. Green dashed line represents the boundary of the root cap and the meristem above; the red dashed line represents the boundary of the stele and ground tissue; yellow and black dots indicate OsSCR1 expressed cells, and black dots mark the QC cells according to OsSCR1 expression and anatomical analysis. F–I: Three rounds of asymmetric cell divisions of ground tissue stem cells in rice. Arrows indicate newly formed cell walls. G: First round of asymmetric cell division of the ground tissue stem cell, resulting in a small daughter cell and an irregular-shaped large daughter cell. H: Second round of asymmetric cell division of the irregular-shaped large daughter cell, resulting in the initial cell of the exodermis (indicated by red dot) and the new ground tissue stem cell. I: Third round of asymmetric cell division of the small daughter cell, produced in the first round of asymmetric cell division, resulting in the initial cell of the sclerenchyma cell layer (indicated by red dot) and the initial cell of the cortex and endodermis (indicated by black dot). J: Model for asymmetric cell divisions of the ground tissue stem cell in rice.
unlabelled cells (Figure S1). This result shows that the number of BrdU unlabelled cells varies according to different feeding times, and is not a suitable method to precisely define the QC. The expression of QHB is considered to be QC specific in rice (Kamiya et al. 2003b), but in our experiment the expression is broader, including stem cells near the QC. Considering the morphological differences between rice and Arabidopsis root tips, it seemed that some stem cells next to the QC (including GTSC) might have some QC identity in rice. Alternatively, considering that discovery of the QC marker WOX5 occurred long after characterisation of the QC (Dolan et al. 1993), observations of co-localisation between the QC and WOX5 would define WOX5 as a QC marker (Sarkar et al. 2007), but there is no evidence that this observation is true in other species, such as rice. Hence, there is no relationship between the function of the quiescent centre-specific homeobox (QHB) gene and the QC in rice. We suggest that rice has a small area of QC cells, and is similar to that in Arabidopsis. In Arabidopsis, the QC cells have clear morphological characteristics, and activity of the QC can be investigated directly in longitudinal sections (e.g. using confocal imaging) without any molecular markers (Ortega-Martinez et al. 2007; Zhang et al. 2010). In this research, we found that the rice QC can also be investigated using its morphological characteristics in longitudinal sections: the QC is composed of a single layer of cells flanked by two important boundary lines, one is the boundary
Plant Biology 16 (2014) 1014–1019 © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands
The quiescent centre in rice roots
Ni, Shen, Zhang & Wu
of the root cap and the meristem above, the other is the boundary of the stele and ground tissue (Fig. 1E). From this, we could directly study the stability of the QC in various conditions. The stability of QC in rice Phosphate, nitrate and potassium are three major nutrients for plants, and the ability of plants to respond appropriately to nutrient availability is of fundamental importance for their adaptation to the environment. Previous studies showed that phosphate or nitrate deficiency could change the root system architecture (Linkohr et al. 2002). In this research, we examined the QC of 2-week-old rice in phosphate, nitrate or potassium deficient conditions (-P, -N or -K). Both -P and -N induced root growth while -K reduced root growth (Figs 2A, S2A). In spite of root length changes caused by these nutrient deficiencies, section analysis showed similar cell arrangement patterns in the root tip (Fig. 2B–E). Detailed analysis focused on the QC showed single cell layers that were identical to untreated controls. These results show that although nutrient deficiencies alter root architecture, cell division activity of the QC does not change. Development of plant roots is regulated by phytohormones. Auxin and cytokinin are key hormones that regulate root development, vascular differentiation and root gravitropism (Aloni et al. 2006), and treatment with these hormones can dramatically change the root architecture. In this research, we examined the status of the QC in the presence of external auxin or cytokinin treatments. Both naphthalene acetic acid (NAA) and 6-benzylaminopurine (6-BA) seriously inhibited primary root growth. In addition, 6-BA completely inhibited the initiation of lateral root (Figs 3A, S2B). However, longitudinal section analysis of root tips showed that neither of these treatments changed the cell patterns of the QC (Fig. 3B–D). This indicates that the rice QC can tolerate high concentrations of auxin or cytokinin. Alternatively, rice might have an efficient degradation or transport system (e.g. PIN family in auxin transport) to dilute the high concentration of phytohormones. Ethylene was reported to induce cell divisions in the QC in Arabidopsis (Ortega-Martinez et al. 2007); therefore, we examined whether ethylene has similar effects on the QC in rice.
Treatment with the precursor of ethylene, 1-aminocyclopropane-1-carboxylate (ACC), significantly reduced root length, as also reported in Arabidopsis (Figs 4A, S2B), and longitudinal section analysis showed abnormal transverse cell divisions in the rice QC cells (3/10), similar to that found in Arabidopsis (Fig. 4C and D compare to 4B). Interestingly, detailed analysis of the cells around the QC showed a high frequency of abnormal cell divisions occurred in the GTSC (Fig. 4C–F). In the presence of ACC, the first round of asymmetric cell division often started in another edge of the GTSC (7/10), which never occurred in normal conditions (0/10). These results show that ethylene can induce cell divisions in the QC of rice, similar to results for Arabidopsis. Furthermore, ethylene also changed formative cell divisions in the GTSC of rice, which is not described for Arabidopsis. Our study revealed that rice has a small QC area similar to that of Arabidopsis, although BrdU incorporation and QHB expression results showed a relatively larger area. Longitudinal section analysis showed that the rice QC is composed of a single layer of cells, limited by two boundary lines lengthwise, one is the boundary of the root cap and the meristem above, while the other is the boundary of the stele and ground tissue cells. In cross-sections the QC is also flanked by the GTSC. Recently, a new technique has been developed to produce highresolution images that allow three-dimensional reconstruction of cellular organisation of plant organs (Truernit et al. 2008). In order to visualise the extensional three-dimensional organisation of the QC in rice, it is necessary to use this technique to visualise the whole-mount image of the root tip in rice. We studied the stability of the QC under various conditions, and found that although nutrient deficiencies altered root architecture, none of the treatments changed the cell patterns of the QC. This shows that the QC was not affected under nutrient deficiency conditions. Alternatively, considering the extensive rice endosperm in the seed that can sustain root growth for some time, it is possible that nutrients stored in the seeds may influence our results. Ethylene was reported to induce cell divisions in the QC of Arabidopsis (Ortega-Martinez et al. 2007). In our experiment, we found irregular transverse cell divisions in the rice QC, similar to those in Arabidopsis. Interestingly, we also found abnormal cell divisions occurred
A
B
C
D
Fig. 2. Nutrient deficiencies do not change the QC in rice. A: Nutrient deficiencies alter root length of rice: from left to right, CK, -P,-N,-K. Bar = 5 cm. B–E: Longitudinal sections of rice root tips, dots indicate the QC cells. B: CK; C: -P; D: -N; E: -K. Plant Biology 16 (2014) 1014–1019 © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands
E
1017
The quiescent centre in rice roots
Ni, Shen, Zhang & Wu
A B
C
D Fig. 3. Auxin or cytokinin treatments do not change the QC in rice. A: Auxin and cytokinin treatments alter the root architecture of rice. From left to right, CK (left), auxin treatment (middle), cytokinin treatment (right). Bar = 2 cm. B–E: Longitudinal sections of rice root tips, dots indicate QC cells. B: CK; C: auxin treatment; D: cytokinin treatment.
A
B
C
E
D
F
in the GTSC, which is not described for Arabidopsis. Formative cell division is important to specify and maintain pools of stem cells, and ACR4 signalling plays a key role in mediating formative divisions in pluripotent root tissues during organogenesis (De Smet et al. 2008). In this research, we defined the index of formative cell divisions in the GTSC. It with be interesting to investigate the relationship between ACR4 and ethylene signalling in the GTSC of rice. 1018
Fig. 4. Ethylene treatment induces irregular transverse cell divisions in the QC and changes formative cell divisions in the GTSC. A: Ethylene treatment alters the root architecture of rice. From left to right, CK (left), ethylene treatment (right). Bar = 2 cm. B–F: Longitudinal sections of rice root tips, dots indicate the QC cells. B: CK; C: and E: ethylene treatment; D: and F: are magnifications of C: and E:, respectively. Arrowhead indicates irregular transverse cell division in the QC; arrows indicate newly formed cell wall of the GTSC, which is in a different edge compared with normal conditions.
ACKNOWLEDGEMENTS We thank Dr Keke Yi (Zhejiang Academy of Agricultural Sciences) and Dr Feihua Wu (Hangzhou Normal University) for helpful comments. This work was supported by grants from the National Basic Research and Development Program of China (NO. 2011CB100300) and Zhejiang Provincial Natural Science Foundation of China (NO. LQ13C020005).
Plant Biology 16 (2014) 1014–1019 © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands
The quiescent centre in rice roots
Ni, Shen, Zhang & Wu
SUPPORTING INFORMATION Additional Supporting Information may be found in the online version of this article: Figure S1. BrdU incorporation in rice root tips at different feeding times. (A) Rice root tips incubated with BrdU for 24 h. (B) Rice root tips incubated with BrdU for 48 h; note: a relatively smaller number of unlabelled cells are shown compared with (A). REFERENCES Aloni R., Aloni E., Langhans M., Ullrich C.I. (2006) Role of cytokinin and auxin in shaping root architecture: regulating vascular differentiation, lateral root initiation, root apical dominance and root gravitropism. Annals of Botany, 97, 883–893. Benfey P.N., Scheres B. (2000) Root development. Current Biology, 10, R813–R815. van den Berg C., Willemsen V., Hendriks G., Weisbeek P., Scheres B. (1997) Short-range control of cell differentiation in the Arabidopsis root meristem. Nature, 390, 287–289. Cui H., Levesque M.P., Vernoux T., Jung J.W., Paquette A.J., Gallagher K.L., Wang J.Y., Blilou I., Scheres B., Benfey P.N. (2007) An evolutionarily conserved mechanism delimiting SHR movement defines a single layer of endodermis in plants. Science, 316, 421–425. De Smet I., Vassileva V., De Rybel B., Levesque M.P., Grunewald W., Van Damme D., Van Noorden G., Naudts M., Van Isterdael G., De Clercq R. (2008) Receptor-like kinase ACR4 restricts formative cell divisions in the Arabidopsis root. Science, 322, 594–597. Di Laurenzio L., Wysocka-Diller J., Malamy J.E., Pysh L., Helariutta Y., Freshour G., Hahn M.G., Feldmann K.A., Benfey P.N. (1996) The SCARECROW gene regulates an asymmetric cell division that is essential for generating the radial organization of the Arabidopsis root. Cell, 86, 423–433. Dolan L., Janmaat K., Willemsen V., Linstead P., Poethig S., Roberts K., Scheres B. (1993) Cellular organisation of the Arabidopsis thaliana root. Development, 119, 71–84. Jefferson R.A., Kavanagh T.A., Bevan M.W. (1987) GUS fusions: beta-glucuronidase as a sensitive and
Figure S2. Root length changes in response to nutrient deficiencies and hormone treatments. (A) Phosphate or nitrate deficiency (-P or -N) induced root growth while potassium deficiency (-K) reduced root growth in rice (n = 10). (B) NAA, 6-BA and ACC treatments reduced root growth in rice (n = 10). Asterisks indicate a statistically significant difference (P < 0.05) between the treatment and its relevant control.
versatile gene fusion marker in higher plants. EMBO Journal, 6, 3901–3907. Kamiya N., Itoh J., Morikami A., Nagato Y., Matsuoka M. (2003a) The SCARECROW gene’s role in asymmetric cell divisions in rice plants. The Plant Journal, 36, 45–54. Kamiya N., Nagasaki H., Morikami A., Sato Y., Matsuoka M. (2003b) Isolation and characterization of a rice WUSCHEL-type homeobox gene that is specifically expressed in the central cells of a quiescent center in the root apical meristem. The Plant Journal, 35, 429–441. Kerk N.M., Jiang K., Feldman L.J. (2000) Auxin metabolism in the root apical meristem. Plant Physiology, 122, 925–932. Li J., Zhu S., Song X., Shen Y., Chen H., Yu J., Yi K., Liu Y., Karplus V.J., Wu P., Deng X.W. (2006) A rice glutamate receptor-like gene is critical for the division and survival of individual cells in the root apical meristem. The Plant Cell, 18, 340–349. Linkohr B.I., Williamson L.C., Fitter A.H., Leyser H. (2002) Nitrate and phosphate availability and distribution have different effects on root system architecture of Arabidopsis. The Plant Journal, 29, 751–760. Liu H., Wang S., Yu X., Yu J., He X., Zhang S., Shou H., Wu P. (2005) ARL1, a LOB-domain protein required for adventitious root formation in rice. The Plant Journal, 43, 47–56. Ni J., Wang G., Zhu Z., Zhang H., Wu Y., Wu P. (2011) OsIAA23-mediated auxin signaling defines postembryonic maintenance of QC in rice. The Plant Journal, 68, 433–442. Ortega-Martinez O., Pernas M., Carol R.J., Dolan L. (2007) Ethylene modulates stem cell division in the Arabidopsis thaliana root. Science, 317, 507–510. Rebouillat J., Dievart A., Verdeil L., Escoute J., Giese G., Breitler C., Gantet P., Espeout S., Guiderdoni E.,
Plant Biology 16 (2014) 1014–1019 © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands
Perin C. (2009) Molecular Genetics of Rice Root Development. Rice, 2, 15–34. Sabatini S., Beis D., Wolkenfelt H., Murfett J., Guilfoyle T., Malamy J., Benfey P., Leyser O., Bechtold N., Weisbeek P., Scheres B. (1999) An auxin-dependent distal organizer of pattern and polarity in the Arabidopsis root. Cell, 99, 463–472. Sabatini S., Heidstra R., Wildwater M., Scheres B. (2003) SCARECROW is involved in positioning the stem cell niche in the Arabidopsis root meristem. Genes & Development, 17, 354–358. Sanchez-Calderon L., Lopez-Bucio J., Chacon-Lopez A., Cruz-Ramirez A., Nieto-Jacobo F., Dubrovsky J.G., Herrera-Estrella L. (2005) Phosphate starvation induces a determinate developmental program in the roots of Arabidopsis thaliana. Plant and Cell Physiology, 46, 174–184. Sarkar A.K., Luijten M., Miyashima S., Lenhard M., Hashimoto T., Nakajima K., Scheres B., Heidstra R., Laux T. (2007) Conserved factors regulate signalling in Arabidopsis thaliana shoot and root stem cell organizers. Nature, 446, 811–814. Truernit E., Bauby H., Dubreucq B., Grandjean O., Runions J., Barthelemy J., Palauqui J.C. (2008) High-resolution whole-mount imaging of threedimensional tissue organization and gene expression enables the study of phloem development and structure in Arabidopsis. The Plant Cell, 20, 1494–1503. Ward J.T., Lahner B., Yakubova E., Salt D.E., Raghothama K.G. (2008) The effect of iron on the primary root elongation of Arabidopsis during phosphate deficiency. Plant Physiology, 147, 1181–1191. Zhang H., Han W., De Smet I., Talboys P., Loya R., Hassan A., Rong H., Jurgens G., Paul Knox J., Wang M.H. (2010) ABA promotes quiescence of the quiescent centre and suppresses stem cell differentiation in the Arabidopsis primary root meristem. The Plant Journal, 64, 764–774.
1019
