Journal of the Neurological Sciences 348 (2015) 174–180
Contents lists available at ScienceDirect
Journal of the Neurological Sciences journal homepage: www.elsevier.com/locate/jns
Decreased expression of IL-27 and its correlation with Th1 and Th17 cells in progressive multiple sclerosis Shao-can Tang a,b,1, Xiao-hua Fan a,1, Qing-min Pan a,c, Qiang-san Sun d,⁎⁎, Yu Liu e,⁎ a
Department of Rehabilitation Medicine, Shandong Provincial Hospital Affiliated to Shandong University, 324 Jingwu Road, Jinan, PR China Department of Internal Neurology, Shandong Provincial Hospital Affiliated to Shandong University, 324 Jingwu Road, Jinan, PR China Department of Ophthalmology, Affiliated Hospital of Taishan Medical University, 706 Taishanda Street, Taian, Shandong, PR China d Department of Rehabilitation Medicine, Second Hospital of Shandong University, 247 Beiyuanda Street, Jinan, PR China e School of Chemistry and Pharmaceutical Engineering, Qilu University of Technology, 3501 Daxue Road, Jinan, PR China b c
a r t i c l e
i n f o
Article history: Received 19 August 2014 Received in revised form 14 November 2014 Accepted 25 November 2014 Available online 3 December 2014 Keywords: Progressive multiple sclerosis T helper 17 T helper 1 Interleukin-27 Cytokines CD4+ T cells
a b s t r a c t Progressive multiple sclerosis (MS) is an immune-mediated demyelinating disease in which both imbalanced T helper (Th) subsets and aberrant cytokine profiles have been found. Interleukin-27 (IL-27), a cytokine with proinflammatory and anti-inflammatory effects, plays pleiotropic roles in immunomodulation. In the present study, plasma levels of IL-27, interferon-gamma (IFN-γ), IL-17 and frequencies of peripheral Th1, Th17 cells were determined by enzyme-linked immunosorbent assay (ELISA) and flow cytometry in 45 progressive MS and 25 healthy controls. mRNA expression levels of IL-27, IFN-γ, T-bet, IL-17 and RAR-related orphan receptor gamma t (RORγt) in peripheral blood mononuclear cells (PBMCs) were also quantified by real-time polymerase chain reaction. Plasma and mRNA levels of IL-27 in progressive MS patients were significantly lower than those in healthy controls, while plasma concentrations of IL-17, frequencies of circulating Th17, and mRNA expression levels of IL-17 as well as RORγt were all increased remarkably compared with healthy controls. No statistical significance was observed in IFN-γ and T-bet mRNA expression or plasma IFN-γ levels between progressive MS patients and healthy controls. Moreover, plasma levels of IL-27 were found to be negatively correlated to the percentages of circulating Th17 or plasma IL-17 concentrations in patients with progressive MS. Our data showed that progressive MS patients had decreased plasma and mRNA expression levels of IL-27, suggesting that it might be involved in the pathophysiological process of MS. © 2014 Elsevier B.V. All rights reserved.
1. Introduction Multiple sclerosis (MS) is the principal inflammatory disease of the central nervous system (CNS) in which the immune system reacts with myelin peptides of CNS and mediates the destruction of CNS tissue, resulting in demyelination, axonal damage and subsequent neurological disability [1]. According to population-based studies, the incidence of MS ranges from 60 to 200 per 105 in Northern Europe and North America, and from 6 to 20 per 105 in low-risk areas such as Japan [2, 3]. MS is a heterogeneous disease clinically, pathologically and radiologically. The most common form of the disease is relapsing-remitting MS (RR-MS) that affects up to 85% of patients. A majority of RR-MS will go on to develop secondary progressive MS (SP-MS) characterized by worsening neurological disability with or without superimposed attacks. About 10% of patients exhibit primary progressive MS (PPMS), which involves continuous disease progression from onset without ⁎ Corresponding author. Tel.: +86 531 82169885; fax: +86 531 86907588. ⁎⁎ Corresponding author. E-mail addresses: [email protected] (Y. Liu), [email protected] (Q-s.Sun). 1 Shao-can Tang and Xiao-hua Fan contribute equally to this work.
http://dx.doi.org/10.1016/j.jns.2014.11.035 0022-510X/© 2014 Elsevier B.V. All rights reserved.
relapse or remission. The pathophysiology of MS is heterogeneous and complex. It has been well known that autoreactive T cells against myelin antigens play important roles in the progression of MS. It was initially suggested that T helper (Th) 1 cells were responsible for the pathogenesis of MS [4]. More recently, a new subset of Th cells that secrete IL-17, termed Th17 cells [5], have been shown to be associated with the pathogenesis of several inflammatory diseases, including experimental autoimmune encephalomyelitis (EAE) [4, 6], psoriasis [7], rheumatoid arthritis [8] and RR-MS [9]. The precise roles of Th1 and Th17 cells in autoimmunity still remain to be clarified. Interleukin-27 (IL-27), a member of IL-12 family, is a heterodimeric cytokine composed of Epstein–Barr virus-induced gene protein 3 (EBI3) and p28 subunits [10] and is mainly produced by activated antigenpresenting cells (APCs) [11]. By signaling through a receptor complex consisting of the unique IL-27 receptor (IL-27R, also known as WSX-1 and TCCR) and gp130 subunit, IL-27 can promote Th1 differentiation from naïve T cells in a signal transducer and activator of transcription 1 (STAT1)-dependent manner, inducing the production of interferon γ (IFN-γ) [12, 13]. More recent studies revealed that IL-27 might play a regulatory role by expanding the inducible regulatory T cells to produce IL-10 [14]. IL-27 also suppresses inflammation via inhibiting the
S. Tang et al. / Journal of the Neurological Sciences 348 (2015) 174–180 Table 1 Main features of the patients with progressive MS and healthy controls. Patients Variable No. Females/males Age (years)⁎ Disease duration EDSS
Progressive MS
Normal controls
Secondary
Primary
29 16/13 34 (18, 62) 15 (12, 22) 6 (5, 7)
16 9/7 36 (25, 63) 7 (4, 9) 5 (4, 6)
25 14/11 32 (19, 63) -
⁎ Median and range.
differentiation and function of Th17 cells [15, 16]. By secreting a group of pro-inflammatory cytokines, particular IL-17 and IL-21, Th17 cells are implicated in a variety of autoimmune diseases [17, 18]. A series of studies have carried out to investigate the pathophysiological significance of IL-27 in Th1/Th17-mediated inflammatory disorders, such as system lupus erythematosus (SLE) [19], rheumatoid arthritis (RA)[20, 21] and primary immune thrombocytopenia (ITP) [22], most of which suggested a protective role of IL-27 in autoimmunity. Although MS is speculated to be a T-cell-mediated autoimmune disease directed against myelin proteins, the cause of the disease is not well illuminated. Up to date, the roles of IL-27 and its relation with Th1 and Th17 cells in MS remain unsettled. In the present study, plasma levels of IL-27, IFN-γ and IL-17 in progressive MS were measured by enzyme-linked immunosorbent assays (ELISA). mRNA expression of IL-27, T-bet, RORγt, IL-17 and frequencies of Th1, Th17 were also determined by real-time polymerase chain reaction (PCR) analysis and flow cytometry (FCM), respectively. All of these might provide reference data for further investigation of IL-27 in the development of progressive MS. 2. Materials and methods 2.1. Patients and controls A total of forty-five adult patients with progressive MS (25 females and 20 males, age range 18–63 years, median 35 years) were enrolled in this study. Enrollment took place between March 2012 and July 2014 at the Department of neurology, Shandong Provincial Hospital, Shandong University, Jinan, China. Progressive MS patients were diagnosed according to revised MacDonald criteria including patients' history, clinical signs and symptoms, physical examination and adjunctive diagnostic tools such as magnetic resonance imaging (MRI). Among them, there were 29 patients with SP-MS (16 females and 13 males, age range 18–62 years, median 34 years), and 16 patients with PP-MS (9 females and 7 males, age range 25–64 years, median 36 years). All patients were free from immunosuppressive therapy for at least 2 weeks before blood sampling and had expanded disability status scale (EDSS) score assigned by a neurologist. Twenty-five healthy control subjects (14 females and 11 males, median 32 years, range 19–63 years) without any history of autoimmune disease were included. Clinical details of the MS patients and healthy controls were shown in Table 1.
175
This study was approved by the Medical Ethical Committee of Shandong Provincial Hospital, Shandong University. Informed consent was obtained from all patients before enrollment in the study in accordance with the Declaration of Helsinki. 2.2. Plasma and peripheral blood mononuclear cells (PMBCs) preparation Peripheral blood was collected into heparin-anticoagulant vacutainer tubes. Plasma was obtained from all subjects by centrifugation and stored at −80 °C for determination of cytokines. PBMCs were isolated from heparinized blood by gradient centrifugation using 1.077 g/ml Ficoll-Paque (Pharmacia Diagnostic, Uppsala, Sweden). The isolated PBMCs were stored at −80 °C for RNA isolation. 2.3. ELISA for plasma IL-27, IFN-γ and IL-17 Plasma IL-27, IFN-γ and IL-17 from MS patients and healthy controls were determined using commercial ELISA kits (eBioscience) according to the manufacturer's instructions. The detection limit or these three cytokines was 9.5 pg/ml, 3.2 pg/ml and 0.5 pg/ml, respectively. 2.4. Flow cytometric analysis Peripheral blood was collected and cultured under stimulation conditions before flow cytometric analysis. Briefly, heparinized peripheral whole blood (400 μL) in an equal volume of Roswell Park Memorial Institute (RPMI) 1640 medium was incubated for 4 h at 37 °C with 5% CO2 in the presence of 25 ng/mL of phorbol myristate acetate (PMA), 1 μg/ml of ionomycin and 1.7 μg/mL of Golgiplug (Monensin; all from Alexis Biochemicals, San Diego, CA). PMA and ionomycin are pharmacological T-cell-activating agents that mimic signals generated by the Tcell receptor (TCR) complex and have the advantage of stimulating T cells of any antigen specificity. Monensin was used to block intracellular transport mechanisms, thereby leading to an accumulation of cytokines in the cells. After incubation, cells were stained with PE-Cy5-conjugated anti-CD4 monoclonal antibodies at room temperature in the dark for 20 min. After staining, cells were fixed and permeabilized and then stained with fluorescein isothiocyanate (FITC)-conjugated anti-IFN-γ monoclonal antibodies and PE-conjugated anti-IL-17 monoclonal antibodies. All the antibodies were from eBioscience (San Diego, CA). Isotype controls were included to enable correct compensation and confirm antibody specificity. Stained cells were analyzed by flow cytometric analysis using a FACScan cytometer equipped with CellQuest software (BD Bioscience PharMingen). Th1, Th17 cells were defined as CD4+ IFN-γ+ and CD4+ IL-17+ IFN-γ- T cells, respectively. 2.5. RNA isolation and quantitative real-time RT-PCR TRIzol reagent (Invitrogen) was used to isolate total RNA of PBMCs. RNA was converted into cDNA using the PrimeScript RT reagent kit (Perfect Real Time; Takara) according to the manufacturer's instructions. Multiplex real-time RT-PCR was performed for mRNA expression of IL-27, IFN-γ, T-bet, IL-17, RORγt and GAPDH (endogenous control) on a PRISM_7500 Sequence Detection System (Applied Bio-system, Foster
Table 2 Primers and conditions for real-time quantitative PCR. Gene
IL27 IFN-γ T-bet IL-17 RORγt GAPDH
Annealing temperature
Product length
Forward
Primer sequence (5′3′) Reverse
(°C)
(bp)
CTTGGCTGGCGTCTCAGCCT TTGGCTTAATTCTCTCGGAAACG CATTGCCGTGACTGCCTACC GGAATCTCCACCGCAATGAG CTCAAAGCAGGAGCAATGGAA GCACCGTCAAGGCTGAGAAC
CGGAGAGCAGCTTCCTGGCG CGCTACATCTGAATGACCTGC GATGCTGGTGTCAACAGATGTG ACACCAGTATCTTCTCCAGGC AGGGAGTGGGAGAAGTCAAAGA TGGTGAAGACGCCAGTGGA
65 62 62 65 62 65/62
157 120 121 202 164 238
176
S. Tang et al. / Journal of the Neurological Sciences 348 (2015) 174–180
Fig. 1. Plasma levels of IL-27, IFN-γ and IL-17 in progressive MS patients and healthy controls. Plasma IL-27, IFN-γ and IL-17 levels were detected by ELISA assay. (A) Levels of IL-27 in progressive MS (P-MS) patients were significantly decreased compared with healthy controls. (B) No significant difference in plasma IFN-γ levels was found between P-MS patients and healthy controls. (C) Remarkably higher IL-17 levels were shown in P-MS patients compared with healthy controls. (D) Levels of IL-27 in SP-MS or PP-MS were significantly lower than that in healthy controls, while there was no statistical difference in levels of IL-27 between SP-MS and PP-MS. (E) No statistical difference was observed in IFN-γ levels among patients with SP-MS, PP-MS and healthy controls. (F) Levels of IL-17 in SP-MS or PP-MS were significantly higher than that in healthy controls, while there was no significant difference in levels of IL-17 between SP-MS and PP-MS. *P b 0.05, #P b 0.001.
City, CA, USA). The primers for all mRNA assays were intron spanning. The sequences of the amplification primers and amplifying conditions were listed in Table 2. Fluorescence was acquired at extension 72 °C. ABI Sequence Detection System software version 1.0 (PE Applied Biosystems, Warrington, UK) was used to determine the cycle number at which fluorescence emission crossed the automatically determined Ct value. Comparative Ct method (using arithmetic formulae) was used for relative quantification of target mRNA according to relative expression
software tool (REST©) [23]. The amplification efficiency between the target and the reference control (GAPDH) was compared in order to use the delta delta Ct (△△Ct) calculation. 2.6. Statistical analysis Data were expressed as mean ± SD. Statistical significance between MS patients and healthy controls was determined by independent sample t-test. While difference among cases with SP-MS, PP-MS and healthy controls was determined by one-way analysis of variance (ANOVA), and the difference between two groups was then determined by Student–Newman–Keuls test. The data of quantitative real-time PCR were analyzed using REST® software. Pearson correlation was used for correlation analysis unless the data were not normally distributed, in which case Spearman correlation analysis was conducted. All tests were performed by SPSS 17.0. P value b 0.05 was considered statistically significant. 3. Results 3.1. Plasma concentrations of IL-27, IFN-γ and IL17 in progressive MS patients and healthy controls
Fig. 2. Correlation between plasma levels of IL-27 and IL-17 in MS patients. There was a negative correlation between plasma levels of IL-27 and IL-17 in progressive MS patients (r = −0.371, P = 0.012; Pearson correlation analysis).
In consistence with a previous report [24], plasma levels of IL-27 in progressive MS patients were significantly lower than that in healthy controls (119.16 ± 29.86 vs. 140.01 ± 15.23 pg/mL; P b 0.05; Fig. 1A), while no statistical difference was found in plasma levels of IFN-γ between progressive MS patients and healthy controls (43.05 ± 7.13 vs. 40.02 ± 5.72 pg/ml; P = 0.074; Fig. 1B). Significantly higher plasma IL-17 levels were found in progressive MS patients compared with healthy controls (33.68 ± 9.07 vs. 20.17 ± 4.97 pg/ml; P b 0.001;
S. Tang et al. / Journal of the Neurological Sciences 348 (2015) 174–180
177
Fig. 1C). However, no significant difference was found in plasma levels of IL-27, IFN-γ or IL-17 between SP-MS and PP-MS patients (IL-27: 117.5 ± 31.36 vs. 122.16 ± 27.66 pg/ml, P = 0.564; IFN-γ: 42.99 ± 7.18 vs. 43.13 ± 7.26 pg/ml, P = 0.949; and IL-17: 34.39 ± 8.26 vs. 32.40 ± 10.56 pg/ml, P = 0.42, respectively).
0.012; Fig. 2), while no statistical correlation was found between plasma levels of IL-27 and IFN-γ (r = −0.07, P = 0.649).
3.2. The relationship between plasma levels of IL-27 and IFN-γ, IL-17 in progressive MS patients
Frequencies of Th1 cells and Th17 cells in peripheral blood of progressive MS patients and healthy controls were examined by flow cytometry. Representative dot plots of Th1 and Th17 cells were shown in Fig. 3. Percentages of circulating Th1 cells (CD4+ IFN-γ+) in progressive MS patients were slightly higher than that in healthy controls (11.54 ± 3.38 % vs. 10.06 ± 3.04 %), but this difference did not achieve statistical significance (P = 0.075; Fig. 3G). In consistence with plasma levels of IL-17, frequencies of peripheral blood Th17 cells in progressive MS patients were significantly increased compared with healthy controls (2.01 ± 0.58% vs. 1.33 ± 0.36%; P b 0.001; Fig. 3H).
It has been reported that IL-27 could enhance IFN-γ production in T cells, antagonize the effect of IL-4 in Th1 differentiating process and suppress the production of IL-17 in T cells [12, 13, 15]. Hence, correlation analysis was performed to evaluate if there was a latent relationship between plasma levels of IL-27 and IFN-γ or IL-17. Results showed that plasma levels of IL-27 were negatively correlated to concentrations of IL-17 in progressive MS patients (r = − 0.371, P =
3.3. Percentages of circulating Th1 cells and Th17 cells in progressive MS patients and healthy controls
Fig. 3. Flow cytometric analysis of Th1 and Th17 cells in peripheral blood of progressive MS patients and healthy controls. Peripheral blood from progressive MS patients and healthy controls were stimulated with PMA, ionomycin and monensin for 4 h and next stained with labeled antibodies as described in Methods. (A) Lymphocytes were gated in R1 by forward and side scatter. (B) CD4+ lymphocytes were gated in R2. (C, D) Representative dot plots of Th1 cells in progressive MS patients and controls. (E, F) Representative dot plots of Th17 cells in progressive MS patients and controls. (G) Frequencies of circulating Th1 cells in progressive MS patients and healthy controls. No statistical difference was found. (H) Percentages of peripheral blood Th17 cells in progressive MS patients were significantly higher than that in healthy controls. (I) No statistical difference was observed in frequencies of peripheral Th1 cells among patients with SP-MS, PP-MS and healthy controls. (J) Percentages of Th17 cells in SP-MS or PP-MS were significantly higher than that in healthy controls, while there was no significant difference in frequencies of circulating Th17 cells between SP-MS and PP-MS. #P b 0.001.
178
S. Tang et al. / Journal of the Neurological Sciences 348 (2015) 174–180
Additionally, no statistical difference was found in circulating Th1 or Th17 cells between SP-MS and PP-MS patients (Th1: 11.70 ± 3.46% vs. 11.25 ± 3.32%, P = 0.662; Th17: 2.02 ± 0.56% vs. 1.99 ± 0.63, P = 0.82, respectively). 3.4. Correlation between plasma levels of IL-27 and frequencies of Th17, Th1 in progressive MS patients Correlation analysis was performed to assess the relationship between plasma IL-27 concentrations and circulating Th17, Th1 levels in progressive MS patients. The data indicated that plasma levels of IL27 were negatively correlated to circulating Th17 levels in progressive MS patients (r = − 0.301, P = 0.044; Fig. 4), whereas percentages of Th1 cells failed to show a correlation with IL-27 levels (r = − 0.164, P = 0.281). 3.5. mRNA expression levels of IL-27, IFN-γ, T-bet, IL-17 and RORγt in PBMCs of progressive MS patients and controls To further define the relationship between IL-27 and Th1, Th17 cells in progressive MS patients, mRNA expression levels of IL-27, IFN-γ, IL17 and the Th1-specific transcription factor T-bet as well as Th17specific transcription factor RORγt were determined by real-time RTPCR. Using the REST software, data were presented as fold changes in gene expression normalized to an endogenous reference gene and relative to healthy controls. As shown in Fig. 5, the relative amount IL-27 mRNA in progressive MS patients was 0.69-fold of that in healthy controls (P b 0.001). By contrast, mRNA levels of IFN-γ and T-bet showed no significant difference between progressive MS patients and healthy controls (P N 0.05). In line with plasma levels of IL-17, considerably elevated IL-17 and RORγt mRNA levels were also found in progressive MS patients compared with healthy controls (4.39-fold, P b 0.001; and 9.58-fold, P b 0.001, respectively). 4. Discussion Cytokine-mediated immunity plays an important role in the pathophysiological process of various autoimmune disorders. As a welldefined inflammatory and autoimmune disease, progressive MS has also been reported to have an aberrant cytokine profile. The Th1 cytokines, TNF-α, were higher in MS patients, and Th1 cells were originally thought to be the main pathogenic T cells in RR-MS and its animal model experimental autoimmune encephalomyelitis (EAE) [25, 26]. More recent studies have highlighted an important pathogenic role for Th17 cells and its effector cytokine IL-17 in the development of relapsing MS as well as EAE [9, 27–29]. IL-27, which belongs to the IL-12 cytokine family, plays pleiotropic roles in immunomodulation. Recent studies about IL-27 in human autoimmune diseases have yielded conflicting results, with either decreased levels in ITP [22], SLE [19, 30] or increased expression levels in RA[21] and psoriasis [31]. With regard to EAE, several groups reported consistently that IL-27 played a protective role in the inflammatory process of central nervous system (CNS) [15, 16, 32, 33]. We explored the role of IL-27 in progressive MS and found that MS patients had decreased plasma and mRNA expression levels. In the present study, plasma IFN-γ, IL-17 as well as Th1, Th17 were also determined. Our data indicated that plasma concentrations of IFN-γ and percentages of circulating Th1 in progressive MS were slightly higher than in healthy controls, but the difference did not reach statistical significance. Furthermore, we did not observe a difference in mRNA expression levels of IFN-γ and T-bet between progressive MS patients and healthy controls. Those results were in accordance with the renewed view that MS is not only a purely Th1-mediated disease [34]. It has been demonstrated that the Th1/Th2 ratio is not remarkably shifted in the T cells infiltrating sites of demyelination [35]. Moreover, no difference was found in the cytokine pattern of myelin basic protein
(MBP)-reactive T cells between patients with MS and healthy controls [36]. Previous studies suggested that IL-27 exerted bilaterally biological effects on Th1 cells. It could not only promote Th1 differentiation and IFN-γ secretion in naïve CD4+ T cells but also restrict the strength and duration of Th1 responses in Th1 highly polarized conditions [37]. The present study did not observe a correlation between plasma levels of IL-27 and Th1 or IFN-γ. A growing body of emerging evidence has confirmed the pathogenetic role of Th17 in MS development. It was observed several years ago that IL-17 mRNA was augmented in the blood and CSF of relapsing MS patients, with higher IL-17 transcript levels in peripheral blood than CSF [38]. Microarray analysis conducted by Lock et al. [27] revealed that IL-17 transcript was upregulated in MS lesion of EAE. Ishizu and colleagues [28] also observed that concentrations of IL-17 were significantly higher in opticospinal MS than healthy subjects. Furthermore, IL-17 production in CNS-infiltrating T cells was shown to be associated with blood-brain barrier destruction and disease activity [39, 40]. However, whether Th17 is relevant during progressive stage of MS still remains controversial. Frisullo et al. [41] did not observe a statistical difference in plasma levels of IL-17 between SP-MS and health controls. Tcell-targeted therapy was also shown to be less effective in patients who had entered the later progressive stages [42]. Moreover, gadolinium enhancing activity diminished over time and did not correlate with neurologic deficits in progressive MS, providing an indirect clue that inflammation was not the predominant pathophysiological mechanism in progressive MS [43]. Despite that, it is inappropriate to completely rule out the pathogenic roles of Th17 cells in progressive MS. Romme and colleagues [44] reported that patients with progressive MS had increased frequencies of Th17 cells and activated follicular T helper (TFH) cells in peripheral blood, and IL-23R+ Th17 cells were elevated both in PP-MS and SP-MS. mRNA expression of IL-21, IL-21R and ICOS from peripheral CD4+ T cells were all upregulated in progressive MS. A more recently study showed that intracranial injection of cerebrospinal fluid (CSF) from progressive MS patients could lead to significantly elevated Th17 cell activity in the CNS and peripheral lymph nodes in mice [45]. Consistent with these previous findings, our data showed that percentages of circulating Th17 and plasma IL-17 levels in progressive MS patients were significantly higher than in healthy controls, and mRNA expression levels of IL-17 and its lineage-specific transcription factor RORγt were also elevated considerably. Aside from that, plasma levels of IL-27 were found to be negatively correlated to the frequencies of circulating Th17 or plasma IL-17 concentrations in
Fig. 4. Correlation between plasma levels of IL-27 and frequencies of circulating Th17 in progressive MS patients. A negative correlation was found between plasma IL-27 levels and percentages of peripheral blood Th17 cells in progressive MS patients (r = −0.301, P = 0.044; Pearson correlation analysis).
S. Tang et al. / Journal of the Neurological Sciences 348 (2015) 174–180
Fig. 5. Relative mRNA expression levels of IL-27, IFN-γ, T-bet, IL-17 and RORγt in PBMCs of progressive MS patients and health controls. IL-27 mRNA expression levels were significantly lower in progressive MS patients than healthy controls, while mRNA expression levels of IL-17 and RORγt were statistically higher in progressive MS patients compared with healthy controls. No significant difference in mRNA levels of IFN-γ or Tbet was found between progressive MS patients and healthy controls. #P b 0.001.
patients with progressive MS, providing further evidence about the anti-inflammatory role of IL-27 in MS. Our present study suggested that abnormal cellular immunity occurred in patients with progressive MS. Both the disturbed T cell ratio and the aberrant cytokine profile played important roles in the progression of MS. So far, there is still no special treatment modality for effective blocking the pathophysiological processes of MS [46–48], and signaling pathways mediated by aberrant cytokines might exacerbate the immune deviation and weaken the clinical efficacy of conventional treatment. As MS is a heterogeneous and complex autoimmune disorder, further investigations are required to illuminate the precise role of IL-27 in the development of MS. Taken together, our data showed that progressive MS had decreased plasma and mRNA expression levels of IL-27, and increased plasma and mRNA levels of IL-17 as well as circulating Th17 cells, suggesting their involvement in the pathophysiological process of the disease. Additionally, plasma IL-27 levels were negatively correlated to percentages of circulating Th17 cells and concentrations of plasma IL-17. Modulation of IL-27 might be a reasonable therapeutic strategy for progressive MS. Authorship Contribution: S.-c.T., X.-h.F., Q.-s.S. and Y. L. designed and performed research, analyzed data and wrote the paper; Q,-m.P. performed research. Conflict of interest disclosure The authors declare no competing financial interests. References [1] Kamm CP, Uitdehaag BM, Polman CH. Multiple sclerosis: current knowledge and future outlook. Eur Neurol 2014;72:132–41. [2] Tullman MJ. Overview of the epidemiology, diagnosis, and disease progression associated with multiple sclerosis. Am J Manag Care 2013;19:S15–20. [3] Jadidi-Niaragh F, Mirshafiey A. Th17 cell, the new player of neuroinflammatory process in multiple sclerosis. Scand J Immunol 2011;74:1–13. [4] Fletcher JM, Lalor SJ, Sweeney CM, Tubridy N, Mills KH. T cells in multiple sclerosis and experimental autoimmune encephalomyelitis. Clin Exp Immunol 2010;162:1–11. [5] Park H, Li Z, Yang XO, Chang SH, Nurieva R, Wang YH, et al. A distinct lineage of CD4 T cells regulates tissue inflammation by producing interleukin 17. Nat Immunol 2005;6:1133–41.
179
[6] Aranami T, Yamamura T. Th17 Cells and autoimmune encephalomyelitis (EAE/MS). Allergol Int: Off J Jpn Soc Allergol 2008;57:115–20. [7] Di Cesare A, Di Meglio P, Nestle FO. The IL-23/Th17 axis in the immunopathogenesis of psoriasis. J Invest Dermatol 2009;129:1339–50. [8] Leipe J, Grunke M, Dechant C, Reindl C, Kerzendorf U, Schulze-Koops H, et al. Role of Th17 cells in human autoimmune arthritis. Arthritis Rheum 2010;62:2876–85. [9] Lovett-Racke AE, Yang Y, Racke MK. Th1 versus Th17: are T cell cytokines relevant in multiple sclerosis? Biochim Biophys Acta 1812;2011:246–51. [10] Pflanz S, Timans JC, Cheung J, Rosales R, Kanzler H, Gilbert J, et al. IL-27, a heterodimeric cytokine composed of EBI3 and p28 protein, induces proliferation of naive CD4+ T cells. Immunity 2002;16:779–90. [11] Batten M, Ghilardi N. The biology and therapeutic potential of interleukin 27. J Mol Med (Berl) 2007;85:661–72. [12] Takeda A, Hamano S, Yamanaka A, Hanada T, Ishibashi T, Mak TW, et al. Cutting edge: role of IL-27/WSX-1 signaling for induction of T-bet through activation of STAT1 during initial Th1 commitment. J Immunol 2003;170:4886–90. [13] Owaki T, Asakawa M, Morishima N, Hata K, Fukai F, Matsui M, et al. A role for IL-27 in early regulation of Th1 differentiation. J Immunol 2005;175:2191–200. [14] Awasthi A, Carrier Y, Peron JP, Bettelli E, Kamanaka M, Flavell RA, et al. A dominant function for interleukin 27 in generating interleukin 10-producing antiinflammatory T cells. Nat Immunol 2007;8:1380–9. [15] Stumhofer JS, Laurence A, Wilson EH, Huang E, Tato CM, Johnson LM, et al. Interleukin 27 negatively regulates the development of interleukin 17-producing T helper cells during chronic inflammation of the central nervous system. Nat Immunol 2006;7:937–45. [16] Batten M, Li J, Yi S, Kljavin NM, Danilenko DM, Lucas S, et al. Interleukin 27 limits autoimmune encephalomyelitis by suppressing the development of interleukin 17-producing T cells. Nat Immunol 2006;7:929–36. [17] Langrish CL, Chen Y, Blumenschein WM, Mattson J, Basham B, Sedgwick JD, et al. IL23 drives a pathogenic T cell population that induces autoimmune inflammation. J Exp Med 2005;201:233–40. [18] Pernis AB. Th17 cells in rheumatoid arthritis and systemic lupus erythematosus. J Intern Med 2009;265:644–52. [19] Li TT, Zhang T, Chen GM, Zhu QQ, Tao JH, Pan HF, et al. Low level of serum interleukin 27 in patients with systemic lupus erythematosus. J Investig Med: Off Publ Am Fed Clin Res 2010;58:737–9. [20] Cao Y, Doodes PD, Glant TT, Finnegan A. IL-27 induces a Th1 immune response and susceptibility to experimental arthritis. J Immunol 2008;180:922–30. [21] Wong CK, Chen da P, Tam LS, Li EK, Yin YB, Lam CW. Effects of inflammatory cytokine IL-27 on the activation of fibroblast-like synoviocytes in rheumatoid arthritis. Arthritis Res Ther 2010;12:R129. [22] Liu XG, Ren J, Yu Y, Sun L, Shi Y, Qin P, et al. Decreased expression of interleukin-27 in immune thrombocytopenia. Br J Haematol 2011;153:259–67. [23] Pfaffl MW, Horgan GW, Dempfle L. Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res 2002;30:e36. [24] Babaloo Z, Yeganeh RK, Farhoodi M, Baradaran B, Bonyadi M, Aghebati L. Increased IL-17A but decreased IL-27 serum levels in patients with multiple sclerosis. Iran J Immunol 2013;10:47–54. [25] Panitch HS, Hirsch RL, Haley AS, Johnson KP. Exacerbations of multiple sclerosis in patients treated with gamma interferon. Lancet 1987;1:893–5. [26] Nylander A, Hafler DA. Multiple sclerosis. J Clin Invest 2012;122:1180–8. [27] Lock C, Hermans G, Pedotti R, Brendolan A, Schadt E, Garren H, et al. Genemicroarray analysis of multiple sclerosis lesions yields new targets validated in autoimmune encephalomyelitis. Nat Med 2002;8:500–8. [28] Ishizu T, Osoegawa M, Mei FJ, Kikuchi H, Tanaka M, Takakura Y, et al. Intrathecal activation of the IL-17/IL-8 axis in opticospinal multiple sclerosis. Brain: J Neurol 2005; 128:988–1002. [29] Kebir H, Ifergan I, Alvarez JI, Bernard M, Poirier J, Arbour N, et al. Preferential recruitment of interferon-gamma-expressing TH17 cells in multiple sclerosis. Ann Neurol 2009;66:390–402. [30] Duarte AL, Dantas AT, de Ataide Mariz H, dos Santos FA, da Silva JC, da Rocha Jr LF, et al. Decreased serum interleukin 27 in Brazilian systemic lupus erythematosus patients. Mol Biol Rep 2013;40:4889–92. [31] Shibata S, Tada Y, Kanda N, Nashiro K, Kamata M, Karakawa M, et al. Possible roles of IL-27 in the pathogenesis of psoriasis. J Invest Dermatol 2010;130:1034–9. [32] Fitzgerald DC, Ciric B, Touil T, Harle H, Grammatikopolou J, Das Sarma J, et al. Suppressive effect of IL-27 on encephalitogenic Th17 cells and the effector phase of experimental autoimmune encephalomyelitis. J Immunol 2007;179: 3268–75. [33] Fitzgerald DC, Zhang GX, El-Behi M, Fonseca-Kelly Z, Li H, Yu S, et al. Suppression of autoimmune inflammation of the central nervous system by interleukin 10 secreted by interleukin 27-stimulated T cells. Nat Immunol 2007;8:1372–9. [34] Grigoriadis N, Grigoriadis S, Polyzoidou E, Milonas I, Karussis D. Neuroinflammation in multiple sclerosis: evidence for autoimmune dysregulation, not simple autoimmune reaction. Clin Neurol Neurosurg 2006;108:241–4. [35] Cannella B, Raine CS. The adhesion molecule and cytokine profile of multiple sclerosis lesions. Ann Neurol 1995;37:424–35. [36] Windhagen A, Anderson DE, Carrizosa A, Balashov K, Weiner HL, Hafler DA. Cytokine secretion of myelin basic protein reactive T cells in patients with multiple sclerosis. J Neuroimmunol 1998;91:1–9. [37] Yoshimura T, Takeda A, Hamano S, Miyazaki Y, Kinjyo I, Ishibashi T, et al. Two-sided roles of IL-27: induction of Th1 differentiation on naive CD4+ T cells versus suppression of proinflammatory cytokine production including IL-23-induced IL17 on activated CD4+ T cells partially through STAT3-dependent mechanism. J Immunol 2006;177:5377–85.
180
S. Tang et al. / Journal of the Neurological Sciences 348 (2015) 174–180
[38] Matusevicius D, Kivisakk P, He B, Kostulas N, Ozenci V, Fredrikson S, et al. Interleukin-17 mRNA expression in blood and CSF mononuclear cells is augmented in multiple sclerosis. Mult Scler 1999;5:101–4. [39] Kebir H, Kreymborg K, Ifergan I, Dodelet-Devillers A, Cayrol R, Bernard M, et al. Human TH17 lymphocytes promote blood-brain barrier disruption and central nervous system inflammation. Nat Med 2007;13:1173–5. [40] Murugaiyan G, Mittal A, Lopez-Diego R, Maier LM, Anderson DE, Weiner HL. IL-27 is a key regulator of IL-10 and IL-17 production by human CD4+ T cells. J Immunol 2009;183:2435–43. [41] Frisullo G, Nociti V, Iorio R, Patanella AK, Marti A, Caggiula M, et al. IL17 and IFNgamma production by peripheral blood mononuclear cells from clinically isolated syndrome to secondary progressive multiple sclerosis. Cytokine 2008;44:22–5. [42] Weiner HL, Cohen JA. Treatment of multiple sclerosis with cyclophosphamide: critical review of clinical and immunologic effects. Mult Scler 2002;8:142–54. [43] He J, Grossman RI, Ge Y, Mannon LJ. Enhancing patterns in multiple sclerosis: evolution and persistence. AJNR Am J Neuroradiol 2001;22:664–9.
[44] Romme Christensen J, Börnsen L, Ratzer R, Piehl F, Khademi M, Olsson T, et al. Systemic inflammation in progressive multiple sclerosis involves follicular T-helper, Th17- and activated B-cells and correlates with progression. PLoS One 2013;8: e57820. [45] Cristofanilli M, Rosenthal H, Cymring B, Gratch D, Pagano B, Xie B, et al. Progressive multiple sclerosis cerebrospinal fluid induces inflammatory demyelination, axonal loss, and astrogliosis in mice. Exp Neurol 2014;261:620–32. [46] Yamout B, Alroughani R, Al-Jumah M, Khoury S, Abouzeid N, Dahdaleh M, et al. Consensus guidelines for the diagnosis and treatment of multiple sclerosis. Curr Med Res Opin 2013;29:611–21. [47] Tanasescu R, Ionete C, Chou IJ, Constantinescu CS. Advances in the treatment of relapsing-remitting multiple sclerosis. Biomed J 2014;37:41–9. [48] Wingerchuk DM, Carter JL. Multiple sclerosis: current and emerging diseasemodifying therapies and treatment strategies. Mayo Clin Proc 2014;89:225–40.
Contents lists available at ScienceDirect
Journal of the Neurological Sciences journal homepage: www.elsevier.com/locate/jns
Decreased expression of IL-27 and its correlation with Th1 and Th17 cells in progressive multiple sclerosis Shao-can Tang a,b,1, Xiao-hua Fan a,1, Qing-min Pan a,c, Qiang-san Sun d,⁎⁎, Yu Liu e,⁎ a
Department of Rehabilitation Medicine, Shandong Provincial Hospital Affiliated to Shandong University, 324 Jingwu Road, Jinan, PR China Department of Internal Neurology, Shandong Provincial Hospital Affiliated to Shandong University, 324 Jingwu Road, Jinan, PR China Department of Ophthalmology, Affiliated Hospital of Taishan Medical University, 706 Taishanda Street, Taian, Shandong, PR China d Department of Rehabilitation Medicine, Second Hospital of Shandong University, 247 Beiyuanda Street, Jinan, PR China e School of Chemistry and Pharmaceutical Engineering, Qilu University of Technology, 3501 Daxue Road, Jinan, PR China b c
a r t i c l e
i n f o
Article history: Received 19 August 2014 Received in revised form 14 November 2014 Accepted 25 November 2014 Available online 3 December 2014 Keywords: Progressive multiple sclerosis T helper 17 T helper 1 Interleukin-27 Cytokines CD4+ T cells
a b s t r a c t Progressive multiple sclerosis (MS) is an immune-mediated demyelinating disease in which both imbalanced T helper (Th) subsets and aberrant cytokine profiles have been found. Interleukin-27 (IL-27), a cytokine with proinflammatory and anti-inflammatory effects, plays pleiotropic roles in immunomodulation. In the present study, plasma levels of IL-27, interferon-gamma (IFN-γ), IL-17 and frequencies of peripheral Th1, Th17 cells were determined by enzyme-linked immunosorbent assay (ELISA) and flow cytometry in 45 progressive MS and 25 healthy controls. mRNA expression levels of IL-27, IFN-γ, T-bet, IL-17 and RAR-related orphan receptor gamma t (RORγt) in peripheral blood mononuclear cells (PBMCs) were also quantified by real-time polymerase chain reaction. Plasma and mRNA levels of IL-27 in progressive MS patients were significantly lower than those in healthy controls, while plasma concentrations of IL-17, frequencies of circulating Th17, and mRNA expression levels of IL-17 as well as RORγt were all increased remarkably compared with healthy controls. No statistical significance was observed in IFN-γ and T-bet mRNA expression or plasma IFN-γ levels between progressive MS patients and healthy controls. Moreover, plasma levels of IL-27 were found to be negatively correlated to the percentages of circulating Th17 or plasma IL-17 concentrations in patients with progressive MS. Our data showed that progressive MS patients had decreased plasma and mRNA expression levels of IL-27, suggesting that it might be involved in the pathophysiological process of MS. © 2014 Elsevier B.V. All rights reserved.
1. Introduction Multiple sclerosis (MS) is the principal inflammatory disease of the central nervous system (CNS) in which the immune system reacts with myelin peptides of CNS and mediates the destruction of CNS tissue, resulting in demyelination, axonal damage and subsequent neurological disability [1]. According to population-based studies, the incidence of MS ranges from 60 to 200 per 105 in Northern Europe and North America, and from 6 to 20 per 105 in low-risk areas such as Japan [2, 3]. MS is a heterogeneous disease clinically, pathologically and radiologically. The most common form of the disease is relapsing-remitting MS (RR-MS) that affects up to 85% of patients. A majority of RR-MS will go on to develop secondary progressive MS (SP-MS) characterized by worsening neurological disability with or without superimposed attacks. About 10% of patients exhibit primary progressive MS (PPMS), which involves continuous disease progression from onset without ⁎ Corresponding author. Tel.: +86 531 82169885; fax: +86 531 86907588. ⁎⁎ Corresponding author. E-mail addresses: [email protected] (Y. Liu), [email protected] (Q-s.Sun). 1 Shao-can Tang and Xiao-hua Fan contribute equally to this work.
http://dx.doi.org/10.1016/j.jns.2014.11.035 0022-510X/© 2014 Elsevier B.V. All rights reserved.
relapse or remission. The pathophysiology of MS is heterogeneous and complex. It has been well known that autoreactive T cells against myelin antigens play important roles in the progression of MS. It was initially suggested that T helper (Th) 1 cells were responsible for the pathogenesis of MS [4]. More recently, a new subset of Th cells that secrete IL-17, termed Th17 cells [5], have been shown to be associated with the pathogenesis of several inflammatory diseases, including experimental autoimmune encephalomyelitis (EAE) [4, 6], psoriasis [7], rheumatoid arthritis [8] and RR-MS [9]. The precise roles of Th1 and Th17 cells in autoimmunity still remain to be clarified. Interleukin-27 (IL-27), a member of IL-12 family, is a heterodimeric cytokine composed of Epstein–Barr virus-induced gene protein 3 (EBI3) and p28 subunits [10] and is mainly produced by activated antigenpresenting cells (APCs) [11]. By signaling through a receptor complex consisting of the unique IL-27 receptor (IL-27R, also known as WSX-1 and TCCR) and gp130 subunit, IL-27 can promote Th1 differentiation from naïve T cells in a signal transducer and activator of transcription 1 (STAT1)-dependent manner, inducing the production of interferon γ (IFN-γ) [12, 13]. More recent studies revealed that IL-27 might play a regulatory role by expanding the inducible regulatory T cells to produce IL-10 [14]. IL-27 also suppresses inflammation via inhibiting the
S. Tang et al. / Journal of the Neurological Sciences 348 (2015) 174–180 Table 1 Main features of the patients with progressive MS and healthy controls. Patients Variable No. Females/males Age (years)⁎ Disease duration EDSS
Progressive MS
Normal controls
Secondary
Primary
29 16/13 34 (18, 62) 15 (12, 22) 6 (5, 7)
16 9/7 36 (25, 63) 7 (4, 9) 5 (4, 6)
25 14/11 32 (19, 63) -
⁎ Median and range.
differentiation and function of Th17 cells [15, 16]. By secreting a group of pro-inflammatory cytokines, particular IL-17 and IL-21, Th17 cells are implicated in a variety of autoimmune diseases [17, 18]. A series of studies have carried out to investigate the pathophysiological significance of IL-27 in Th1/Th17-mediated inflammatory disorders, such as system lupus erythematosus (SLE) [19], rheumatoid arthritis (RA)[20, 21] and primary immune thrombocytopenia (ITP) [22], most of which suggested a protective role of IL-27 in autoimmunity. Although MS is speculated to be a T-cell-mediated autoimmune disease directed against myelin proteins, the cause of the disease is not well illuminated. Up to date, the roles of IL-27 and its relation with Th1 and Th17 cells in MS remain unsettled. In the present study, plasma levels of IL-27, IFN-γ and IL-17 in progressive MS were measured by enzyme-linked immunosorbent assays (ELISA). mRNA expression of IL-27, T-bet, RORγt, IL-17 and frequencies of Th1, Th17 were also determined by real-time polymerase chain reaction (PCR) analysis and flow cytometry (FCM), respectively. All of these might provide reference data for further investigation of IL-27 in the development of progressive MS. 2. Materials and methods 2.1. Patients and controls A total of forty-five adult patients with progressive MS (25 females and 20 males, age range 18–63 years, median 35 years) were enrolled in this study. Enrollment took place between March 2012 and July 2014 at the Department of neurology, Shandong Provincial Hospital, Shandong University, Jinan, China. Progressive MS patients were diagnosed according to revised MacDonald criteria including patients' history, clinical signs and symptoms, physical examination and adjunctive diagnostic tools such as magnetic resonance imaging (MRI). Among them, there were 29 patients with SP-MS (16 females and 13 males, age range 18–62 years, median 34 years), and 16 patients with PP-MS (9 females and 7 males, age range 25–64 years, median 36 years). All patients were free from immunosuppressive therapy for at least 2 weeks before blood sampling and had expanded disability status scale (EDSS) score assigned by a neurologist. Twenty-five healthy control subjects (14 females and 11 males, median 32 years, range 19–63 years) without any history of autoimmune disease were included. Clinical details of the MS patients and healthy controls were shown in Table 1.
175
This study was approved by the Medical Ethical Committee of Shandong Provincial Hospital, Shandong University. Informed consent was obtained from all patients before enrollment in the study in accordance with the Declaration of Helsinki. 2.2. Plasma and peripheral blood mononuclear cells (PMBCs) preparation Peripheral blood was collected into heparin-anticoagulant vacutainer tubes. Plasma was obtained from all subjects by centrifugation and stored at −80 °C for determination of cytokines. PBMCs were isolated from heparinized blood by gradient centrifugation using 1.077 g/ml Ficoll-Paque (Pharmacia Diagnostic, Uppsala, Sweden). The isolated PBMCs were stored at −80 °C for RNA isolation. 2.3. ELISA for plasma IL-27, IFN-γ and IL-17 Plasma IL-27, IFN-γ and IL-17 from MS patients and healthy controls were determined using commercial ELISA kits (eBioscience) according to the manufacturer's instructions. The detection limit or these three cytokines was 9.5 pg/ml, 3.2 pg/ml and 0.5 pg/ml, respectively. 2.4. Flow cytometric analysis Peripheral blood was collected and cultured under stimulation conditions before flow cytometric analysis. Briefly, heparinized peripheral whole blood (400 μL) in an equal volume of Roswell Park Memorial Institute (RPMI) 1640 medium was incubated for 4 h at 37 °C with 5% CO2 in the presence of 25 ng/mL of phorbol myristate acetate (PMA), 1 μg/ml of ionomycin and 1.7 μg/mL of Golgiplug (Monensin; all from Alexis Biochemicals, San Diego, CA). PMA and ionomycin are pharmacological T-cell-activating agents that mimic signals generated by the Tcell receptor (TCR) complex and have the advantage of stimulating T cells of any antigen specificity. Monensin was used to block intracellular transport mechanisms, thereby leading to an accumulation of cytokines in the cells. After incubation, cells were stained with PE-Cy5-conjugated anti-CD4 monoclonal antibodies at room temperature in the dark for 20 min. After staining, cells were fixed and permeabilized and then stained with fluorescein isothiocyanate (FITC)-conjugated anti-IFN-γ monoclonal antibodies and PE-conjugated anti-IL-17 monoclonal antibodies. All the antibodies were from eBioscience (San Diego, CA). Isotype controls were included to enable correct compensation and confirm antibody specificity. Stained cells were analyzed by flow cytometric analysis using a FACScan cytometer equipped with CellQuest software (BD Bioscience PharMingen). Th1, Th17 cells were defined as CD4+ IFN-γ+ and CD4+ IL-17+ IFN-γ- T cells, respectively. 2.5. RNA isolation and quantitative real-time RT-PCR TRIzol reagent (Invitrogen) was used to isolate total RNA of PBMCs. RNA was converted into cDNA using the PrimeScript RT reagent kit (Perfect Real Time; Takara) according to the manufacturer's instructions. Multiplex real-time RT-PCR was performed for mRNA expression of IL-27, IFN-γ, T-bet, IL-17, RORγt and GAPDH (endogenous control) on a PRISM_7500 Sequence Detection System (Applied Bio-system, Foster
Table 2 Primers and conditions for real-time quantitative PCR. Gene
IL27 IFN-γ T-bet IL-17 RORγt GAPDH
Annealing temperature
Product length
Forward
Primer sequence (5′3′) Reverse
(°C)
(bp)
CTTGGCTGGCGTCTCAGCCT TTGGCTTAATTCTCTCGGAAACG CATTGCCGTGACTGCCTACC GGAATCTCCACCGCAATGAG CTCAAAGCAGGAGCAATGGAA GCACCGTCAAGGCTGAGAAC
CGGAGAGCAGCTTCCTGGCG CGCTACATCTGAATGACCTGC GATGCTGGTGTCAACAGATGTG ACACCAGTATCTTCTCCAGGC AGGGAGTGGGAGAAGTCAAAGA TGGTGAAGACGCCAGTGGA
65 62 62 65 62 65/62
157 120 121 202 164 238
176
S. Tang et al. / Journal of the Neurological Sciences 348 (2015) 174–180
Fig. 1. Plasma levels of IL-27, IFN-γ and IL-17 in progressive MS patients and healthy controls. Plasma IL-27, IFN-γ and IL-17 levels were detected by ELISA assay. (A) Levels of IL-27 in progressive MS (P-MS) patients were significantly decreased compared with healthy controls. (B) No significant difference in plasma IFN-γ levels was found between P-MS patients and healthy controls. (C) Remarkably higher IL-17 levels were shown in P-MS patients compared with healthy controls. (D) Levels of IL-27 in SP-MS or PP-MS were significantly lower than that in healthy controls, while there was no statistical difference in levels of IL-27 between SP-MS and PP-MS. (E) No statistical difference was observed in IFN-γ levels among patients with SP-MS, PP-MS and healthy controls. (F) Levels of IL-17 in SP-MS or PP-MS were significantly higher than that in healthy controls, while there was no significant difference in levels of IL-17 between SP-MS and PP-MS. *P b 0.05, #P b 0.001.
City, CA, USA). The primers for all mRNA assays were intron spanning. The sequences of the amplification primers and amplifying conditions were listed in Table 2. Fluorescence was acquired at extension 72 °C. ABI Sequence Detection System software version 1.0 (PE Applied Biosystems, Warrington, UK) was used to determine the cycle number at which fluorescence emission crossed the automatically determined Ct value. Comparative Ct method (using arithmetic formulae) was used for relative quantification of target mRNA according to relative expression
software tool (REST©) [23]. The amplification efficiency between the target and the reference control (GAPDH) was compared in order to use the delta delta Ct (△△Ct) calculation. 2.6. Statistical analysis Data were expressed as mean ± SD. Statistical significance between MS patients and healthy controls was determined by independent sample t-test. While difference among cases with SP-MS, PP-MS and healthy controls was determined by one-way analysis of variance (ANOVA), and the difference between two groups was then determined by Student–Newman–Keuls test. The data of quantitative real-time PCR were analyzed using REST® software. Pearson correlation was used for correlation analysis unless the data were not normally distributed, in which case Spearman correlation analysis was conducted. All tests were performed by SPSS 17.0. P value b 0.05 was considered statistically significant. 3. Results 3.1. Plasma concentrations of IL-27, IFN-γ and IL17 in progressive MS patients and healthy controls
Fig. 2. Correlation between plasma levels of IL-27 and IL-17 in MS patients. There was a negative correlation between plasma levels of IL-27 and IL-17 in progressive MS patients (r = −0.371, P = 0.012; Pearson correlation analysis).
In consistence with a previous report [24], plasma levels of IL-27 in progressive MS patients were significantly lower than that in healthy controls (119.16 ± 29.86 vs. 140.01 ± 15.23 pg/mL; P b 0.05; Fig. 1A), while no statistical difference was found in plasma levels of IFN-γ between progressive MS patients and healthy controls (43.05 ± 7.13 vs. 40.02 ± 5.72 pg/ml; P = 0.074; Fig. 1B). Significantly higher plasma IL-17 levels were found in progressive MS patients compared with healthy controls (33.68 ± 9.07 vs. 20.17 ± 4.97 pg/ml; P b 0.001;
S. Tang et al. / Journal of the Neurological Sciences 348 (2015) 174–180
177
Fig. 1C). However, no significant difference was found in plasma levels of IL-27, IFN-γ or IL-17 between SP-MS and PP-MS patients (IL-27: 117.5 ± 31.36 vs. 122.16 ± 27.66 pg/ml, P = 0.564; IFN-γ: 42.99 ± 7.18 vs. 43.13 ± 7.26 pg/ml, P = 0.949; and IL-17: 34.39 ± 8.26 vs. 32.40 ± 10.56 pg/ml, P = 0.42, respectively).
0.012; Fig. 2), while no statistical correlation was found between plasma levels of IL-27 and IFN-γ (r = −0.07, P = 0.649).
3.2. The relationship between plasma levels of IL-27 and IFN-γ, IL-17 in progressive MS patients
Frequencies of Th1 cells and Th17 cells in peripheral blood of progressive MS patients and healthy controls were examined by flow cytometry. Representative dot plots of Th1 and Th17 cells were shown in Fig. 3. Percentages of circulating Th1 cells (CD4+ IFN-γ+) in progressive MS patients were slightly higher than that in healthy controls (11.54 ± 3.38 % vs. 10.06 ± 3.04 %), but this difference did not achieve statistical significance (P = 0.075; Fig. 3G). In consistence with plasma levels of IL-17, frequencies of peripheral blood Th17 cells in progressive MS patients were significantly increased compared with healthy controls (2.01 ± 0.58% vs. 1.33 ± 0.36%; P b 0.001; Fig. 3H).
It has been reported that IL-27 could enhance IFN-γ production in T cells, antagonize the effect of IL-4 in Th1 differentiating process and suppress the production of IL-17 in T cells [12, 13, 15]. Hence, correlation analysis was performed to evaluate if there was a latent relationship between plasma levels of IL-27 and IFN-γ or IL-17. Results showed that plasma levels of IL-27 were negatively correlated to concentrations of IL-17 in progressive MS patients (r = − 0.371, P =
3.3. Percentages of circulating Th1 cells and Th17 cells in progressive MS patients and healthy controls
Fig. 3. Flow cytometric analysis of Th1 and Th17 cells in peripheral blood of progressive MS patients and healthy controls. Peripheral blood from progressive MS patients and healthy controls were stimulated with PMA, ionomycin and monensin for 4 h and next stained with labeled antibodies as described in Methods. (A) Lymphocytes were gated in R1 by forward and side scatter. (B) CD4+ lymphocytes were gated in R2. (C, D) Representative dot plots of Th1 cells in progressive MS patients and controls. (E, F) Representative dot plots of Th17 cells in progressive MS patients and controls. (G) Frequencies of circulating Th1 cells in progressive MS patients and healthy controls. No statistical difference was found. (H) Percentages of peripheral blood Th17 cells in progressive MS patients were significantly higher than that in healthy controls. (I) No statistical difference was observed in frequencies of peripheral Th1 cells among patients with SP-MS, PP-MS and healthy controls. (J) Percentages of Th17 cells in SP-MS or PP-MS were significantly higher than that in healthy controls, while there was no significant difference in frequencies of circulating Th17 cells between SP-MS and PP-MS. #P b 0.001.
178
S. Tang et al. / Journal of the Neurological Sciences 348 (2015) 174–180
Additionally, no statistical difference was found in circulating Th1 or Th17 cells between SP-MS and PP-MS patients (Th1: 11.70 ± 3.46% vs. 11.25 ± 3.32%, P = 0.662; Th17: 2.02 ± 0.56% vs. 1.99 ± 0.63, P = 0.82, respectively). 3.4. Correlation between plasma levels of IL-27 and frequencies of Th17, Th1 in progressive MS patients Correlation analysis was performed to assess the relationship between plasma IL-27 concentrations and circulating Th17, Th1 levels in progressive MS patients. The data indicated that plasma levels of IL27 were negatively correlated to circulating Th17 levels in progressive MS patients (r = − 0.301, P = 0.044; Fig. 4), whereas percentages of Th1 cells failed to show a correlation with IL-27 levels (r = − 0.164, P = 0.281). 3.5. mRNA expression levels of IL-27, IFN-γ, T-bet, IL-17 and RORγt in PBMCs of progressive MS patients and controls To further define the relationship between IL-27 and Th1, Th17 cells in progressive MS patients, mRNA expression levels of IL-27, IFN-γ, IL17 and the Th1-specific transcription factor T-bet as well as Th17specific transcription factor RORγt were determined by real-time RTPCR. Using the REST software, data were presented as fold changes in gene expression normalized to an endogenous reference gene and relative to healthy controls. As shown in Fig. 5, the relative amount IL-27 mRNA in progressive MS patients was 0.69-fold of that in healthy controls (P b 0.001). By contrast, mRNA levels of IFN-γ and T-bet showed no significant difference between progressive MS patients and healthy controls (P N 0.05). In line with plasma levels of IL-17, considerably elevated IL-17 and RORγt mRNA levels were also found in progressive MS patients compared with healthy controls (4.39-fold, P b 0.001; and 9.58-fold, P b 0.001, respectively). 4. Discussion Cytokine-mediated immunity plays an important role in the pathophysiological process of various autoimmune disorders. As a welldefined inflammatory and autoimmune disease, progressive MS has also been reported to have an aberrant cytokine profile. The Th1 cytokines, TNF-α, were higher in MS patients, and Th1 cells were originally thought to be the main pathogenic T cells in RR-MS and its animal model experimental autoimmune encephalomyelitis (EAE) [25, 26]. More recent studies have highlighted an important pathogenic role for Th17 cells and its effector cytokine IL-17 in the development of relapsing MS as well as EAE [9, 27–29]. IL-27, which belongs to the IL-12 cytokine family, plays pleiotropic roles in immunomodulation. Recent studies about IL-27 in human autoimmune diseases have yielded conflicting results, with either decreased levels in ITP [22], SLE [19, 30] or increased expression levels in RA[21] and psoriasis [31]. With regard to EAE, several groups reported consistently that IL-27 played a protective role in the inflammatory process of central nervous system (CNS) [15, 16, 32, 33]. We explored the role of IL-27 in progressive MS and found that MS patients had decreased plasma and mRNA expression levels. In the present study, plasma IFN-γ, IL-17 as well as Th1, Th17 were also determined. Our data indicated that plasma concentrations of IFN-γ and percentages of circulating Th1 in progressive MS were slightly higher than in healthy controls, but the difference did not reach statistical significance. Furthermore, we did not observe a difference in mRNA expression levels of IFN-γ and T-bet between progressive MS patients and healthy controls. Those results were in accordance with the renewed view that MS is not only a purely Th1-mediated disease [34]. It has been demonstrated that the Th1/Th2 ratio is not remarkably shifted in the T cells infiltrating sites of demyelination [35]. Moreover, no difference was found in the cytokine pattern of myelin basic protein
(MBP)-reactive T cells between patients with MS and healthy controls [36]. Previous studies suggested that IL-27 exerted bilaterally biological effects on Th1 cells. It could not only promote Th1 differentiation and IFN-γ secretion in naïve CD4+ T cells but also restrict the strength and duration of Th1 responses in Th1 highly polarized conditions [37]. The present study did not observe a correlation between plasma levels of IL-27 and Th1 or IFN-γ. A growing body of emerging evidence has confirmed the pathogenetic role of Th17 in MS development. It was observed several years ago that IL-17 mRNA was augmented in the blood and CSF of relapsing MS patients, with higher IL-17 transcript levels in peripheral blood than CSF [38]. Microarray analysis conducted by Lock et al. [27] revealed that IL-17 transcript was upregulated in MS lesion of EAE. Ishizu and colleagues [28] also observed that concentrations of IL-17 were significantly higher in opticospinal MS than healthy subjects. Furthermore, IL-17 production in CNS-infiltrating T cells was shown to be associated with blood-brain barrier destruction and disease activity [39, 40]. However, whether Th17 is relevant during progressive stage of MS still remains controversial. Frisullo et al. [41] did not observe a statistical difference in plasma levels of IL-17 between SP-MS and health controls. Tcell-targeted therapy was also shown to be less effective in patients who had entered the later progressive stages [42]. Moreover, gadolinium enhancing activity diminished over time and did not correlate with neurologic deficits in progressive MS, providing an indirect clue that inflammation was not the predominant pathophysiological mechanism in progressive MS [43]. Despite that, it is inappropriate to completely rule out the pathogenic roles of Th17 cells in progressive MS. Romme and colleagues [44] reported that patients with progressive MS had increased frequencies of Th17 cells and activated follicular T helper (TFH) cells in peripheral blood, and IL-23R+ Th17 cells were elevated both in PP-MS and SP-MS. mRNA expression of IL-21, IL-21R and ICOS from peripheral CD4+ T cells were all upregulated in progressive MS. A more recently study showed that intracranial injection of cerebrospinal fluid (CSF) from progressive MS patients could lead to significantly elevated Th17 cell activity in the CNS and peripheral lymph nodes in mice [45]. Consistent with these previous findings, our data showed that percentages of circulating Th17 and plasma IL-17 levels in progressive MS patients were significantly higher than in healthy controls, and mRNA expression levels of IL-17 and its lineage-specific transcription factor RORγt were also elevated considerably. Aside from that, plasma levels of IL-27 were found to be negatively correlated to the frequencies of circulating Th17 or plasma IL-17 concentrations in
Fig. 4. Correlation between plasma levels of IL-27 and frequencies of circulating Th17 in progressive MS patients. A negative correlation was found between plasma IL-27 levels and percentages of peripheral blood Th17 cells in progressive MS patients (r = −0.301, P = 0.044; Pearson correlation analysis).
S. Tang et al. / Journal of the Neurological Sciences 348 (2015) 174–180
Fig. 5. Relative mRNA expression levels of IL-27, IFN-γ, T-bet, IL-17 and RORγt in PBMCs of progressive MS patients and health controls. IL-27 mRNA expression levels were significantly lower in progressive MS patients than healthy controls, while mRNA expression levels of IL-17 and RORγt were statistically higher in progressive MS patients compared with healthy controls. No significant difference in mRNA levels of IFN-γ or Tbet was found between progressive MS patients and healthy controls. #P b 0.001.
patients with progressive MS, providing further evidence about the anti-inflammatory role of IL-27 in MS. Our present study suggested that abnormal cellular immunity occurred in patients with progressive MS. Both the disturbed T cell ratio and the aberrant cytokine profile played important roles in the progression of MS. So far, there is still no special treatment modality for effective blocking the pathophysiological processes of MS [46–48], and signaling pathways mediated by aberrant cytokines might exacerbate the immune deviation and weaken the clinical efficacy of conventional treatment. As MS is a heterogeneous and complex autoimmune disorder, further investigations are required to illuminate the precise role of IL-27 in the development of MS. Taken together, our data showed that progressive MS had decreased plasma and mRNA expression levels of IL-27, and increased plasma and mRNA levels of IL-17 as well as circulating Th17 cells, suggesting their involvement in the pathophysiological process of the disease. Additionally, plasma IL-27 levels were negatively correlated to percentages of circulating Th17 cells and concentrations of plasma IL-17. Modulation of IL-27 might be a reasonable therapeutic strategy for progressive MS. Authorship Contribution: S.-c.T., X.-h.F., Q.-s.S. and Y. L. designed and performed research, analyzed data and wrote the paper; Q,-m.P. performed research. Conflict of interest disclosure The authors declare no competing financial interests. References [1] Kamm CP, Uitdehaag BM, Polman CH. Multiple sclerosis: current knowledge and future outlook. Eur Neurol 2014;72:132–41. [2] Tullman MJ. Overview of the epidemiology, diagnosis, and disease progression associated with multiple sclerosis. Am J Manag Care 2013;19:S15–20. [3] Jadidi-Niaragh F, Mirshafiey A. Th17 cell, the new player of neuroinflammatory process in multiple sclerosis. Scand J Immunol 2011;74:1–13. [4] Fletcher JM, Lalor SJ, Sweeney CM, Tubridy N, Mills KH. T cells in multiple sclerosis and experimental autoimmune encephalomyelitis. Clin Exp Immunol 2010;162:1–11. [5] Park H, Li Z, Yang XO, Chang SH, Nurieva R, Wang YH, et al. A distinct lineage of CD4 T cells regulates tissue inflammation by producing interleukin 17. Nat Immunol 2005;6:1133–41.
179
[6] Aranami T, Yamamura T. Th17 Cells and autoimmune encephalomyelitis (EAE/MS). Allergol Int: Off J Jpn Soc Allergol 2008;57:115–20. [7] Di Cesare A, Di Meglio P, Nestle FO. The IL-23/Th17 axis in the immunopathogenesis of psoriasis. J Invest Dermatol 2009;129:1339–50. [8] Leipe J, Grunke M, Dechant C, Reindl C, Kerzendorf U, Schulze-Koops H, et al. Role of Th17 cells in human autoimmune arthritis. Arthritis Rheum 2010;62:2876–85. [9] Lovett-Racke AE, Yang Y, Racke MK. Th1 versus Th17: are T cell cytokines relevant in multiple sclerosis? Biochim Biophys Acta 1812;2011:246–51. [10] Pflanz S, Timans JC, Cheung J, Rosales R, Kanzler H, Gilbert J, et al. IL-27, a heterodimeric cytokine composed of EBI3 and p28 protein, induces proliferation of naive CD4+ T cells. Immunity 2002;16:779–90. [11] Batten M, Ghilardi N. The biology and therapeutic potential of interleukin 27. J Mol Med (Berl) 2007;85:661–72. [12] Takeda A, Hamano S, Yamanaka A, Hanada T, Ishibashi T, Mak TW, et al. Cutting edge: role of IL-27/WSX-1 signaling for induction of T-bet through activation of STAT1 during initial Th1 commitment. J Immunol 2003;170:4886–90. [13] Owaki T, Asakawa M, Morishima N, Hata K, Fukai F, Matsui M, et al. A role for IL-27 in early regulation of Th1 differentiation. J Immunol 2005;175:2191–200. [14] Awasthi A, Carrier Y, Peron JP, Bettelli E, Kamanaka M, Flavell RA, et al. A dominant function for interleukin 27 in generating interleukin 10-producing antiinflammatory T cells. Nat Immunol 2007;8:1380–9. [15] Stumhofer JS, Laurence A, Wilson EH, Huang E, Tato CM, Johnson LM, et al. Interleukin 27 negatively regulates the development of interleukin 17-producing T helper cells during chronic inflammation of the central nervous system. Nat Immunol 2006;7:937–45. [16] Batten M, Li J, Yi S, Kljavin NM, Danilenko DM, Lucas S, et al. Interleukin 27 limits autoimmune encephalomyelitis by suppressing the development of interleukin 17-producing T cells. Nat Immunol 2006;7:929–36. [17] Langrish CL, Chen Y, Blumenschein WM, Mattson J, Basham B, Sedgwick JD, et al. IL23 drives a pathogenic T cell population that induces autoimmune inflammation. J Exp Med 2005;201:233–40. [18] Pernis AB. Th17 cells in rheumatoid arthritis and systemic lupus erythematosus. J Intern Med 2009;265:644–52. [19] Li TT, Zhang T, Chen GM, Zhu QQ, Tao JH, Pan HF, et al. Low level of serum interleukin 27 in patients with systemic lupus erythematosus. J Investig Med: Off Publ Am Fed Clin Res 2010;58:737–9. [20] Cao Y, Doodes PD, Glant TT, Finnegan A. IL-27 induces a Th1 immune response and susceptibility to experimental arthritis. J Immunol 2008;180:922–30. [21] Wong CK, Chen da P, Tam LS, Li EK, Yin YB, Lam CW. Effects of inflammatory cytokine IL-27 on the activation of fibroblast-like synoviocytes in rheumatoid arthritis. Arthritis Res Ther 2010;12:R129. [22] Liu XG, Ren J, Yu Y, Sun L, Shi Y, Qin P, et al. Decreased expression of interleukin-27 in immune thrombocytopenia. Br J Haematol 2011;153:259–67. [23] Pfaffl MW, Horgan GW, Dempfle L. Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res 2002;30:e36. [24] Babaloo Z, Yeganeh RK, Farhoodi M, Baradaran B, Bonyadi M, Aghebati L. Increased IL-17A but decreased IL-27 serum levels in patients with multiple sclerosis. Iran J Immunol 2013;10:47–54. [25] Panitch HS, Hirsch RL, Haley AS, Johnson KP. Exacerbations of multiple sclerosis in patients treated with gamma interferon. Lancet 1987;1:893–5. [26] Nylander A, Hafler DA. Multiple sclerosis. J Clin Invest 2012;122:1180–8. [27] Lock C, Hermans G, Pedotti R, Brendolan A, Schadt E, Garren H, et al. Genemicroarray analysis of multiple sclerosis lesions yields new targets validated in autoimmune encephalomyelitis. Nat Med 2002;8:500–8. [28] Ishizu T, Osoegawa M, Mei FJ, Kikuchi H, Tanaka M, Takakura Y, et al. Intrathecal activation of the IL-17/IL-8 axis in opticospinal multiple sclerosis. Brain: J Neurol 2005; 128:988–1002. [29] Kebir H, Ifergan I, Alvarez JI, Bernard M, Poirier J, Arbour N, et al. Preferential recruitment of interferon-gamma-expressing TH17 cells in multiple sclerosis. Ann Neurol 2009;66:390–402. [30] Duarte AL, Dantas AT, de Ataide Mariz H, dos Santos FA, da Silva JC, da Rocha Jr LF, et al. Decreased serum interleukin 27 in Brazilian systemic lupus erythematosus patients. Mol Biol Rep 2013;40:4889–92. [31] Shibata S, Tada Y, Kanda N, Nashiro K, Kamata M, Karakawa M, et al. Possible roles of IL-27 in the pathogenesis of psoriasis. J Invest Dermatol 2010;130:1034–9. [32] Fitzgerald DC, Ciric B, Touil T, Harle H, Grammatikopolou J, Das Sarma J, et al. Suppressive effect of IL-27 on encephalitogenic Th17 cells and the effector phase of experimental autoimmune encephalomyelitis. J Immunol 2007;179: 3268–75. [33] Fitzgerald DC, Zhang GX, El-Behi M, Fonseca-Kelly Z, Li H, Yu S, et al. Suppression of autoimmune inflammation of the central nervous system by interleukin 10 secreted by interleukin 27-stimulated T cells. Nat Immunol 2007;8:1372–9. [34] Grigoriadis N, Grigoriadis S, Polyzoidou E, Milonas I, Karussis D. Neuroinflammation in multiple sclerosis: evidence for autoimmune dysregulation, not simple autoimmune reaction. Clin Neurol Neurosurg 2006;108:241–4. [35] Cannella B, Raine CS. The adhesion molecule and cytokine profile of multiple sclerosis lesions. Ann Neurol 1995;37:424–35. [36] Windhagen A, Anderson DE, Carrizosa A, Balashov K, Weiner HL, Hafler DA. Cytokine secretion of myelin basic protein reactive T cells in patients with multiple sclerosis. J Neuroimmunol 1998;91:1–9. [37] Yoshimura T, Takeda A, Hamano S, Miyazaki Y, Kinjyo I, Ishibashi T, et al. Two-sided roles of IL-27: induction of Th1 differentiation on naive CD4+ T cells versus suppression of proinflammatory cytokine production including IL-23-induced IL17 on activated CD4+ T cells partially through STAT3-dependent mechanism. J Immunol 2006;177:5377–85.
180
S. Tang et al. / Journal of the Neurological Sciences 348 (2015) 174–180
[38] Matusevicius D, Kivisakk P, He B, Kostulas N, Ozenci V, Fredrikson S, et al. Interleukin-17 mRNA expression in blood and CSF mononuclear cells is augmented in multiple sclerosis. Mult Scler 1999;5:101–4. [39] Kebir H, Kreymborg K, Ifergan I, Dodelet-Devillers A, Cayrol R, Bernard M, et al. Human TH17 lymphocytes promote blood-brain barrier disruption and central nervous system inflammation. Nat Med 2007;13:1173–5. [40] Murugaiyan G, Mittal A, Lopez-Diego R, Maier LM, Anderson DE, Weiner HL. IL-27 is a key regulator of IL-10 and IL-17 production by human CD4+ T cells. J Immunol 2009;183:2435–43. [41] Frisullo G, Nociti V, Iorio R, Patanella AK, Marti A, Caggiula M, et al. IL17 and IFNgamma production by peripheral blood mononuclear cells from clinically isolated syndrome to secondary progressive multiple sclerosis. Cytokine 2008;44:22–5. [42] Weiner HL, Cohen JA. Treatment of multiple sclerosis with cyclophosphamide: critical review of clinical and immunologic effects. Mult Scler 2002;8:142–54. [43] He J, Grossman RI, Ge Y, Mannon LJ. Enhancing patterns in multiple sclerosis: evolution and persistence. AJNR Am J Neuroradiol 2001;22:664–9.
[44] Romme Christensen J, Börnsen L, Ratzer R, Piehl F, Khademi M, Olsson T, et al. Systemic inflammation in progressive multiple sclerosis involves follicular T-helper, Th17- and activated B-cells and correlates with progression. PLoS One 2013;8: e57820. [45] Cristofanilli M, Rosenthal H, Cymring B, Gratch D, Pagano B, Xie B, et al. Progressive multiple sclerosis cerebrospinal fluid induces inflammatory demyelination, axonal loss, and astrogliosis in mice. Exp Neurol 2014;261:620–32. [46] Yamout B, Alroughani R, Al-Jumah M, Khoury S, Abouzeid N, Dahdaleh M, et al. Consensus guidelines for the diagnosis and treatment of multiple sclerosis. Curr Med Res Opin 2013;29:611–21. [47] Tanasescu R, Ionete C, Chou IJ, Constantinescu CS. Advances in the treatment of relapsing-remitting multiple sclerosis. Biomed J 2014;37:41–9. [48] Wingerchuk DM, Carter JL. Multiple sclerosis: current and emerging diseasemodifying therapies and treatment strategies. Mayo Clin Proc 2014;89:225–40.
