© 7992 Oxford University Press
Human Molecular Genetics, Vol. 1, No. 2
127-129
De novo mutation in the COL4A5 gene converting glycine 325 to glutamic acid in Alport syndrome Alessandra Renieri, Marco Seri, Jeanne C.Myers1, Taina Pihlajaniemi2, Laura Massella3, Gianfranco Rizzoni3 and Mario De Marchi* Cattedra di Genetica Medica, Dipartimento di Biologia Molecolare, Universita di Siena, 53100 Italy, 1 Department of Biochemistry and Biophysics, University of Pennsylvania, Philadelphia, PA 19104-6059, USA, 2Collagen Research Unit, Biocenter and Department of Medical Biochemistry, University of Oulu, SF-90220, Finland and 3Divisione di Nefrologia e Dialisi, Ospedale Bambin Gesu, Istituto di Ricovero e Cura a Carattere Scientifico, 00165 Rome, Italy
ABSTRACT
Southern blot analysis of the COL4A5 gene in a 6 year old Italian Alport patient (proband VIZ) showed the loss of an Mspl site that was present in the mother and control DNAs. PCR amplification and DNA sequencing revealed a single G—A nucleotide change. The mutation results in substitution of a glutamic acid for a glycine residue at position 325 in the triple helical region of the a5(IV) chain. INTRODUCTION The COL4A5 gene, encoding the a5 chain of basement membrane collagen is the locus of X-linked Alport syndrome (1 - 3 ) . A variety of mutations have been found in this gene and are each different from one another (4-8). A case of a de novo mutation is reported here. MATERIALS AND METHODS Genomic DNA was purified from EDTA-blood, digested to completion with the restriction enzymes Bglll, EcoRI, Hindlll, Sad, TaqI or Mspl, electrophoresed on 0.8% agarose gels, and transferred to charged nylon filters according to standard protocols (9). The following probes were used: PF17B, an EcoRI fragment of cDNA PF17, covering nucleotides 1-680 of the sequence reported in ref. 3; PF17A, the adjacent fragment covering nucleotides 681 -1907; PF6, HE6 and PF7 3' clones. All these probes, together coding for > 90% of the human a5(TV) chain, (2, 3, 7) were used after labeling with a 32 P dATP and dCTP by random priming. Filters were hybridized overnight a t 6 8 o C i n 6 x S S C ( l x S S C = 0.15 M NaCl, 0.015 M sodium citrate, pH 6.8), 0,5% SDS, 5xDenhart's, washed three times for 30 minutes in 2xSSC/0.5% SDS at room temperature, 1 xSSC/0.5% SDSat65°C, 0.1 xSSC/0.5% SDSat65°C, and autoradiographed for 1-5 days at -70°C. COL4A1 and COL4A5 DNA sequences were aligned for maximum homology using the Microgenie software (Beckman), starting from the 3' end of the gene where exon boundaries are known and conserved (10). For PCR amplification, 1 /tg genomic DNA, in a reaction mixture of 100 /tl containing 0.5 /*M of each primer, was • To whom correspondence should be addressed
denatured at 97°C for 5', mixed with Taq polymerase (2 units, Promega), and cycled 35 x at 94 °C for 60 seconds, 58 °C for 40 seconds (cycles 1 -20) or 30 seconds (cycles 20-35), 72°C for 30 seconds, and finally incubated at 72°C for 5 minutes. The PCR product was ligated to M13 Bluescript SK vector (Stratagene) cleaved with Xbal and Sad. DNA sequencing was performed directly on the sense strand of the PCR product and on the antisense strand of four separate clones using the pUC/M13 reverse primer (Promega). RESULTS AND DISCUSSION Proband VIZ is an Italian child presenting with haematuria (3 + ) and proteinuria ( + ) since the age of 11 months; since age 2 proteinuria has ranged between 200-300 mg/day. Ocular and auditory assessment (evoked auditory potential at age 2 and repeated audiometry thereafter) have up to now been normal (age 6 years). Alport syndrome was diagnosed on the basis of a renal biopsy, performed when he was three years old, which showed thinning, occasional splitting and interruption of the glomerular basement membrane (11). The mother is deaf from birth and two maternal aunts are deaf from early infancy. The mother has normal renal function and urinalysis; the aunts showed minimal proteinuria (1 +) in only one urinalysis. Since Alport syndrome in the proband is due to a de novo mutation (see molecular analysis described below), deafness running in the maternal side is likely autosomal recessive, and the aunts proteinuria is probably also an unrelated finding. Southern blot analysis of Mspl-cleaved genomic DNAs using probe PF17A identified bands of 13, 3.8, 3.5, 2.8 and 1.6 Kb in VIZ, and bands of 7.6, 5.8 (less intense), 3.8, 3.5, 2.8 and 1.6 Kb in the mother and control DNAs (Figure la). The contiguous 5' PF17B probe strongly hybridized to the 5.8 Kb band in normal DNA, and to the abnormal 13 Kb fragment but not the 5.8 Kb band in VIZ. Normal findings were obtained with all other enzyme/probe combinations tested (not shown). Therefore, the simplest explanation of the data is a de novo change in the patient's DNA that eliminated an Mspl site between the normal 7.6 Kb and 5.8 Kb fragments, resulting in a new 13 Kb long fragment.
Downloaded from http://hmg.oxfordjournals.org/ at Purdue University Libraries ADMN on June 7, 2015
Submitted January 9, 1992
128 Human Molecular Genetics, Vol. 1, No. 2
c)
CVizM
stCVlzM -13 68
— 7.6
40
3.5
— 1.6
ATGCCTGGTGATCCTGGT - 3 '
J-TCCCTACCACTTTTCC
T
S-eGTTTGCCTGGTGATCCTGGTTACCCTGGTGAACE£l3»AGGGATGGTQAAAAG-3' I
I
I
I
C0L4A5 (
5-SGTTTTCCTGGTGAACCCG0GTACCCAGGACTCATAGGCC6CCAGGGCCCGCAG-3-
?)
C0L4A1 (trail 7)
b) Figure 1.Restriction analysis of genomic DNA and of the amplified COL4A5 exon containing the mutated Mspl site, a) Mspl digested genomic DNA hybridized with probe PF17A. Fragment length is indicated in Kb. VIZ = proband, M = his mother, C = a normal male. The control is representative of 32 healthy individuals (M/F 28/4). The normal 5.8 Kb fragment lacking in VIZ hybridizes weakly with this probe and is not visible in this figure, b) Alignment of human COL4A5 and COL4AI cDNA sequences. Only exon 17 of the COL4A1 gene is shown. The mutated Mspl site (boxed) is 16 bp from the 3' boundary of the putative corresponding COL4A5 exon. Forward and reverse primers of COL4A5 were designed to minimize homology with COL4A1. Xbal and Sad sites were added at the 5' end of the primers for cloning purposes, c) Six percent polyacrylamide gel of PCR products digested with Mspl. Length is indicated in bp. st = molecular weight marker (type V Boehringer).
fl
C
6
T
Pro Gly CCC 661 flGG CG6 ccr TCC
dCC
H66 TCC
ACKNOWLEDGMENTS normal
mutated
A.R. and L.M. are recipients of 'Dottorato di Ricerca Genetica umana' and Ministero Sanita 'Ricercafinalizzata89' fellowships. Work supported by funds MURST 40%, Ricerca finalizzata regione Toscana, and NIH grant AR20553.
Glu
REFERENCES
Figure 2. DNA sequence of the cloned PCR product of proband VIZ. Left: missense mutation and loss of Mspl site (boxed). Right: sequencing gel of the antisense strand, showing a T instead of a C (arrow).
1. Hostikka.L.S., Eddy.R.L., Byers.M.G., Hoyhtya,M., Shows,B. and Tryggvason.K. (1990) Proc. Nail. Acad. Sci. USA 87, 1606-1610. 2. Myers.J.C, Jones,T.A., Pohjolainen,E.-R., Kadri.A.S., Goddard.A.D., Sheer.D., Solomon,E. and Pihlajaniemi.T. (1990) Am. J. Hum. Genet. 46, 1024-1033. 3. Pihlajaniemi.T., Pohjolainen,E.-R. and Myers,J.(1990)/ Biol. Chem. 265, 13758-13766.
Downloaded from http://hmg.oxfordjournals.org/ at Purdue University Libraries ADMN on June 7, 2015
28
2.8
In order to further characterize the prospective mutation by DNA sequencing, a PCR template product was generated. Since the 5' COL4A5 genomic structure has not been reported, we designed primers assuming conservation of the exon boundaries between the homologous COL4A5 and COL4A1 genes (12). Alignment of the two cDNA sequences suggested that the Mspl site in question corresponded to a COL4A1 region entirely contained within the 54 bp exon 17 (Figure lb). Using two primers coding for the ends of the putative COL4A5 exon, a PCR product of the expected 68 bp size was obtained from VIZ, his mother and control DNAs. This amplified product was cleaved by Mspl into 40 and 28 bp fragments in the control and in the mother, but not in the proband (Figure lc). DNA sequencing revealed a G/C to A/T transition in the external position of the Mspl site (CCGG-CCGA) causing a GGA (gly) to GAA (glu) change (Figure 2). This substitution is located in the triple-helical region between interruptions IV and V at residue 325 of the a5 chain (13). The smallest amino acid, glycine, occurs as every third residue in collagenous sequences. Many of the mutations identified in the fibrillar collagens demonstrate that substitution of bulkier amino acids for glycine prevents correct folding of the triple helix and results in synthesis of functionally impaired collagen (14, 15). The substitution of glycine identified here in the a5(TV) chain in an Alport patient, together with similar cases recently observed in patients with this disease (8), suggest that triple helix destabilization has a pathogenic role also in Alport syndrome. Interestingly, a Gly —Arg substitution in position 325 was identified in a large French Alport family (Knebelmann and Antignac, personal communication) through loss of the same Mspl site. In that case, the G—A change affected the internal G of the restriction site and was likely due to a C-~ T transition in the antisense strand caused by a mutagenic "KZ, as is generally assumed in CG dinucleotides (16). The present de novo mutation can be ascribed to the same mechanism only assuming that the C next to the CG is preferentially methylated as well. Taking into account the extensive heterogeneity of mutations (4—8), and the reduced genetic fitness of the disease, a significant proportion of Alport cases can be predicted to originate de novo, as it appears to be for the present case. However, this has previously been demonstrated at the molecular level only in few instances (6) perhaps because a positive family history is generally required for diagnosis (17). The widespread use of molecular tools will help diagnosis of Alport syndrome even in isolated cases, and will allow to estimate the actual proportion of de novo mutations.
Human Molecular Genetics, Vol. 1, No. 2 129
Downloaded from http://hmg.oxfordjournals.org/ at Purdue University Libraries ADMN on June 7, 2015
4. Barker.D.F., Hostikka.S.L., Zhou.J., Chow.L.T., Oliphant.A.R., Gerken,S.C, Gregory,M.C, Skolnick.M.H., Atkin.C.L. and Tryggvason.K. (1990) Science 248, 1224-1226. 5. Zhou,J., Barker.D.F., Hostikka.S.L., Gregory.M.C, Atkin.C.L. and Tryggvason.K. (1991) Genomics 9, 10-18. 6. Boye.E., Vetrie.D., Flinter.F., Buckle.B., Pihlajaniemi.T., Hamalainen.E.R., Myers,J.C. and Bobrow.M.H. (1991) Genomics 11, 1125-1132. 7. Renieri.A., Seri.M., MyersJ.C., Pihlajaniemi.T., Sessa.A., Rizzoni.G. and De Marchi.M. (1992) Hum. Genet. In Press. 8. ZhouJ., HertzJ.M. and Tryggvason.K. (1992) Am. J. Hum. Genet. In Press. 9. Sambrook,J., Fritsch.E.F. and Maniatis,T.(1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 10. Zhou.J., Hostikka.S.L., Chow.L.T. and Tryggvason.K. (1991) Genomics 9, 1-9. 11. Spear.G.S. (1990) in Sessa.A., Meroni.M. and Battini.G. (eds) Hereditary Nephritis. Karger, Basel, pp. 41—46. 12. Soininen.R., Huotari.M., Ganguly,A., Prockop.D.J. and Tryggvason.K. (1989)7. Biol. Chem. 264, 13565-13571. 13. ZhouJ., Leinonen.A. and Tryggvason.K. (1991) Proceedings of 8th ICHG 2405. Am. J. Hum. Genet. Supplement 49, 424. 14. Byers.P.H., Wallis.G.A. and Willing.M.C. (1991) J. Med. Genet. 28, 433-442. 15. Kuivaniemi.H., Tromp.G. and Prockop.D.J. (1991) FASEBJ. 5, 2052-2060. 16. Pmchno.C.J., Cohn.D.H., Wallis.G.A., Willing.M.C., Starman.B.J., Zhang.X. and Byers.P.H. (1991) Hum. Genet. 87, 33-40. 17. Flinter.F.A., Abbs.S. and Bobrow.M. (1989) Genomics 4, 335-338.
Human Molecular Genetics, Vol. 1, No. 2
127-129
De novo mutation in the COL4A5 gene converting glycine 325 to glutamic acid in Alport syndrome Alessandra Renieri, Marco Seri, Jeanne C.Myers1, Taina Pihlajaniemi2, Laura Massella3, Gianfranco Rizzoni3 and Mario De Marchi* Cattedra di Genetica Medica, Dipartimento di Biologia Molecolare, Universita di Siena, 53100 Italy, 1 Department of Biochemistry and Biophysics, University of Pennsylvania, Philadelphia, PA 19104-6059, USA, 2Collagen Research Unit, Biocenter and Department of Medical Biochemistry, University of Oulu, SF-90220, Finland and 3Divisione di Nefrologia e Dialisi, Ospedale Bambin Gesu, Istituto di Ricovero e Cura a Carattere Scientifico, 00165 Rome, Italy
ABSTRACT
Southern blot analysis of the COL4A5 gene in a 6 year old Italian Alport patient (proband VIZ) showed the loss of an Mspl site that was present in the mother and control DNAs. PCR amplification and DNA sequencing revealed a single G—A nucleotide change. The mutation results in substitution of a glutamic acid for a glycine residue at position 325 in the triple helical region of the a5(IV) chain. INTRODUCTION The COL4A5 gene, encoding the a5 chain of basement membrane collagen is the locus of X-linked Alport syndrome (1 - 3 ) . A variety of mutations have been found in this gene and are each different from one another (4-8). A case of a de novo mutation is reported here. MATERIALS AND METHODS Genomic DNA was purified from EDTA-blood, digested to completion with the restriction enzymes Bglll, EcoRI, Hindlll, Sad, TaqI or Mspl, electrophoresed on 0.8% agarose gels, and transferred to charged nylon filters according to standard protocols (9). The following probes were used: PF17B, an EcoRI fragment of cDNA PF17, covering nucleotides 1-680 of the sequence reported in ref. 3; PF17A, the adjacent fragment covering nucleotides 681 -1907; PF6, HE6 and PF7 3' clones. All these probes, together coding for > 90% of the human a5(TV) chain, (2, 3, 7) were used after labeling with a 32 P dATP and dCTP by random priming. Filters were hybridized overnight a t 6 8 o C i n 6 x S S C ( l x S S C = 0.15 M NaCl, 0.015 M sodium citrate, pH 6.8), 0,5% SDS, 5xDenhart's, washed three times for 30 minutes in 2xSSC/0.5% SDS at room temperature, 1 xSSC/0.5% SDSat65°C, 0.1 xSSC/0.5% SDSat65°C, and autoradiographed for 1-5 days at -70°C. COL4A1 and COL4A5 DNA sequences were aligned for maximum homology using the Microgenie software (Beckman), starting from the 3' end of the gene where exon boundaries are known and conserved (10). For PCR amplification, 1 /tg genomic DNA, in a reaction mixture of 100 /tl containing 0.5 /*M of each primer, was • To whom correspondence should be addressed
denatured at 97°C for 5', mixed with Taq polymerase (2 units, Promega), and cycled 35 x at 94 °C for 60 seconds, 58 °C for 40 seconds (cycles 1 -20) or 30 seconds (cycles 20-35), 72°C for 30 seconds, and finally incubated at 72°C for 5 minutes. The PCR product was ligated to M13 Bluescript SK vector (Stratagene) cleaved with Xbal and Sad. DNA sequencing was performed directly on the sense strand of the PCR product and on the antisense strand of four separate clones using the pUC/M13 reverse primer (Promega). RESULTS AND DISCUSSION Proband VIZ is an Italian child presenting with haematuria (3 + ) and proteinuria ( + ) since the age of 11 months; since age 2 proteinuria has ranged between 200-300 mg/day. Ocular and auditory assessment (evoked auditory potential at age 2 and repeated audiometry thereafter) have up to now been normal (age 6 years). Alport syndrome was diagnosed on the basis of a renal biopsy, performed when he was three years old, which showed thinning, occasional splitting and interruption of the glomerular basement membrane (11). The mother is deaf from birth and two maternal aunts are deaf from early infancy. The mother has normal renal function and urinalysis; the aunts showed minimal proteinuria (1 +) in only one urinalysis. Since Alport syndrome in the proband is due to a de novo mutation (see molecular analysis described below), deafness running in the maternal side is likely autosomal recessive, and the aunts proteinuria is probably also an unrelated finding. Southern blot analysis of Mspl-cleaved genomic DNAs using probe PF17A identified bands of 13, 3.8, 3.5, 2.8 and 1.6 Kb in VIZ, and bands of 7.6, 5.8 (less intense), 3.8, 3.5, 2.8 and 1.6 Kb in the mother and control DNAs (Figure la). The contiguous 5' PF17B probe strongly hybridized to the 5.8 Kb band in normal DNA, and to the abnormal 13 Kb fragment but not the 5.8 Kb band in VIZ. Normal findings were obtained with all other enzyme/probe combinations tested (not shown). Therefore, the simplest explanation of the data is a de novo change in the patient's DNA that eliminated an Mspl site between the normal 7.6 Kb and 5.8 Kb fragments, resulting in a new 13 Kb long fragment.
Downloaded from http://hmg.oxfordjournals.org/ at Purdue University Libraries ADMN on June 7, 2015
Submitted January 9, 1992
128 Human Molecular Genetics, Vol. 1, No. 2
c)
CVizM
stCVlzM -13 68
— 7.6
40
3.5
— 1.6
ATGCCTGGTGATCCTGGT - 3 '
J-TCCCTACCACTTTTCC
T
S-eGTTTGCCTGGTGATCCTGGTTACCCTGGTGAACE£l3»AGGGATGGTQAAAAG-3' I
I
I
I
C0L4A5 (
5-SGTTTTCCTGGTGAACCCG0GTACCCAGGACTCATAGGCC6CCAGGGCCCGCAG-3-
?)
C0L4A1 (trail 7)
b) Figure 1.Restriction analysis of genomic DNA and of the amplified COL4A5 exon containing the mutated Mspl site, a) Mspl digested genomic DNA hybridized with probe PF17A. Fragment length is indicated in Kb. VIZ = proband, M = his mother, C = a normal male. The control is representative of 32 healthy individuals (M/F 28/4). The normal 5.8 Kb fragment lacking in VIZ hybridizes weakly with this probe and is not visible in this figure, b) Alignment of human COL4A5 and COL4AI cDNA sequences. Only exon 17 of the COL4A1 gene is shown. The mutated Mspl site (boxed) is 16 bp from the 3' boundary of the putative corresponding COL4A5 exon. Forward and reverse primers of COL4A5 were designed to minimize homology with COL4A1. Xbal and Sad sites were added at the 5' end of the primers for cloning purposes, c) Six percent polyacrylamide gel of PCR products digested with Mspl. Length is indicated in bp. st = molecular weight marker (type V Boehringer).
fl
C
6
T
Pro Gly CCC 661 flGG CG6 ccr TCC
dCC
H66 TCC
ACKNOWLEDGMENTS normal
mutated
A.R. and L.M. are recipients of 'Dottorato di Ricerca Genetica umana' and Ministero Sanita 'Ricercafinalizzata89' fellowships. Work supported by funds MURST 40%, Ricerca finalizzata regione Toscana, and NIH grant AR20553.
Glu
REFERENCES
Figure 2. DNA sequence of the cloned PCR product of proband VIZ. Left: missense mutation and loss of Mspl site (boxed). Right: sequencing gel of the antisense strand, showing a T instead of a C (arrow).
1. Hostikka.L.S., Eddy.R.L., Byers.M.G., Hoyhtya,M., Shows,B. and Tryggvason.K. (1990) Proc. Nail. Acad. Sci. USA 87, 1606-1610. 2. Myers.J.C, Jones,T.A., Pohjolainen,E.-R., Kadri.A.S., Goddard.A.D., Sheer.D., Solomon,E. and Pihlajaniemi.T. (1990) Am. J. Hum. Genet. 46, 1024-1033. 3. Pihlajaniemi.T., Pohjolainen,E.-R. and Myers,J.(1990)/ Biol. Chem. 265, 13758-13766.
Downloaded from http://hmg.oxfordjournals.org/ at Purdue University Libraries ADMN on June 7, 2015
28
2.8
In order to further characterize the prospective mutation by DNA sequencing, a PCR template product was generated. Since the 5' COL4A5 genomic structure has not been reported, we designed primers assuming conservation of the exon boundaries between the homologous COL4A5 and COL4A1 genes (12). Alignment of the two cDNA sequences suggested that the Mspl site in question corresponded to a COL4A1 region entirely contained within the 54 bp exon 17 (Figure lb). Using two primers coding for the ends of the putative COL4A5 exon, a PCR product of the expected 68 bp size was obtained from VIZ, his mother and control DNAs. This amplified product was cleaved by Mspl into 40 and 28 bp fragments in the control and in the mother, but not in the proband (Figure lc). DNA sequencing revealed a G/C to A/T transition in the external position of the Mspl site (CCGG-CCGA) causing a GGA (gly) to GAA (glu) change (Figure 2). This substitution is located in the triple-helical region between interruptions IV and V at residue 325 of the a5 chain (13). The smallest amino acid, glycine, occurs as every third residue in collagenous sequences. Many of the mutations identified in the fibrillar collagens demonstrate that substitution of bulkier amino acids for glycine prevents correct folding of the triple helix and results in synthesis of functionally impaired collagen (14, 15). The substitution of glycine identified here in the a5(TV) chain in an Alport patient, together with similar cases recently observed in patients with this disease (8), suggest that triple helix destabilization has a pathogenic role also in Alport syndrome. Interestingly, a Gly —Arg substitution in position 325 was identified in a large French Alport family (Knebelmann and Antignac, personal communication) through loss of the same Mspl site. In that case, the G—A change affected the internal G of the restriction site and was likely due to a C-~ T transition in the antisense strand caused by a mutagenic "KZ, as is generally assumed in CG dinucleotides (16). The present de novo mutation can be ascribed to the same mechanism only assuming that the C next to the CG is preferentially methylated as well. Taking into account the extensive heterogeneity of mutations (4—8), and the reduced genetic fitness of the disease, a significant proportion of Alport cases can be predicted to originate de novo, as it appears to be for the present case. However, this has previously been demonstrated at the molecular level only in few instances (6) perhaps because a positive family history is generally required for diagnosis (17). The widespread use of molecular tools will help diagnosis of Alport syndrome even in isolated cases, and will allow to estimate the actual proportion of de novo mutations.
Human Molecular Genetics, Vol. 1, No. 2 129
Downloaded from http://hmg.oxfordjournals.org/ at Purdue University Libraries ADMN on June 7, 2015
4. Barker.D.F., Hostikka.S.L., Zhou.J., Chow.L.T., Oliphant.A.R., Gerken,S.C, Gregory,M.C, Skolnick.M.H., Atkin.C.L. and Tryggvason.K. (1990) Science 248, 1224-1226. 5. Zhou,J., Barker.D.F., Hostikka.S.L., Gregory.M.C, Atkin.C.L. and Tryggvason.K. (1991) Genomics 9, 10-18. 6. Boye.E., Vetrie.D., Flinter.F., Buckle.B., Pihlajaniemi.T., Hamalainen.E.R., Myers,J.C. and Bobrow.M.H. (1991) Genomics 11, 1125-1132. 7. Renieri.A., Seri.M., MyersJ.C., Pihlajaniemi.T., Sessa.A., Rizzoni.G. and De Marchi.M. (1992) Hum. Genet. In Press. 8. ZhouJ., HertzJ.M. and Tryggvason.K. (1992) Am. J. Hum. Genet. In Press. 9. Sambrook,J., Fritsch.E.F. and Maniatis,T.(1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 10. Zhou.J., Hostikka.S.L., Chow.L.T. and Tryggvason.K. (1991) Genomics 9, 1-9. 11. Spear.G.S. (1990) in Sessa.A., Meroni.M. and Battini.G. (eds) Hereditary Nephritis. Karger, Basel, pp. 41—46. 12. Soininen.R., Huotari.M., Ganguly,A., Prockop.D.J. and Tryggvason.K. (1989)7. Biol. Chem. 264, 13565-13571. 13. ZhouJ., Leinonen.A. and Tryggvason.K. (1991) Proceedings of 8th ICHG 2405. Am. J. Hum. Genet. Supplement 49, 424. 14. Byers.P.H., Wallis.G.A. and Willing.M.C. (1991) J. Med. Genet. 28, 433-442. 15. Kuivaniemi.H., Tromp.G. and Prockop.D.J. (1991) FASEBJ. 5, 2052-2060. 16. Pmchno.C.J., Cohn.D.H., Wallis.G.A., Willing.M.C., Starman.B.J., Zhang.X. and Byers.P.H. (1991) Hum. Genet. 87, 33-40. 17. Flinter.F.A., Abbs.S. and Bobrow.M. (1989) Genomics 4, 335-338.
