RESEARCH ARTICLE – Pharmacokinetics, Pharmacodynamics and Drug Transport and Metabolism
Decreased Radixin Function for ATP-Binding Cassette Transporters in Liver in Adjuvant-Induced Arthritis Rats ATSUSHI KAWASE,1 MISATO SAKATA,1 NAGISA YADA,1 MISAKI NAKASAKA,1 TAKUYA SHIMIZU,2 YUKIO KATO,2 MASAHIRO IWAKI1 1 2
Department of Pharmacy, School of Pharmacy, Kinki University, Osaka 577-8502, Japan Faculty of Pharmacy, Institute of Medical, Pharmaceutical and Health Sciences, Kanazawa University, Kanazawa 920-1192, Japan
Received 7 August 2014; revised 20 September 2014; accepted 22 September 2014 Published online 20 October 2014 in Wiley Online Library (wileyonlinelibrary.com). DOI 10.1002/jps.24210 ABSTRACT: Pathophysiological changes are associated with alterations in the expression and function of numerous ADME-related proteins. We have previously demonstrated that the membrane localization of ATP-binding cassette (ABC) transporters in liver was decreased without change of total expression levels in adjuvant-induced arthritis (AA) in rats. Ezrin/radixin/moesin (ERM) proteins are involved in localization of some ABC transporters in canalicular membrane. The mRNA levels of radixin decreased significantly in liver but not kidney, small intestine, and brain. The mRNA levels of ezrin and moesin did not change in AA. The membrane localization of radixin was reduced in liver of AA and the ratios of activated radixin (p-radixin) to total radixin were decreased in AA, although the protein levels of radixin did not change in homogenate and membrane protein. To clarify whether AA affects the linker functions of ERM proteins, we examined the interactions between ERM proteins and ABC transporters. The interactions between radixin and ABC transporters were decreased in AA. In vitro studies using human hepatoma HepG2 cells showed that interleukin-1 decreased the mRNA levels of radixin and colocalization of radixin and Mrp2. Our results show that the decreased radixin functions affect the interaction between radixin and ABC transporters in C 2014 Wiley Periodicals, Inc. and the American Pharmacists Association J Pharm Sci 103:4058–4065, 2014 inflammation. Keywords: ABC transporters; active transport; disease states; efflux pumps; elimination; membrane transport; MRP; multidrug resistance transporters; P-glycoprotein
INTRODUCTION Drug transporters, including efflux transporters [ATP-binding cassette (ABC) proteins] and uptake transporters [solute carrier (SLC) proteins], have an important impact on drug disposition, efficacy, and toxicity. The ezrin/radixin/moesin (ERM) proteins are a closely related family of proteins that crosslink cytoskeletal actin filaments (F-actin) with integral plasma membrane proteins.1 ERM proteins are involved in membrane localization and function of ABC transporters expressed in canalicular membrane. Recently, it has been focused on the necessity of adaptor/scaffold proteins in addition to transporter itself for transport activity. The intramolecular interactions keep ERM proteins in dormant closed form in cytoplasm.2,3 The phosphorylation of threonine residue at C-terminus switch ERM proteins to activated open form that shows the linker activities for transporter.4–6 In radixin-deficient mice, the development of conjugated hyperbilirubinemia associated with the loss of ABC transporters such as multidrug resistance-associated protein 2 (Mrp2/Abcc2) from the canalicular membrane like Dubin–Johnson syndrome in human7 suggests that radixin has an important role in membrane localization of Mrp2. Radixin is also involved in membrane localization of P-glycoprotein (P-gp/Abcb1)se.8,9 Pathophysiological changes in human patients and in animal models of infection or inflammation are associated with immediate and often dramatic alterations in the production of Correspondence to: Masahiro Iwaki (Telephone: +81-643073628; Fax: +81667301394; E-mail: [email protected]) Journal of Pharmaceutical Sciences, Vol. 103, 4058–4065 (2014)
C 2014 Wiley Periodicals, Inc. and the American Pharmacists Association
4058
numerous liver-derived proteins. Decreases of ABC transporter activities could lead to intracellular accumulation of drugs and/or their metabolites. Inflammation-mediated changes in drug transporter expression and activity affect the therapeutic drug response.10 In particular, liver is susceptible to inflammation such as virus hepatitis and drug-induced hepatitis and main organ for metabolisms of xenobiotics and endogenous substrates. We previously demonstrated the alterations in expression and activity of drug metabolizing enzymes and transporters in inflammation using mice with collagen-induced arthritis or rats with adjuvant-induced arthritis (AA).11–14 AA rats have been used as a model for rheumatoid arthritis for the development of anti-inflammatory medicines because they exhibit systemic inflammatory disease with changes to bone and cartilage similar to that observed in humans with rheumatoid arthritis.15 AA rats at 7 days (AA 7 d) and 21 days (AA 21 d) after adjuvant treatment have been shown to exhibit acute and chronic inflammatory conditions. The increases of lactate dehydrogenase, aspartate aminotransferase, alkaline phosphatase, and "1 -acid glycoprotein and decreases of albumin were observed in serum of AA rats.12 Our previous study showed that the hepatic membrane localization of ABC transporters such as P-gp, Mrp2, and breast cancer-resistance protein (Bcrp/Abcg2) were decreased without changes of total expression levels in AA rats.16 Therefore, there could be impacts on the expression and function of ERM proteins in AA rats. These backgrounds prompted us to investigate the effects of inflammation on the expression and function of ERM proteins associated with ABC transporters. Serum levels of inflammatory cytokines such as interleukin (IL)-1$, IL-6, and tumor necrosis factor-alpha (TNF-") in AA rats are
Kawase et al., JOURNAL OF PHARMACEUTICAL SCIENCES 103:4058–4065, 2014
RESEARCH ARTICLE – Pharmacokinetics, Pharmacodynamics and Drug Transport and Metabolism
significantly increased after the acute phase.17 We also examined the effects of inflammatory cytokines on the expression level and localization of ERM proteins.
MATERIALS AND METHODS Antibodies Mouse monoclonal anti-P-gp antibody (C219) (GeneTex, Irvine, California), mouse monoclonal anti-Mrp2 antibody (M2 III-6) (Abcam, Cambridge, UK), rabbit polyclonal anti-Bcrp antibody (Aviva Systems Biology, San Diego, California), mouse monoclonal anti-$-actin (Acris Antibodies, Herford, Germany), peroxidase-labeled goat antimouse IgG antibody (KPL, Massachusetts), CF568 goat antimouse IgG (Biotium, California), CF488 goat antirabbit IgG (Biotium), rabbit monoclonal antirat ezrin (EP886Y) (Abcam), rabbit monoclonal antirat radixin (EP1862Y) (Abcam), and rabbit monoclonal antirat moesin (EP1863Y) (Abcam) were commercially obtained. Preparation of AA Rats Female Sprague–Dawley rats (7-week old) weighing 150–170 g, were purchased from Japan SLC (Shizuoka, Japan). Animals were housed in a temperature-controlled room with free access to standard laboratory chow and water. Rats were treated subcutaneously to right hind footpad and tail base with 1 mg heatkilled Mycobacterium butyricum (Difco Laboratories, Michigan) as an adjuvant suspended in Bayol F oil (10 mg/mL). Hindpaw volumes were measured using liquid plethysmometry. Animals were studied at 7 days (acute phase), and 21 days (chronic phase) after injection of adjuvant or Bayol F. AA rats in the acute phase exhibited local inflammation at the treated site. In the chronic phase, severe inflammation was observed in local and systemic sites. Animals were anesthetized with diethyl ether and sacrificed by exsanguinations via the aorta in the abdomen. Liver, kidney, small intestine (10–15 cm from stomach), and brain were removed. Following flash freezing in liquid nitrogen, all samples were stored at −80◦ C until use. Committee for the Care and Use of Laboratory Animals at Kinki University School of Pharmacy approved the experiments.
Table 1.
4059
Primer Sequences Used in PCR Assays
Gene
Primer Sequence (5 -3 )
Ezrin
GACTGCCTGTGCGCGGACTT GGAGGGGTGGACGGAGGGTC AGGCAACACCAAGCAGCGCA ATCGCACTGCACCCGCACAG ACTCCTCCCTTGCCGCACCA GCTTGCCAGTGGTGTTGGGCT TTGTCCTCGCTAAGGACCTGAA CGTCCAACACAATGTCCCTTTT
Radixin Moesin 18S ribosomal RNA
(pH 7.4) containing 250 mM sucrose and 1% (v/v) protease inhibitor cocktail (Sigma–Aldrich, Missouri) at 4◦ C and centrifuged at 3000g for 10 min at 4◦ C. The supernatant was subsequently collected and used in the analysis. Membrane proteins were extracted using the Mem-PER eukaryotic membrane protein extraction reagent kit (Thermo, Massachusetts). The membrane protein extracted by Mem-PER eukaryotic membrane protein extraction reagent kit include the minimal crosscontamination (typically less than 10%) of hydrophilic (cytoplasmic) protein into membrane protein fraction. Protein concentrations were determined using a BCA protein assay kit (Pierce, Illinois). Homogenates (5 :g) and membrane proteins (5 :g) were diluted with loading buffer, denatured at 95◦ C for 3 min and resolved using sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) 10% (radixin and $-actin) and 6% phosphorylated-radixin (p-radixin) polyacrylamide. The SDSPAGE gel for p-radixin included 20 :M Phos-tag (NARD Institute, Hyogo, Japan) to recognize the activated radixin. Proteins were then transferred to a polyvinylidene fluoride membrane (Hybond-P; GE Healthcare, New Jersey) and subjected to semidry blotting using a Transblot SD (Bio-Rad, California). Radixin, p-radixin, and $-actin proteins were detected using ECL Prime Western blotting detection reagent (GE Healthcare). Immunofluorescence Analysis
Determination of mRNA levels was performed using real-time reverse-transcription polymerase chain reaction (RT-PCR) as previously described.18 Total RNA (500 ng) was extracted from each sample and reverse transcribed to complementary DNA (cDNA) using a PrimeScript-RT reagent Kit (TaKaRa, Shiga, Japan). Reactions were incubated for 15 min at 37◦ C and 5 s at 85◦ C. The reverse-transcribed cDNA was used as a template for real-time RT-PCR. Amplification was performed in a 50-:L reaction mixture containing 2× SYBR Premix Ex Taq (TaKaRa) and 0.2 mM of each primer set as shown in Table 1. PCRs were incubated at 95◦ C for 10 s, and then amplified at 95◦ C for 5 s, 55◦ C for 20 s, and 72◦ C for 31 s for 40 cycles. Data were normalized to the amount of 18S rRNA in each sample. Data were analyzed with ABI Prism 7000 SDS software (Applied Biosystems, California) using the multiplex comparative method.
Livers were perfused fixed by 4% paraformaldehyde in 0.1 M phosphate-buffered saline (PBS) for 10 min. The excised livers were immersed in 4% paraformaldehyde in 0.1 M PBS for 3 h, 10% sucrose for 3 h, 20% sucrose for 3 h, and 30% sucrose for overnight. The tissue blocks embedded in Tissue-Tek O.C.T. compound (Sakura Finetek, Tokyo, Japan) were snap frozen in liquid nitrogen. The cryosections (6 :m thick) were prepared at −20◦ C by cryostat (Leica CM1100; Leica, Wetzlar, Germany). The sections on the slides were hydrated in PBS and blocked for 30 min with 3% bovine serum albumin (BSA)/PBS. After wash with 0.1% BSA/PBS, the slides were incubated with antiMrp2 antibody and antiradixin antibody for 1 h. After wash with 0.1% BSA/PBS, the slides were incubated with CF568 goat antimouse IgG and CF488 goat antirabbit IgG for 1 hr. Samples were mounted in VECTASHIELD (Vector Laboratories, California) and were subjected to confocal laser scanning microscope (FV10i-DOC; OLYMPUS, Tokyo, Japan).
Western Blot Analysis
Measurement of Hepatic Glutathione Levels
Hepatic homogenates and membrane proteins were prepared and subjected to Western blot analysis. For homogenates, 100 mg of each tissue was homogenized in HEPES–Tris buffer
The 10-mg livers of control and AA 7 d and AA 21 d were homogenized in 1 mL of 2 mM ethylenediaminetetraacetic acid (EDTA)/PBS. The homogenates were centrifuged at 6300g for
Real-Time Reverse-Transcription Polymerase Chain Reaction
DOI 10.1002/jps.24210
Kawase et al., JOURNAL OF PHARMACEUTICAL SCIENCES 103:4058–4065, 2014
4060
RESEARCH ARTICLE – Pharmacokinetics, Pharmacodynamics and Drug Transport and Metabolism
Figure 1. Changes in relative mRNA levels of ERM proteins in (a) liver, (b) kidney, (c) small intestine, (d) brain of control, AA 7 d, and AA 21 d. Results are expressed as the mean ± SD (n = 4). There were significant differences between control and AA rats (*p < 0.05).
5 min. The glutathione (GSH) levels in 50 :L supernatant were determined by GSH-Glo glutathione assay (Promega, Wisconsin). Luminescence intensities were measured by luminometer (Junior LB 9509 portable tube luminometer; Berthold Technologies, Bad Wildbad, Germany). Immunoprecipitation Analysis Following procedures were performed at 4◦ C. Livers of control and AA 7 d and AA 21 d were homogenized in 1 mL/g tissue wet weight of lysis buffer containing 25 mM Tris–HCl (pH 7.5), 5 mM EDTA, 250 mM NaCl, 1% (v/v) Triton X-100, 60 mM noctyl-$-D-glucopyranoside, 50 mM NaF, 1 mM Na3 VO4 , and protease inhibitor (1 mM PMSF, 5 :g/mL leupeptin, and 1 :g/mL pepstatin A) and was lysed for 1 h. The tissue homogenate (20 mg protein) was centrifuged at 20,000g for 10 min. A 40-:L Protein G Sepharose 4 Fast Flow (GE Healthcare) and 8 :L anti-P-gp antibody, anti-MRP2 antibody, and anti-Bcrp antibody were added to collected supernatant and were incubated for overnight. The beads were sedimented at 9000g for 1 min and washed three times with lysis buffer. Finally, 50 :L elution buffer containing 10 mM Tris–HCl (pH 6.5), 3% (w/v) SDS, 10% (v/v) glycerol, 5% (v/v) $-mercaptoethanol, 8 M urea, and 0.001% bromophenol blue was added and boiled at 95◦ C for 5 min. After centrifugation of suspension at 9000g for 5 min, the supernatant was subjected to SDS-PAGE and Western blot analysis for ERM proteins. In Vitro Experiments Using HepG2 Cells HepG2 cells were cultured in Dulbecco’s modified Eagle’s medium (Nacalai Tesque, Kyoto, Japan) containing 10% fetal bovine serum, penicillin (100 U/mL), streptomycin (100 :g/mL), and L-glutamine (4 mM) and maintained in a 5% CO2 incubator at 37◦ C. Inflammatory cytokines such as IL-1$, IL-6, and TNF" were added at a concentration of 10 ng/mL to HepG2 cells Kawase et al., JOURNAL OF PHARMACEUTICAL SCIENCES 103:4058–4065, 2014
seeded on 24 well plate at the concentrations 1.0 × 105 cells/mL. At 24 h after treatment, cells were harvested and the total RNA and cell lysate were extracted from cells. The RTPCR and Western blotting analysis were performed as in vivo study using liver samples. For immunofluorescence analysis, HepG2 cells were plated in collagen-coated glass bottom dishes (Matsunami Glass Ind., Osaka, Japan) at the concentrations 1.0 × 105 cells/mL. IL-1$ was added at 10 ng/mL to HepG2 cells. At 24 h after treatment, the medium was removed and the cell washed with PBS (?). After HepG2 cells were fixed with 4% paraformaldehyde for 10 min and were permeabilized with 0.5% Tween-20, the nonspecific binding of antibodies was blocked by 3% BSA in PBS for 30 min. Each dish was then incubated at room temperature for 1 h with anti-radixin antibody and anti-Mrp2 antibody in 0.1% BSA in PBS. Dishes were incubated with CF568 goat antimouse IgG and CF488 goat antirabbit IgG for 1 h. Samples were subjected to confocal laser scanning microscope (FV10i-DOC). Statistical Analysis The significance difference of the mean values between groups was estimated using analysis of variance followed by the Bonferroni test. A p value of less than 0.05 was considered statistically significant.
RESULTS mRNA levels of ERM proteins were determined in the liver, kidney, small intestine, and brain in control and AA rats (Fig. 1). The mRNA levels of radixin in the liver decreased significantly by about 75% in AA 21 d. mRNA levels of ezrin and moesin in the liver did not change (Fig. 1a). mRNA levels of ERM proteins in the kidney, small intestine, and brain did not change in AA 7 d and AA 21 d (Figs. 1b–1d). DOI 10.1002/jps.24210
RESEARCH ARTICLE – Pharmacokinetics, Pharmacodynamics and Drug Transport and Metabolism
Figure 2. Changes in relative protein levels of radixin in homogenates and membrane proteins from livers of AA rats. Results are expressed as the mean ± SD (n = 4).
Protein levels of radixin in liver homogenates and membrane proteins in control and AA rats are shown in Figure 2. In liver homogenates and membrane protein, protein levels of radixin did not change in AA 7 d and AA 21 d. Figure 3 illustrates the localization of radixin and Mrp2 expression in liver of control, AA 7 d, and AA 21 d. The colocalization of radixin and Mrp2 was observed in control. The confocal images in AA 7 d and AA 21 d revealed the disruption for colocalization of radixin and Mrp2 in liver, suggesting that the function of radixin could be decreased without changes in expression levels of radixin. We examined
4061
the relative expression levels of p-radixin/total radixin (Fig. 4). The expression levels of p-radixin/total radixin were significantly decreased in AA 7 d. In AA 21 d, the expression levels of p-radixin/total radixin showed a declining trend. The hepatic GSH levels were determined (Fig. 5) because the hepatic GSH levels are involved in the phosphorylation of radixin. As the development of inflammation, the hepatic GSH levels were significantly decreased in AA 7 d and AA 21 d. To clarify the effects of the decreased functions of radixin on the interactions between ERM proteins and ABC transporters, we examined the levels of protein–protein complexes by immunoprecipitation assay (Fig. 6). Significant decreases in the interactions between radixin and P-gp or Mrp2 were observed in homogenates of AA 21 d. The interactions between ezrin or moesin and P-gp, Mrp2 or Bcrp were not detected in liver of AA 7 d and AA 21 d (data not shown). To clarify the mechanism of decrease in radixin function, we examined the effects of inflammatory cytokines on the expression and localization of radixin (Fig. 7). The addition of IL-1$ but not IL-6 and TNF-" to HepG2 cells results in the decrease of radixin mRNA expression in HepG2 cells (Fig. 7a). These inflammatory cytokines did not affect the mRNA levels of ezrin and moesin (data not shown). The decreases of protein levels of radixin by inflammatory cytokines were not significant (Fig. 7b). The colocalization of radixin and Mrp2 were observed in HepG2 cells. After addition of IL-1$ to HepG2 cells, the colocalization of radixin and Mrp2 was disrupted.
DISCUSSION It is known that expression of ABC transporters are regulated by several stimuli such as heat shock and irradiation, which induce cellular stress or inflammation.19 However, it remains unclear whether inflammation condition affects the expression and function of ERM proteins.
Figure 3. Localization of radixin (green) and Mrp2 (red) expression in liver of control, AA 7 d, and AA 21 d. Arrows indicate colocalization of Mrp2 and radixin. DOI 10.1002/jps.24210
Kawase et al., JOURNAL OF PHARMACEUTICAL SCIENCES 103:4058–4065, 2014
4062
RESEARCH ARTICLE – Pharmacokinetics, Pharmacodynamics and Drug Transport and Metabolism
Figure 5. Hepatic GSH levels in control, AA 7 d, and AA 21 d. The GSH levels in 10 mg liver were measured by GSH-Glo glutathione assay. Results are expressed as the mean ± SD (n = 4). There were significant differences between control and AA rats (*p < 0.05, **p < 0.01).
Figure 4. Changes in relative protein levels of p-radixin/total radixin in membrane proteins from livers of control, AA 7 d, and AA 21 d. Results are expressed as the mean ± SD (n = 4). There were significant differences between control and AA rats (*p < 0.05).
Results in this study showed that the effects of AA on the expression and function of ERM proteins were distinct for ERM proteins in liver. In particular, the linker activities of radixin but not ezrin or moesin to P-gp or Mrp2 were observed in AA 21 d (Fig. 6). The predominant involvement of radixin in localization of ABC transporters on canalicular membrane in liver has been reported. For example, the knockdown of radixin by adenoviruses expressing siRNA in sandwich-cultured rat hepatocytes results in the reduction of membrane localization and activities of Mrp2 in canalicular membrane.8 In the knockdown of ERM proteins by siRNA in HepG2 cells, radixin is involved in membrane localization of P-gp and ezrin is involved in translational process.9 Phosphorylated ERM protein (opened active form) exerts linker activities for ABC transporters.2,3 We have also checked the similar protein levels of ABC transporters afKawase et al., JOURNAL OF PHARMACEUTICAL SCIENCES 103:4058–4065, 2014
ter immunoprecipitation for homogenate. Therefore, results in Figure 6 could reflect the interactions between p-radixin and ABC transporters. The mRNA levels of radixin did not change in kidney, small intestine, and brain (Figs. 1b–1d), and the little interactions between radixin and ABC transporters in kidney were observed in AA 21 d (data not shown). These results suggested that the effects of AA 21 d on the mRNA and function of radixin were liver specific. Liver that is susceptible to inflammation could exhibit marked inflammatory responses compared with other organs. Serum levels of inflammatory cytokines in AA rats are significantly increased after the acute phase.17 Sukhai et al.20 demonstrated that the treatment of rat primary hepatocytes with IL-1$ resulted in a decrease in both the expression and the function of P-gp. The mRNA levels of IL-1$ were higher in AA 21 d compared with control in liver but not kidney.16 The results of in vitro study showed that the mRNA levels of radixin were decreased by addition of IL-1$ to HepG2 cells (Fig. 7), raising the possibility that the increased IL-1$ in AA could be involved in the decreases of function of radixin in liver as well as in HepG2 cells. The mRNA levels of radixin were also decreased by addition of IL-1$ to rat primary hepatocytes (data not shown). Expression levels of radixin did not necessarily exhibit corresponding changes between mRNA and protein levels. These results suggested that the extent of alterations in mRNA levels of radixin were not enough to affect protein levels and/or that translational or post-translational regulation prevented changes in protein levels. However, the details of translational regulation of radixin are unclear. The functions of radixin were decreased in AA without changes in expression levels of radixin in homogenate and membrane protein. DOI 10.1002/jps.24210
RESEARCH ARTICLE – Pharmacokinetics, Pharmacodynamics and Drug Transport and Metabolism
4063
Figure 6. Interactions between radixin and ABC transporters such as P-gp, Mrp2, and Bcrp expressed in canalicular membrane in homogenates from livers of control, AA 7 d, and AA 21 d. Results are expressed as the mean ± SD (n = 4). There were significant differences between control and AA 21 d (**p < 0.01). IP, immunoprecipitation; IB, immunoblotting.
Figure 7. Effects of inflammatory cytokines (IL-1$, IL-6, and TNF-") on the (a) mRNA, and (b) protein expression levels of radixin and (c) localization of radixin and Mrp2 24 h after addition of inflammatory cytokines to HepG2 cells. Localization of radixin (green) and Mrp2 (red) in HepG2 cells treated with IL-1$. Arrows indicate colocalization of Mrp2 and radixin. Results are expressed as the mean ± SD [n = 4 in (a) and (b)]. There were significant differences between control and IL-1$ (*p < 0.05).
The function of radixin was reduced in AA 7 d and AA 21 d (Fig. 4), probably owing to the significant decreases of GSH levels in liver (Fig. 5). Hepatic GSH levels affect the PKA/PKC balance. The decrease of GSH levels results in the PKC elevation. The superior levels of PKC result in dephosphorylation of radixin.21 A change in GSH levels is also important in assessment of toxicological responses and is an indicator of oxidative stress, potentially leading to apoptosis or cell death. Oxidative stress is a triggering factor for MRP2 internalization.22–24 It has been reported that the canalicular Mrp2 localization is reversibly regulated by the intracellular redox status.25,26 DOI 10.1002/jps.24210
In the results of this study, the relative p-radixin expression levels did not necessarily correspond to the interaction levels between radixin and ABC transporters (Figs. 4 and 6). N-terminus of ERM proteins in activated open form shows linker activities for transporter directly or indirectly via ERMbinding phosphoprotein (EBP50) that expresses in canalicular membrane.27 The levels of EBP50 could be possibly involved in the interactions between radixin and ABC transporters. Moreover, Rho-kinase (ROCK),28 protein kinase C2, and6,29 protein kinase C"30 are involved in the activation of ERM proteins. However, it is unclear whether these factors are affected by Kawase et al., JOURNAL OF PHARMACEUTICAL SCIENCES 103:4058–4065, 2014
4064
RESEARCH ARTICLE – Pharmacokinetics, Pharmacodynamics and Drug Transport and Metabolism
inflammation. More findings on the alterations in EBP50 and kinase in inflammation are needed to clarify the regulation mechanism of ERM proteins. The intrahepatic GSH depletion causes Mrp2 internalization.25 We showed that the hepatic GSH levels were significantly decreased in AA 7 d and AA 21 d (Fig. 5) and the membrane expression of Mrp2 in the liver was decreased both in AA 7 d and AA 21 d.16 These results suggested that the membrane expression of Mrp2 could decrease without change of interaction between radixin and Mrp2 in AA 7 d. Therefore, further studies are needed to clarify the changes in expression and activity of other factors such as EBP50 in AA rats. Compared with ERM proteins in liver, different roles for transporters are shown in other organs. For example, it has been reported on the roles of ERM proteins in intestinal transporters. Ezrin are involved in the post-translational regulation for Mrp2 and P-gp.31 The higher correlation between the expression levels of p-ezrin and Mrp2 was observed. Radixin is involved in post-translational regulation and activity of Pgp in small intestine. In radixin-deficient mice, the little regional differences in expression levels of P-gp were observed in small intestine.32 After etoposide treatment to mice, the phosphorylation of ERM proteins are regulated via activation of RhoA/ROCK in small intestine.33,34 For other ABC transporters, it has been reported that the knockdown of radixin in SGC-7901 cells affects the expression and activity of only Mrp2 among Mrp1-6 family members,35 suggesting that radixin is a selective modulator for the expression and function of ABC transporters.
CONCLUSIONS The inflammatory condition induces the decrease in functions of radixin rather than expression levels of radixin. The decreased functions of radixin could affect the interactions between radixin and ABC transporters. These findings provide the therapeutic information on biliary excretion-mediated ABC transporter in inflammation.
ACKNOWLEDGMENTS This work was supported by JSPS KAKENHI Grant Number 26860119 and the “Antiaging” Project for Private Universities, with a matching fund subsidy from Ministry of Education, Culture, Sports, Science, and Technology. We wish to thank Dr. Tomoko Sugiura in Pharmaceutical and Health Sciences, Kanazawa University, for useful advices.
REFERENCES 1. Sato N, Funayama N, Nagahuchi A, Yonemura S, Tsukita S, Tsukita S. 1992. A gene family consisting of ezrin, radixin and moesin. Its specific localization at actin filament/plasma membrane association sites. J Cell Sci 103:131–143. 2. Gary R, Bretscher A. 1995. Ezrin self-association involves binding of an N-terminal domain to a normally masked C-terminal domain that includes the F-actin binding site. Mol Biol Cell 6:1061– 1075. 3. Reczek D, Berryman M, Bretscher A. 1997. Identification of EBP50: A PDZ-containing phosphoprotein that associates with members of the ezrin–radixin–moesin family. J Cell Biol 139:169–179. Kawase et al., JOURNAL OF PHARMACEUTICAL SCIENCES 103:4058–4065, 2014
4. Suda J, Zhu L, Karvar S. 2011. Phosphorylation of radixin regulates cell polarity and Mrp-2 distribution in hepatocytes. Am J Physiol Cell Physiol 300:C416–C424. 5. Yonemura S, Matsui T, Tsukita S, Tsukita S. 2002. Rho-dependent and -independent activation mechanisms of ezrin/radixin/moesin proteins: An essential role for polyphosphoinositides in vivo. J Cell Sci 115:2569–2580. 6. Simons PC, Pietromonaco SF, Reczek D, Bretscher A, Elias L. 1998. C-terminal threonine phosphorylation activates ERM proteins to link the cell’s cortical lipid bilayer to the cytoskeleton. Biochem Biophys Res Commun 253:561–565. 7. Kikuchi S, Hata M, Fukumoto K, Yamane Y, Matsui T, Tamura A, Yonemura S, Yamagishi H, Keppler D, Tsukita S, Tsukita S. 2002. Radixin deficiency causes conjugated hyperbilirubinemia with loss of Mrp2 from bile canalicular membranes. Nat Genet 31:320–325. 8. Wang W, Soroka CJ, Mennone A, Rahnert C, Harry K, Pypaert M, Boyer JL. 2006. Radixin is required to maintain apical canalicular membrane structure and function in rat hepatocytes. Gastroenterology 131:878–884. 9. Kano T, Wada S, Morimoto K, Kato Y, Ogihara T. 2011. Effect of knockdown of ezrin, radixin, and moesin on P-glycoprotein function in HepG2 cells. J Pharm Sci 100:5308–5314. 10. Cressman AM, Petrovic V, Piquette-Miller M. 2012. Inflammationmediated changes in drug transporter expression/activity: Implications for therapeutic drug response. Expert Rev Clin Pharmacol 5:69–89. 11. Kawase A, Tsunokuni Y, Iwaki M. 2007. Effects of alterations in CAR on bilirubin detoxification in mouse collagen-induced arthritis. Drug Metab Dispos 35:256–261. 12. Kawase A, Ikuta H, Uno S, Yamamoto K, Akitsu N, Nagao T, Iwaki M. 2013. Alteration in plasma protein binding properties of propranolol and flurbiprofen during development of adjuvant-induced arthritis in rats. Xenobiotica 43:246–252. 13. Uno S, Kawase A, Tsuji A, Tanino T, Iwaki M. 2007. Decreased intestinal CYP3A and P-glycoprotein activities in rats with adjuvant arthritis. Drug Metab Pharmacokinet 22:313–321. 14. Uno S, Uraki M, Ito A, Shinozaki Y, Yamada A, Kawase A, Iwaki M. 2009. Changes in mRNA expression of ABC and SLC transporters in liver and intestines of the adjuvant-induced arthritis rat. Biopharm Drug Dispos 30:49–54. 15. Williams RC Jr. 1992. Rheumatoid factors: Historical perspective, origins and possible role in disease. J Rheumatol Suppl 32:42–45. 16. Kawase A, Norikane S, Okada A, Adachi M, Kato Y, Iwaki M. 2014. Distinct alterations in ABC transporter expression in liver, kidney, small intestine, and brain in adjuvant-induced arthritic rats. J Pharm Sci 103:2556–2564. 17. Cai X, Wong YF, Zhou H, Xie Y, Liu ZQ, Jiang ZH, Bian ZX, Xu HX, Liu L. 2006. The comparative study of Sprague–Dawley and Lewis rats in adjuvant-induced arthritis. Naunyn-Schmiedeberg’s Arch Pharmacol 373:140–147. 18. Kawase A, Fujii A, Negoro M, Akai R, Ishikubo M, Komura H, Iwaki M. 2008. Differences in cytochrome P450 and nuclear receptor mRNA levels in liver and small intestine between SD and DA rats. Drug Metab Pharmacokinet 23:196–206. 19. Sukhai M, Piquette-Miller M. 2000. Regulation of the multidrug resistance genes by stress signals. J Pharm Pharmac Sci 3:268–280. 20. Sukhai M, Yong A, Pak A, Piquette-Miller M. 2001. Decreased expression of P-glycoprotein in interleukin-1beta and interleukin-6 treated rat hepatocytes. Inflam Res 50:362–370. 21. Sekine S, Ito K, Saeki J, Horie T. 2011. Interaction of Mrp2 with radixin cause reversible canalicular Mrp2 localization induced by intracellular redox status. Biochim Biophys Acta 1812:1427–1434. 22. Ji B, Ito K, Sekine S, Tajima A, Horie T. 2004. Ethacrynicacid-induced glutathione depletion and oxidative stress in normal and Mrp2-deficient rat liver. Free Radic Biol Med 37:1718– 1729. 23. Schmitt M, Kubitz R, Wettstein M, vom Dahl S, Haussinger D. 2000. Retrieval of the mrp2 gene encoded conjugate export pump from the canalicular membrane contributes to cholestasis induced by DOI 10.1002/jps.24210
RESEARCH ARTICLE – Pharmacokinetics, Pharmacodynamics and Drug Transport and Metabolism
tert-butyl hydroperoxide and chloro-dinitrobenzene. Biol Chem 381:487–495. 24. Sekine S, Ito K, Horie T. 2008. Canalicular Mrp2 localization is reversibly regulated by the intracellular redox status. Am J Physiol Gastrointest Liver Physiol 295:G1035–G1041. 25. Sekine S, Mitsuki K, Ito K, Kugioka S, Horie T. 2012. Sustained intrahepatic glutathione depletion causes proteasomal degradation of multidrug resistance-associated protein 2 in rat liver. Biochim Biophys Acta 1822:980–987. 26. Saeki J, Sekine S, Horie T. 2011. LPS-induced dissociation of multidrug resistance-associated protein 2 (Mrp2) and radixin is associated with Mrp2 selective internalization in rats. Biochem Pharmacol 81:178–184. 27. Fouassier L, Duan CY, Feranchak AP, Yun CH, Sutherland E, Simon F, Fitz JG, Doctor RB. 2001. Ezrin-radixin-moesin-binding phosphoprotein 50 is expressed at the apical membrane of rat liver epithelia. Hepatology 33:166–176. 28. Matsui T, Maeda M, Doi Y, Yonemura S, Amano M, Kaibuchi K, Tsukita S. 1998. Rho-kinase phosphorylates COOH-terminal threonines of ezrin/radixin/moesin (ERM) proteins and regulates their head-to-tail association. J Cell Biol 140:647–657. 29. Pietromonaco SF, Simons PC, Altman A, Elias L. 1998. Protein kinase C-theta phosphorylation of moesin in the actin-binding sequence. J Biol Chem 273:7594–7603.
DOI 10.1002/jps.24210
4065
30. Ng T, Parsons M, Hughes WE, Monypenny J, Zicha D, Gautreau A, Arpin M, Gschmeissner S, Verveer PJ, Bastiaens PI, Parker PJ. 2001. Ezrin is a downstream effector of trafficking PKC-integrin complexes involved in the control of cell motility. EMBO J 20:2723– 2741. 31. Nakano T, Sekine S, Ito K, Horie T. 2013. Ezrin regulates the expression of Mrp2/Abcc2 and Mdr1/Abcb1 along the rat small intestinal tract. Am J Physiol Gastrointest Liver Physiol 305:G807– G817. 32. Yano K, Tomono T, Sakai R, Kano T, Morimoto K, Kato Y, Ogihara T. 2013. Contribution of radixin to P-glycoprotein expression and transport activity in mouse small intestine in vivo. J Pharm Sci 102:2875– 2881. 33. Kobori T, Harada S, Nakamoto K, Tokuyama S. 2013. Activation of ERM-family proteins via RhoA-ROCK signaling increases intestinal P-gp expression and leads to attenuation of oral morphine analgesia. J Pharm Sci 102:1095–1105. 34. Kobori T, Harada S, Nakamoto K, Tokuyama S. 2013. Timedependent changes in the activation of RhoA/ROCK and ERM/p-ERM in the increased expression of intestinal P-glycoprotein by repeated oral treatment with etoposide. J Pharm Sci 102:1670–1682. 35. He XJ, Wang WR, Zhang Y, Yang Q. 2012. The effect of radixin knockdown on the expression and efflux function of MRP2 in SGC-7901 cells. Eur J Pharm Sci 46:426–434.
Kawase et al., JOURNAL OF PHARMACEUTICAL SCIENCES 103:4058–4065, 2014
Decreased Radixin Function for ATP-Binding Cassette Transporters in Liver in Adjuvant-Induced Arthritis Rats ATSUSHI KAWASE,1 MISATO SAKATA,1 NAGISA YADA,1 MISAKI NAKASAKA,1 TAKUYA SHIMIZU,2 YUKIO KATO,2 MASAHIRO IWAKI1 1 2
Department of Pharmacy, School of Pharmacy, Kinki University, Osaka 577-8502, Japan Faculty of Pharmacy, Institute of Medical, Pharmaceutical and Health Sciences, Kanazawa University, Kanazawa 920-1192, Japan
Received 7 August 2014; revised 20 September 2014; accepted 22 September 2014 Published online 20 October 2014 in Wiley Online Library (wileyonlinelibrary.com). DOI 10.1002/jps.24210 ABSTRACT: Pathophysiological changes are associated with alterations in the expression and function of numerous ADME-related proteins. We have previously demonstrated that the membrane localization of ATP-binding cassette (ABC) transporters in liver was decreased without change of total expression levels in adjuvant-induced arthritis (AA) in rats. Ezrin/radixin/moesin (ERM) proteins are involved in localization of some ABC transporters in canalicular membrane. The mRNA levels of radixin decreased significantly in liver but not kidney, small intestine, and brain. The mRNA levels of ezrin and moesin did not change in AA. The membrane localization of radixin was reduced in liver of AA and the ratios of activated radixin (p-radixin) to total radixin were decreased in AA, although the protein levels of radixin did not change in homogenate and membrane protein. To clarify whether AA affects the linker functions of ERM proteins, we examined the interactions between ERM proteins and ABC transporters. The interactions between radixin and ABC transporters were decreased in AA. In vitro studies using human hepatoma HepG2 cells showed that interleukin-1 decreased the mRNA levels of radixin and colocalization of radixin and Mrp2. Our results show that the decreased radixin functions affect the interaction between radixin and ABC transporters in C 2014 Wiley Periodicals, Inc. and the American Pharmacists Association J Pharm Sci 103:4058–4065, 2014 inflammation. Keywords: ABC transporters; active transport; disease states; efflux pumps; elimination; membrane transport; MRP; multidrug resistance transporters; P-glycoprotein
INTRODUCTION Drug transporters, including efflux transporters [ATP-binding cassette (ABC) proteins] and uptake transporters [solute carrier (SLC) proteins], have an important impact on drug disposition, efficacy, and toxicity. The ezrin/radixin/moesin (ERM) proteins are a closely related family of proteins that crosslink cytoskeletal actin filaments (F-actin) with integral plasma membrane proteins.1 ERM proteins are involved in membrane localization and function of ABC transporters expressed in canalicular membrane. Recently, it has been focused on the necessity of adaptor/scaffold proteins in addition to transporter itself for transport activity. The intramolecular interactions keep ERM proteins in dormant closed form in cytoplasm.2,3 The phosphorylation of threonine residue at C-terminus switch ERM proteins to activated open form that shows the linker activities for transporter.4–6 In radixin-deficient mice, the development of conjugated hyperbilirubinemia associated with the loss of ABC transporters such as multidrug resistance-associated protein 2 (Mrp2/Abcc2) from the canalicular membrane like Dubin–Johnson syndrome in human7 suggests that radixin has an important role in membrane localization of Mrp2. Radixin is also involved in membrane localization of P-glycoprotein (P-gp/Abcb1)se.8,9 Pathophysiological changes in human patients and in animal models of infection or inflammation are associated with immediate and often dramatic alterations in the production of Correspondence to: Masahiro Iwaki (Telephone: +81-643073628; Fax: +81667301394; E-mail: [email protected]) Journal of Pharmaceutical Sciences, Vol. 103, 4058–4065 (2014)
C 2014 Wiley Periodicals, Inc. and the American Pharmacists Association
4058
numerous liver-derived proteins. Decreases of ABC transporter activities could lead to intracellular accumulation of drugs and/or their metabolites. Inflammation-mediated changes in drug transporter expression and activity affect the therapeutic drug response.10 In particular, liver is susceptible to inflammation such as virus hepatitis and drug-induced hepatitis and main organ for metabolisms of xenobiotics and endogenous substrates. We previously demonstrated the alterations in expression and activity of drug metabolizing enzymes and transporters in inflammation using mice with collagen-induced arthritis or rats with adjuvant-induced arthritis (AA).11–14 AA rats have been used as a model for rheumatoid arthritis for the development of anti-inflammatory medicines because they exhibit systemic inflammatory disease with changes to bone and cartilage similar to that observed in humans with rheumatoid arthritis.15 AA rats at 7 days (AA 7 d) and 21 days (AA 21 d) after adjuvant treatment have been shown to exhibit acute and chronic inflammatory conditions. The increases of lactate dehydrogenase, aspartate aminotransferase, alkaline phosphatase, and "1 -acid glycoprotein and decreases of albumin were observed in serum of AA rats.12 Our previous study showed that the hepatic membrane localization of ABC transporters such as P-gp, Mrp2, and breast cancer-resistance protein (Bcrp/Abcg2) were decreased without changes of total expression levels in AA rats.16 Therefore, there could be impacts on the expression and function of ERM proteins in AA rats. These backgrounds prompted us to investigate the effects of inflammation on the expression and function of ERM proteins associated with ABC transporters. Serum levels of inflammatory cytokines such as interleukin (IL)-1$, IL-6, and tumor necrosis factor-alpha (TNF-") in AA rats are
Kawase et al., JOURNAL OF PHARMACEUTICAL SCIENCES 103:4058–4065, 2014
RESEARCH ARTICLE – Pharmacokinetics, Pharmacodynamics and Drug Transport and Metabolism
significantly increased after the acute phase.17 We also examined the effects of inflammatory cytokines on the expression level and localization of ERM proteins.
MATERIALS AND METHODS Antibodies Mouse monoclonal anti-P-gp antibody (C219) (GeneTex, Irvine, California), mouse monoclonal anti-Mrp2 antibody (M2 III-6) (Abcam, Cambridge, UK), rabbit polyclonal anti-Bcrp antibody (Aviva Systems Biology, San Diego, California), mouse monoclonal anti-$-actin (Acris Antibodies, Herford, Germany), peroxidase-labeled goat antimouse IgG antibody (KPL, Massachusetts), CF568 goat antimouse IgG (Biotium, California), CF488 goat antirabbit IgG (Biotium), rabbit monoclonal antirat ezrin (EP886Y) (Abcam), rabbit monoclonal antirat radixin (EP1862Y) (Abcam), and rabbit monoclonal antirat moesin (EP1863Y) (Abcam) were commercially obtained. Preparation of AA Rats Female Sprague–Dawley rats (7-week old) weighing 150–170 g, were purchased from Japan SLC (Shizuoka, Japan). Animals were housed in a temperature-controlled room with free access to standard laboratory chow and water. Rats were treated subcutaneously to right hind footpad and tail base with 1 mg heatkilled Mycobacterium butyricum (Difco Laboratories, Michigan) as an adjuvant suspended in Bayol F oil (10 mg/mL). Hindpaw volumes were measured using liquid plethysmometry. Animals were studied at 7 days (acute phase), and 21 days (chronic phase) after injection of adjuvant or Bayol F. AA rats in the acute phase exhibited local inflammation at the treated site. In the chronic phase, severe inflammation was observed in local and systemic sites. Animals were anesthetized with diethyl ether and sacrificed by exsanguinations via the aorta in the abdomen. Liver, kidney, small intestine (10–15 cm from stomach), and brain were removed. Following flash freezing in liquid nitrogen, all samples were stored at −80◦ C until use. Committee for the Care and Use of Laboratory Animals at Kinki University School of Pharmacy approved the experiments.
Table 1.
4059
Primer Sequences Used in PCR Assays
Gene
Primer Sequence (5 -3 )
Ezrin
GACTGCCTGTGCGCGGACTT GGAGGGGTGGACGGAGGGTC AGGCAACACCAAGCAGCGCA ATCGCACTGCACCCGCACAG ACTCCTCCCTTGCCGCACCA GCTTGCCAGTGGTGTTGGGCT TTGTCCTCGCTAAGGACCTGAA CGTCCAACACAATGTCCCTTTT
Radixin Moesin 18S ribosomal RNA
(pH 7.4) containing 250 mM sucrose and 1% (v/v) protease inhibitor cocktail (Sigma–Aldrich, Missouri) at 4◦ C and centrifuged at 3000g for 10 min at 4◦ C. The supernatant was subsequently collected and used in the analysis. Membrane proteins were extracted using the Mem-PER eukaryotic membrane protein extraction reagent kit (Thermo, Massachusetts). The membrane protein extracted by Mem-PER eukaryotic membrane protein extraction reagent kit include the minimal crosscontamination (typically less than 10%) of hydrophilic (cytoplasmic) protein into membrane protein fraction. Protein concentrations were determined using a BCA protein assay kit (Pierce, Illinois). Homogenates (5 :g) and membrane proteins (5 :g) were diluted with loading buffer, denatured at 95◦ C for 3 min and resolved using sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) 10% (radixin and $-actin) and 6% phosphorylated-radixin (p-radixin) polyacrylamide. The SDSPAGE gel for p-radixin included 20 :M Phos-tag (NARD Institute, Hyogo, Japan) to recognize the activated radixin. Proteins were then transferred to a polyvinylidene fluoride membrane (Hybond-P; GE Healthcare, New Jersey) and subjected to semidry blotting using a Transblot SD (Bio-Rad, California). Radixin, p-radixin, and $-actin proteins were detected using ECL Prime Western blotting detection reagent (GE Healthcare). Immunofluorescence Analysis
Determination of mRNA levels was performed using real-time reverse-transcription polymerase chain reaction (RT-PCR) as previously described.18 Total RNA (500 ng) was extracted from each sample and reverse transcribed to complementary DNA (cDNA) using a PrimeScript-RT reagent Kit (TaKaRa, Shiga, Japan). Reactions were incubated for 15 min at 37◦ C and 5 s at 85◦ C. The reverse-transcribed cDNA was used as a template for real-time RT-PCR. Amplification was performed in a 50-:L reaction mixture containing 2× SYBR Premix Ex Taq (TaKaRa) and 0.2 mM of each primer set as shown in Table 1. PCRs were incubated at 95◦ C for 10 s, and then amplified at 95◦ C for 5 s, 55◦ C for 20 s, and 72◦ C for 31 s for 40 cycles. Data were normalized to the amount of 18S rRNA in each sample. Data were analyzed with ABI Prism 7000 SDS software (Applied Biosystems, California) using the multiplex comparative method.
Livers were perfused fixed by 4% paraformaldehyde in 0.1 M phosphate-buffered saline (PBS) for 10 min. The excised livers were immersed in 4% paraformaldehyde in 0.1 M PBS for 3 h, 10% sucrose for 3 h, 20% sucrose for 3 h, and 30% sucrose for overnight. The tissue blocks embedded in Tissue-Tek O.C.T. compound (Sakura Finetek, Tokyo, Japan) were snap frozen in liquid nitrogen. The cryosections (6 :m thick) were prepared at −20◦ C by cryostat (Leica CM1100; Leica, Wetzlar, Germany). The sections on the slides were hydrated in PBS and blocked for 30 min with 3% bovine serum albumin (BSA)/PBS. After wash with 0.1% BSA/PBS, the slides were incubated with antiMrp2 antibody and antiradixin antibody for 1 h. After wash with 0.1% BSA/PBS, the slides were incubated with CF568 goat antimouse IgG and CF488 goat antirabbit IgG for 1 hr. Samples were mounted in VECTASHIELD (Vector Laboratories, California) and were subjected to confocal laser scanning microscope (FV10i-DOC; OLYMPUS, Tokyo, Japan).
Western Blot Analysis
Measurement of Hepatic Glutathione Levels
Hepatic homogenates and membrane proteins were prepared and subjected to Western blot analysis. For homogenates, 100 mg of each tissue was homogenized in HEPES–Tris buffer
The 10-mg livers of control and AA 7 d and AA 21 d were homogenized in 1 mL of 2 mM ethylenediaminetetraacetic acid (EDTA)/PBS. The homogenates were centrifuged at 6300g for
Real-Time Reverse-Transcription Polymerase Chain Reaction
DOI 10.1002/jps.24210
Kawase et al., JOURNAL OF PHARMACEUTICAL SCIENCES 103:4058–4065, 2014
4060
RESEARCH ARTICLE – Pharmacokinetics, Pharmacodynamics and Drug Transport and Metabolism
Figure 1. Changes in relative mRNA levels of ERM proteins in (a) liver, (b) kidney, (c) small intestine, (d) brain of control, AA 7 d, and AA 21 d. Results are expressed as the mean ± SD (n = 4). There were significant differences between control and AA rats (*p < 0.05).
5 min. The glutathione (GSH) levels in 50 :L supernatant were determined by GSH-Glo glutathione assay (Promega, Wisconsin). Luminescence intensities were measured by luminometer (Junior LB 9509 portable tube luminometer; Berthold Technologies, Bad Wildbad, Germany). Immunoprecipitation Analysis Following procedures were performed at 4◦ C. Livers of control and AA 7 d and AA 21 d were homogenized in 1 mL/g tissue wet weight of lysis buffer containing 25 mM Tris–HCl (pH 7.5), 5 mM EDTA, 250 mM NaCl, 1% (v/v) Triton X-100, 60 mM noctyl-$-D-glucopyranoside, 50 mM NaF, 1 mM Na3 VO4 , and protease inhibitor (1 mM PMSF, 5 :g/mL leupeptin, and 1 :g/mL pepstatin A) and was lysed for 1 h. The tissue homogenate (20 mg protein) was centrifuged at 20,000g for 10 min. A 40-:L Protein G Sepharose 4 Fast Flow (GE Healthcare) and 8 :L anti-P-gp antibody, anti-MRP2 antibody, and anti-Bcrp antibody were added to collected supernatant and were incubated for overnight. The beads were sedimented at 9000g for 1 min and washed three times with lysis buffer. Finally, 50 :L elution buffer containing 10 mM Tris–HCl (pH 6.5), 3% (w/v) SDS, 10% (v/v) glycerol, 5% (v/v) $-mercaptoethanol, 8 M urea, and 0.001% bromophenol blue was added and boiled at 95◦ C for 5 min. After centrifugation of suspension at 9000g for 5 min, the supernatant was subjected to SDS-PAGE and Western blot analysis for ERM proteins. In Vitro Experiments Using HepG2 Cells HepG2 cells were cultured in Dulbecco’s modified Eagle’s medium (Nacalai Tesque, Kyoto, Japan) containing 10% fetal bovine serum, penicillin (100 U/mL), streptomycin (100 :g/mL), and L-glutamine (4 mM) and maintained in a 5% CO2 incubator at 37◦ C. Inflammatory cytokines such as IL-1$, IL-6, and TNF" were added at a concentration of 10 ng/mL to HepG2 cells Kawase et al., JOURNAL OF PHARMACEUTICAL SCIENCES 103:4058–4065, 2014
seeded on 24 well plate at the concentrations 1.0 × 105 cells/mL. At 24 h after treatment, cells were harvested and the total RNA and cell lysate were extracted from cells. The RTPCR and Western blotting analysis were performed as in vivo study using liver samples. For immunofluorescence analysis, HepG2 cells were plated in collagen-coated glass bottom dishes (Matsunami Glass Ind., Osaka, Japan) at the concentrations 1.0 × 105 cells/mL. IL-1$ was added at 10 ng/mL to HepG2 cells. At 24 h after treatment, the medium was removed and the cell washed with PBS (?). After HepG2 cells were fixed with 4% paraformaldehyde for 10 min and were permeabilized with 0.5% Tween-20, the nonspecific binding of antibodies was blocked by 3% BSA in PBS for 30 min. Each dish was then incubated at room temperature for 1 h with anti-radixin antibody and anti-Mrp2 antibody in 0.1% BSA in PBS. Dishes were incubated with CF568 goat antimouse IgG and CF488 goat antirabbit IgG for 1 h. Samples were subjected to confocal laser scanning microscope (FV10i-DOC). Statistical Analysis The significance difference of the mean values between groups was estimated using analysis of variance followed by the Bonferroni test. A p value of less than 0.05 was considered statistically significant.
RESULTS mRNA levels of ERM proteins were determined in the liver, kidney, small intestine, and brain in control and AA rats (Fig. 1). The mRNA levels of radixin in the liver decreased significantly by about 75% in AA 21 d. mRNA levels of ezrin and moesin in the liver did not change (Fig. 1a). mRNA levels of ERM proteins in the kidney, small intestine, and brain did not change in AA 7 d and AA 21 d (Figs. 1b–1d). DOI 10.1002/jps.24210
RESEARCH ARTICLE – Pharmacokinetics, Pharmacodynamics and Drug Transport and Metabolism
Figure 2. Changes in relative protein levels of radixin in homogenates and membrane proteins from livers of AA rats. Results are expressed as the mean ± SD (n = 4).
Protein levels of radixin in liver homogenates and membrane proteins in control and AA rats are shown in Figure 2. In liver homogenates and membrane protein, protein levels of radixin did not change in AA 7 d and AA 21 d. Figure 3 illustrates the localization of radixin and Mrp2 expression in liver of control, AA 7 d, and AA 21 d. The colocalization of radixin and Mrp2 was observed in control. The confocal images in AA 7 d and AA 21 d revealed the disruption for colocalization of radixin and Mrp2 in liver, suggesting that the function of radixin could be decreased without changes in expression levels of radixin. We examined
4061
the relative expression levels of p-radixin/total radixin (Fig. 4). The expression levels of p-radixin/total radixin were significantly decreased in AA 7 d. In AA 21 d, the expression levels of p-radixin/total radixin showed a declining trend. The hepatic GSH levels were determined (Fig. 5) because the hepatic GSH levels are involved in the phosphorylation of radixin. As the development of inflammation, the hepatic GSH levels were significantly decreased in AA 7 d and AA 21 d. To clarify the effects of the decreased functions of radixin on the interactions between ERM proteins and ABC transporters, we examined the levels of protein–protein complexes by immunoprecipitation assay (Fig. 6). Significant decreases in the interactions between radixin and P-gp or Mrp2 were observed in homogenates of AA 21 d. The interactions between ezrin or moesin and P-gp, Mrp2 or Bcrp were not detected in liver of AA 7 d and AA 21 d (data not shown). To clarify the mechanism of decrease in radixin function, we examined the effects of inflammatory cytokines on the expression and localization of radixin (Fig. 7). The addition of IL-1$ but not IL-6 and TNF-" to HepG2 cells results in the decrease of radixin mRNA expression in HepG2 cells (Fig. 7a). These inflammatory cytokines did not affect the mRNA levels of ezrin and moesin (data not shown). The decreases of protein levels of radixin by inflammatory cytokines were not significant (Fig. 7b). The colocalization of radixin and Mrp2 were observed in HepG2 cells. After addition of IL-1$ to HepG2 cells, the colocalization of radixin and Mrp2 was disrupted.
DISCUSSION It is known that expression of ABC transporters are regulated by several stimuli such as heat shock and irradiation, which induce cellular stress or inflammation.19 However, it remains unclear whether inflammation condition affects the expression and function of ERM proteins.
Figure 3. Localization of radixin (green) and Mrp2 (red) expression in liver of control, AA 7 d, and AA 21 d. Arrows indicate colocalization of Mrp2 and radixin. DOI 10.1002/jps.24210
Kawase et al., JOURNAL OF PHARMACEUTICAL SCIENCES 103:4058–4065, 2014
4062
RESEARCH ARTICLE – Pharmacokinetics, Pharmacodynamics and Drug Transport and Metabolism
Figure 5. Hepatic GSH levels in control, AA 7 d, and AA 21 d. The GSH levels in 10 mg liver were measured by GSH-Glo glutathione assay. Results are expressed as the mean ± SD (n = 4). There were significant differences between control and AA rats (*p < 0.05, **p < 0.01).
Figure 4. Changes in relative protein levels of p-radixin/total radixin in membrane proteins from livers of control, AA 7 d, and AA 21 d. Results are expressed as the mean ± SD (n = 4). There were significant differences between control and AA rats (*p < 0.05).
Results in this study showed that the effects of AA on the expression and function of ERM proteins were distinct for ERM proteins in liver. In particular, the linker activities of radixin but not ezrin or moesin to P-gp or Mrp2 were observed in AA 21 d (Fig. 6). The predominant involvement of radixin in localization of ABC transporters on canalicular membrane in liver has been reported. For example, the knockdown of radixin by adenoviruses expressing siRNA in sandwich-cultured rat hepatocytes results in the reduction of membrane localization and activities of Mrp2 in canalicular membrane.8 In the knockdown of ERM proteins by siRNA in HepG2 cells, radixin is involved in membrane localization of P-gp and ezrin is involved in translational process.9 Phosphorylated ERM protein (opened active form) exerts linker activities for ABC transporters.2,3 We have also checked the similar protein levels of ABC transporters afKawase et al., JOURNAL OF PHARMACEUTICAL SCIENCES 103:4058–4065, 2014
ter immunoprecipitation for homogenate. Therefore, results in Figure 6 could reflect the interactions between p-radixin and ABC transporters. The mRNA levels of radixin did not change in kidney, small intestine, and brain (Figs. 1b–1d), and the little interactions between radixin and ABC transporters in kidney were observed in AA 21 d (data not shown). These results suggested that the effects of AA 21 d on the mRNA and function of radixin were liver specific. Liver that is susceptible to inflammation could exhibit marked inflammatory responses compared with other organs. Serum levels of inflammatory cytokines in AA rats are significantly increased after the acute phase.17 Sukhai et al.20 demonstrated that the treatment of rat primary hepatocytes with IL-1$ resulted in a decrease in both the expression and the function of P-gp. The mRNA levels of IL-1$ were higher in AA 21 d compared with control in liver but not kidney.16 The results of in vitro study showed that the mRNA levels of radixin were decreased by addition of IL-1$ to HepG2 cells (Fig. 7), raising the possibility that the increased IL-1$ in AA could be involved in the decreases of function of radixin in liver as well as in HepG2 cells. The mRNA levels of radixin were also decreased by addition of IL-1$ to rat primary hepatocytes (data not shown). Expression levels of radixin did not necessarily exhibit corresponding changes between mRNA and protein levels. These results suggested that the extent of alterations in mRNA levels of radixin were not enough to affect protein levels and/or that translational or post-translational regulation prevented changes in protein levels. However, the details of translational regulation of radixin are unclear. The functions of radixin were decreased in AA without changes in expression levels of radixin in homogenate and membrane protein. DOI 10.1002/jps.24210
RESEARCH ARTICLE – Pharmacokinetics, Pharmacodynamics and Drug Transport and Metabolism
4063
Figure 6. Interactions between radixin and ABC transporters such as P-gp, Mrp2, and Bcrp expressed in canalicular membrane in homogenates from livers of control, AA 7 d, and AA 21 d. Results are expressed as the mean ± SD (n = 4). There were significant differences between control and AA 21 d (**p < 0.01). IP, immunoprecipitation; IB, immunoblotting.
Figure 7. Effects of inflammatory cytokines (IL-1$, IL-6, and TNF-") on the (a) mRNA, and (b) protein expression levels of radixin and (c) localization of radixin and Mrp2 24 h after addition of inflammatory cytokines to HepG2 cells. Localization of radixin (green) and Mrp2 (red) in HepG2 cells treated with IL-1$. Arrows indicate colocalization of Mrp2 and radixin. Results are expressed as the mean ± SD [n = 4 in (a) and (b)]. There were significant differences between control and IL-1$ (*p < 0.05).
The function of radixin was reduced in AA 7 d and AA 21 d (Fig. 4), probably owing to the significant decreases of GSH levels in liver (Fig. 5). Hepatic GSH levels affect the PKA/PKC balance. The decrease of GSH levels results in the PKC elevation. The superior levels of PKC result in dephosphorylation of radixin.21 A change in GSH levels is also important in assessment of toxicological responses and is an indicator of oxidative stress, potentially leading to apoptosis or cell death. Oxidative stress is a triggering factor for MRP2 internalization.22–24 It has been reported that the canalicular Mrp2 localization is reversibly regulated by the intracellular redox status.25,26 DOI 10.1002/jps.24210
In the results of this study, the relative p-radixin expression levels did not necessarily correspond to the interaction levels between radixin and ABC transporters (Figs. 4 and 6). N-terminus of ERM proteins in activated open form shows linker activities for transporter directly or indirectly via ERMbinding phosphoprotein (EBP50) that expresses in canalicular membrane.27 The levels of EBP50 could be possibly involved in the interactions between radixin and ABC transporters. Moreover, Rho-kinase (ROCK),28 protein kinase C2, and6,29 protein kinase C"30 are involved in the activation of ERM proteins. However, it is unclear whether these factors are affected by Kawase et al., JOURNAL OF PHARMACEUTICAL SCIENCES 103:4058–4065, 2014
4064
RESEARCH ARTICLE – Pharmacokinetics, Pharmacodynamics and Drug Transport and Metabolism
inflammation. More findings on the alterations in EBP50 and kinase in inflammation are needed to clarify the regulation mechanism of ERM proteins. The intrahepatic GSH depletion causes Mrp2 internalization.25 We showed that the hepatic GSH levels were significantly decreased in AA 7 d and AA 21 d (Fig. 5) and the membrane expression of Mrp2 in the liver was decreased both in AA 7 d and AA 21 d.16 These results suggested that the membrane expression of Mrp2 could decrease without change of interaction between radixin and Mrp2 in AA 7 d. Therefore, further studies are needed to clarify the changes in expression and activity of other factors such as EBP50 in AA rats. Compared with ERM proteins in liver, different roles for transporters are shown in other organs. For example, it has been reported on the roles of ERM proteins in intestinal transporters. Ezrin are involved in the post-translational regulation for Mrp2 and P-gp.31 The higher correlation between the expression levels of p-ezrin and Mrp2 was observed. Radixin is involved in post-translational regulation and activity of Pgp in small intestine. In radixin-deficient mice, the little regional differences in expression levels of P-gp were observed in small intestine.32 After etoposide treatment to mice, the phosphorylation of ERM proteins are regulated via activation of RhoA/ROCK in small intestine.33,34 For other ABC transporters, it has been reported that the knockdown of radixin in SGC-7901 cells affects the expression and activity of only Mrp2 among Mrp1-6 family members,35 suggesting that radixin is a selective modulator for the expression and function of ABC transporters.
CONCLUSIONS The inflammatory condition induces the decrease in functions of radixin rather than expression levels of radixin. The decreased functions of radixin could affect the interactions between radixin and ABC transporters. These findings provide the therapeutic information on biliary excretion-mediated ABC transporter in inflammation.
ACKNOWLEDGMENTS This work was supported by JSPS KAKENHI Grant Number 26860119 and the “Antiaging” Project for Private Universities, with a matching fund subsidy from Ministry of Education, Culture, Sports, Science, and Technology. We wish to thank Dr. Tomoko Sugiura in Pharmaceutical and Health Sciences, Kanazawa University, for useful advices.
REFERENCES 1. Sato N, Funayama N, Nagahuchi A, Yonemura S, Tsukita S, Tsukita S. 1992. A gene family consisting of ezrin, radixin and moesin. Its specific localization at actin filament/plasma membrane association sites. J Cell Sci 103:131–143. 2. Gary R, Bretscher A. 1995. Ezrin self-association involves binding of an N-terminal domain to a normally masked C-terminal domain that includes the F-actin binding site. Mol Biol Cell 6:1061– 1075. 3. Reczek D, Berryman M, Bretscher A. 1997. Identification of EBP50: A PDZ-containing phosphoprotein that associates with members of the ezrin–radixin–moesin family. J Cell Biol 139:169–179. Kawase et al., JOURNAL OF PHARMACEUTICAL SCIENCES 103:4058–4065, 2014
4. Suda J, Zhu L, Karvar S. 2011. Phosphorylation of radixin regulates cell polarity and Mrp-2 distribution in hepatocytes. Am J Physiol Cell Physiol 300:C416–C424. 5. Yonemura S, Matsui T, Tsukita S, Tsukita S. 2002. Rho-dependent and -independent activation mechanisms of ezrin/radixin/moesin proteins: An essential role for polyphosphoinositides in vivo. J Cell Sci 115:2569–2580. 6. Simons PC, Pietromonaco SF, Reczek D, Bretscher A, Elias L. 1998. C-terminal threonine phosphorylation activates ERM proteins to link the cell’s cortical lipid bilayer to the cytoskeleton. Biochem Biophys Res Commun 253:561–565. 7. Kikuchi S, Hata M, Fukumoto K, Yamane Y, Matsui T, Tamura A, Yonemura S, Yamagishi H, Keppler D, Tsukita S, Tsukita S. 2002. Radixin deficiency causes conjugated hyperbilirubinemia with loss of Mrp2 from bile canalicular membranes. Nat Genet 31:320–325. 8. Wang W, Soroka CJ, Mennone A, Rahnert C, Harry K, Pypaert M, Boyer JL. 2006. Radixin is required to maintain apical canalicular membrane structure and function in rat hepatocytes. Gastroenterology 131:878–884. 9. Kano T, Wada S, Morimoto K, Kato Y, Ogihara T. 2011. Effect of knockdown of ezrin, radixin, and moesin on P-glycoprotein function in HepG2 cells. J Pharm Sci 100:5308–5314. 10. Cressman AM, Petrovic V, Piquette-Miller M. 2012. Inflammationmediated changes in drug transporter expression/activity: Implications for therapeutic drug response. Expert Rev Clin Pharmacol 5:69–89. 11. Kawase A, Tsunokuni Y, Iwaki M. 2007. Effects of alterations in CAR on bilirubin detoxification in mouse collagen-induced arthritis. Drug Metab Dispos 35:256–261. 12. Kawase A, Ikuta H, Uno S, Yamamoto K, Akitsu N, Nagao T, Iwaki M. 2013. Alteration in plasma protein binding properties of propranolol and flurbiprofen during development of adjuvant-induced arthritis in rats. Xenobiotica 43:246–252. 13. Uno S, Kawase A, Tsuji A, Tanino T, Iwaki M. 2007. Decreased intestinal CYP3A and P-glycoprotein activities in rats with adjuvant arthritis. Drug Metab Pharmacokinet 22:313–321. 14. Uno S, Uraki M, Ito A, Shinozaki Y, Yamada A, Kawase A, Iwaki M. 2009. Changes in mRNA expression of ABC and SLC transporters in liver and intestines of the adjuvant-induced arthritis rat. Biopharm Drug Dispos 30:49–54. 15. Williams RC Jr. 1992. Rheumatoid factors: Historical perspective, origins and possible role in disease. J Rheumatol Suppl 32:42–45. 16. Kawase A, Norikane S, Okada A, Adachi M, Kato Y, Iwaki M. 2014. Distinct alterations in ABC transporter expression in liver, kidney, small intestine, and brain in adjuvant-induced arthritic rats. J Pharm Sci 103:2556–2564. 17. Cai X, Wong YF, Zhou H, Xie Y, Liu ZQ, Jiang ZH, Bian ZX, Xu HX, Liu L. 2006. The comparative study of Sprague–Dawley and Lewis rats in adjuvant-induced arthritis. Naunyn-Schmiedeberg’s Arch Pharmacol 373:140–147. 18. Kawase A, Fujii A, Negoro M, Akai R, Ishikubo M, Komura H, Iwaki M. 2008. Differences in cytochrome P450 and nuclear receptor mRNA levels in liver and small intestine between SD and DA rats. Drug Metab Pharmacokinet 23:196–206. 19. Sukhai M, Piquette-Miller M. 2000. Regulation of the multidrug resistance genes by stress signals. J Pharm Pharmac Sci 3:268–280. 20. Sukhai M, Yong A, Pak A, Piquette-Miller M. 2001. Decreased expression of P-glycoprotein in interleukin-1beta and interleukin-6 treated rat hepatocytes. Inflam Res 50:362–370. 21. Sekine S, Ito K, Saeki J, Horie T. 2011. Interaction of Mrp2 with radixin cause reversible canalicular Mrp2 localization induced by intracellular redox status. Biochim Biophys Acta 1812:1427–1434. 22. Ji B, Ito K, Sekine S, Tajima A, Horie T. 2004. Ethacrynicacid-induced glutathione depletion and oxidative stress in normal and Mrp2-deficient rat liver. Free Radic Biol Med 37:1718– 1729. 23. Schmitt M, Kubitz R, Wettstein M, vom Dahl S, Haussinger D. 2000. Retrieval of the mrp2 gene encoded conjugate export pump from the canalicular membrane contributes to cholestasis induced by DOI 10.1002/jps.24210
RESEARCH ARTICLE – Pharmacokinetics, Pharmacodynamics and Drug Transport and Metabolism
tert-butyl hydroperoxide and chloro-dinitrobenzene. Biol Chem 381:487–495. 24. Sekine S, Ito K, Horie T. 2008. Canalicular Mrp2 localization is reversibly regulated by the intracellular redox status. Am J Physiol Gastrointest Liver Physiol 295:G1035–G1041. 25. Sekine S, Mitsuki K, Ito K, Kugioka S, Horie T. 2012. Sustained intrahepatic glutathione depletion causes proteasomal degradation of multidrug resistance-associated protein 2 in rat liver. Biochim Biophys Acta 1822:980–987. 26. Saeki J, Sekine S, Horie T. 2011. LPS-induced dissociation of multidrug resistance-associated protein 2 (Mrp2) and radixin is associated with Mrp2 selective internalization in rats. Biochem Pharmacol 81:178–184. 27. Fouassier L, Duan CY, Feranchak AP, Yun CH, Sutherland E, Simon F, Fitz JG, Doctor RB. 2001. Ezrin-radixin-moesin-binding phosphoprotein 50 is expressed at the apical membrane of rat liver epithelia. Hepatology 33:166–176. 28. Matsui T, Maeda M, Doi Y, Yonemura S, Amano M, Kaibuchi K, Tsukita S. 1998. Rho-kinase phosphorylates COOH-terminal threonines of ezrin/radixin/moesin (ERM) proteins and regulates their head-to-tail association. J Cell Biol 140:647–657. 29. Pietromonaco SF, Simons PC, Altman A, Elias L. 1998. Protein kinase C-theta phosphorylation of moesin in the actin-binding sequence. J Biol Chem 273:7594–7603.
DOI 10.1002/jps.24210
4065
30. Ng T, Parsons M, Hughes WE, Monypenny J, Zicha D, Gautreau A, Arpin M, Gschmeissner S, Verveer PJ, Bastiaens PI, Parker PJ. 2001. Ezrin is a downstream effector of trafficking PKC-integrin complexes involved in the control of cell motility. EMBO J 20:2723– 2741. 31. Nakano T, Sekine S, Ito K, Horie T. 2013. Ezrin regulates the expression of Mrp2/Abcc2 and Mdr1/Abcb1 along the rat small intestinal tract. Am J Physiol Gastrointest Liver Physiol 305:G807– G817. 32. Yano K, Tomono T, Sakai R, Kano T, Morimoto K, Kato Y, Ogihara T. 2013. Contribution of radixin to P-glycoprotein expression and transport activity in mouse small intestine in vivo. J Pharm Sci 102:2875– 2881. 33. Kobori T, Harada S, Nakamoto K, Tokuyama S. 2013. Activation of ERM-family proteins via RhoA-ROCK signaling increases intestinal P-gp expression and leads to attenuation of oral morphine analgesia. J Pharm Sci 102:1095–1105. 34. Kobori T, Harada S, Nakamoto K, Tokuyama S. 2013. Timedependent changes in the activation of RhoA/ROCK and ERM/p-ERM in the increased expression of intestinal P-glycoprotein by repeated oral treatment with etoposide. J Pharm Sci 102:1670–1682. 35. He XJ, Wang WR, Zhang Y, Yang Q. 2012. The effect of radixin knockdown on the expression and efflux function of MRP2 in SGC-7901 cells. Eur J Pharm Sci 46:426–434.
Kawase et al., JOURNAL OF PHARMACEUTICAL SCIENCES 103:4058–4065, 2014
