Chapter 17 DamID as an Approach to Studying Long-Distance Chromatin Interactions Fabienne Cléard, François Karch, and Robert K. Maeda Abstract How transcription is controlled by distally located cis-regulatory elements is an active area of research in biology. As such, there have been many techniques developed to probe these long-distance chromatin interactions. Here, we focus on one such method, called DamID (van Steensel and Henikoff, Nat Biotechnol 18(4):424–428, 2000). While other methods like 3C (Dekker et al., Science 295(5558):1306– 1311, 2002), 4C (Simonis et al., Nat Genet 38(11):1348–1354, 2006; Zhao et al., Nat Genet 38(11):1341–1347, 2006), and 5C (Dostie et al., Genome Res 16(10):1299–1309, 2006) are undoubtedly powerful, the DamID method can offer some advantages over these methods if the genetic locus can be easily modified. The lack of tissue fixation, the low amounts of starting material required to perform the experiment, and the relatively modest hardware requirements make DamID experiments an interesting alternative to consider when examining long-distance chromatin interactions. Key words Dam methyltransferase, DamID, Drosophila, Chromatin, Long-distance interactions, Gene regulation
1
Introduction DamID is a method where one targets the Dam methyltransferase (Dam) to a site in the genome (generally by fusing Dam to a chromatin-recruiting protein) and monitors DNA methylation (at GATC sites) near the site of targeting [1]. As DNA methylation is mostly nonexistent in flies, this method has proven to be quite powerful in localizing the binding sites of proteins in the Drosophila genome as an alternative to ChIP experiments. On a small scale, monitoring DNA methylation is done by simple restriction enzyme digestion using the methylation-sensitive DpnII enzyme and Q-PCR with primers centered around methylation site being tested. For a wider, genomic scale experiment, the DpnII enzyme can be replaced by the DpnI enyzme, which cuts at methylated GATC sites. Following DpnI digestion, the digested chromatin is size fractionated and DNA linkers are added to the DpnI-cleaved
Yacine Graba and René Rezsohazy (eds.), Hox Genes: Methods and Protocols, Methods in Molecular Biology, vol. 1196, DOI 10.1007/978-1-4939-1242-1_17, © Springer Science+Business Media New York 2014
279
280
Fabienne Cléard et al.
Fig. 1 DamID to study long-distance chromatin interactions. The top panel shows in a cartoon form the 37 kb long chromatin loop between the Fab-7 boundary and the Abd-B promoter region as deduced from the DamID experiment described here. Dam was recruited at Fab-7 by the mean of a fusion with the Gal4 DNA-binding domain (Gal4DBD) and the introduction of UAS sites in the immediate vicinity of Fab-7 by gene conversion (Cléard et al. [3]). The bottom part shows the methylation frequency (also in a cartoon form) of GATC sites as measured by resistance to DpnII digestion across the region. In addition to a peak of methylation at the recruitment site (cis-methylation), a second of peak of methylation is detected in the vicinity of the Abd-B promoter (trans-methylation)
ends for subsequent analysis on microarrays or using a mass sequencing-based approach [2]. We adapted the DamID method for studying long-distance chromatin interactions involving the boundary elements of the Drosophila bithorax complex (BX-C; Fig. 1) [3]. Although boundary elements behave as insulators in transgenic assays (blocking enhancer-promoter interactions), it was clear from their location in the complex that they do not act as simple insulators within the BX-C. The Fab-7 boundary element, for example, lies in between all of the enhancers of the iab-5 and iab-6 domains and their target Abd-B promoter [4]. A number of hypotheses have been proposed to account for the transgenic insulator activity of BX-C boundary elements. Many of these mechanisms, like enhancer trapping/ promoter decoys and the creation of chromatin loops to prevent enhancer-promoter communication, hypothesize that boundary elements may specifically interact with other elements in the BX-C to form chromatin-chromatin interactions [5]. This idea
Finding Long Distance Chromatin with DamID
281
of insulators mediating chromatin-chromatin interactions was supported by work on other elements with insulator activity, such as the Su(Hw) insulator from the gypsy retrotransposon [6, 7]. Thus, we were interested in understanding if the Fab-7 boundary element contacted other elements in the BX-C to perform its function. To investigate this, we turned to the method of DamID. Previous studies had shown that a Dam methyltransferase fused to a Gal4 DNA-binding domain (Gal4DBD) could methylate GATC sites within a range of a couple of kilobases from the initial site of targeting [1]. This “spreading” of methyltransferase activity suggested to us that DamID might be able to methylate interacting DNAs in trans to visualize DNA elements in close proximity to Fab-7 within the nucleus. Of course the major difficulty of DamID is the requirement of a protein to target the methyltransferase to the specific region of the genome. At that time, outside of the GAGA factor, which binds to numerous sites in the genome, we knew nothing of other Fab-7 proteins. Thus, we modified the sequence immediately adjacent to the Fab-7 boundary to include 14 binding sites for the Gal4 protein and flanked the Fab-7 boundary with loxP sites. Using this line, we were able to monitor longdistance chromatin interactions at various sites in the BX-C by monitoring DNA methylation levels away from the targeting site. As a control, we also performed experiments in the absence of Fab-7 to determine which interactions were Fab-7 dependent. Based on our results, we determined that the Fab-7 boundary element interacted with an area near the Abd-B promoter (>35 kb away) in tissues where Abd-B was not expressed. In areas where Abd-B was expressed, this interaction was absent. Thus, using DamID, we were able to determine a role for Fab-7 in long-distance chromatin interactions in vivo, and determine that this activity was regulated along the A-P axis of the fly [3]. One of the advantages of DamID as a method for probing long-distance interactions is its relative simplicity. If one follows the protocol described below, respecting the warnings mentioned in the text and footnotes, one can expect fairly reproducible results. The hardest part of DamID, and its most limiting element, is the creation of proper fly lines in which to do the experiments. While one can make Dam fusions to proteins that bind to a particular element of interest (for example to an insulator), we recommend, instead, spending the time to add heterologous binding sites near the element to be tested. We recommend this approach because of the controls it allows. First, one can remove the element while keeping the targeting sites to check for the specificity of the interactions. Second, one can use a chromosome without targeting sites, but expressing the same Dam fusion protein to characterize the nonspecific level of methylation with the fusion protein.
282
Fabienne Cléard et al.
Obviously, making these modifications to the genome is time consuming and challenging. But, with the advent of numerous new gene targeting methods, these difficulties are not as hard to overcome as in the past. Because of the experimental constraints of DamID, one must consider DamID in the context of other methods used to probe long-distance interactions. Even with the improvements and developments in other technologies such as 3C, 4C, 5C, and Chia-PET [8–12], DamID remains a powerful option to investigate long-distance chromatin interactions. Once again, its limitation is the fact that one needs to target Dam to a specific site in the genome. But, if this is possible, DamID has a number of positive advantages. First, although the quantitation is performed in vitro, it is monitoring marks that occurred in the living organism and does not suffer from artifacts stemming from fixation. Next, it requires very little materials to perform. Our non-genomic scale experiments were performed on DNA isolated from as little as three fly heads, which yielded enough DNA to be used for 40 experiments. Given that flies are small, and fly tissues even smaller, this can be a huge advantage. This advantage might even become more important if combined with tissue-specific expression of Dam fusion proteins. The creation of such tissue-specific forms of Dam has been problematic in the past because high-level expression of Dam (such as the levels one might expect from a UAScontrolled transgene) is lethal. This problem, however, has recently been overcome by the lab of Andrea Brand, who showed that low-level, tissue-specific expression of Dam can be achieved if Dam is made as the second coding sequence in a polycistronic transcript without an internal ribosome entry site under the control of a UAS promoter [13]. Thus, Dam can now be cell- or tissue-specifically expressed, precluding the requirement for tedious dissections. Given the low amount of tissue required to see signal, one might potentially be able to visualize interactions coming from only a small number of cells. The technique described here has been described previously in Cleard et al. [3]. It is a method to determine long-range interactions at selected GATC sites in the genome. As this method is relatively quick and easy to perform with standard molecular biology lab equipment, it is a protocol that should be usable by a wide variety of scientists. If a more genomic approach is required, please refer to Van Steensel et al. [2].
2
Materials 1. Standard cornmeal-agar fly growth media. 2. Fly stocks carrying a Dam fusion protein (with targeting sites inserted near the genomic elements to study if the fusion protein does not possess native targeting sites in the genome;
Finding Long Distance Chromatin with DamID
283
that is, for Gal-Dam fusions one must have UAS targeting sites in the genome near the element to be investigated). Control flies expressing the Dam fusion protein without targeting sites in the genome, or flies expressing Dam not fused to a DNA bind domain for background methylation controls. As DamID requires target sites in the genome for a Dam fusion protein, this review assumes the availability of a Dam fusion protein to a DNA-binding protein with binding sites near the element being studied. These can be Dam fusions to a DNA-binding protein that normally binds the element in question, or, as in our case, a Dam fusion to the Gal4 DNA-binding domain (Gal4DBD) whose binding sites (UAS) have been added next to an element of interest [1]. 3. A quantitative PCR apparatus like an ABI Prism SDS 7900 HT system. 4. 2× Power SYBR Green Master Mix (Applied Biosystems). 5. Applied Biosystems Primer Express Software package (Applied Biosystems). 6. Control primers designed to amplify a genomic region lacking Dam methylation sites (GATC) from the D. melanogaster Gapdh1-F gene (Dm Gapdh1-F) and from the D. melanogaster EF1g-F gene (DmEF1g-F) to be used to standardize the input DNA concentrations for each reaction. Dm Gapdh1-F: ATTTCGCTGAACGATAAGTTCGT (Tm=61.3 °C). Dm Gapdh1-R: CGATGACGCGGTTGGAGTA (Tm = 63.1 °C). Dm EF1g-F: GTGTTCATGTCGTGCAATCTCA (Tm = 62.1 °C). Dm EF1g-R: CGCCTTGCGCATCTTGT (Tm = 62.1 °C). 7. Control primers designed to amplify a region of the genome containing a Dam methyltransferase site (GATC). These primers are used to determine the background level of methylation at a location not targeted by the Dam fusion protein. We use the following primers to amplify a region from the TBP gene: TBP-74 F: CAAAGGTGCGGCAGGAGAT (Tm = 63.6 °C). TBP-155R: CCTATTTATGACTGCTTCTTGAACTTCTT (Tm = 61.7 °C). 8. Fly homogenization buffer: 10 mM Tris-HCl pH 7.5, 10 mM EDTA, 100 mM NaCl, 0.5 % SDS, 100 μg/ml Proteinase K (diluted freshly from 20 mg/ml stock). 9. Restriction enzyme DpnII.
3
Methods
3.1 Fly Growth Conditions
All flies were raised on a standard cornmeal-agar food mixture and grown at room temperature (22 ºC). Higher growing
284
Fabienne Cléard et al.
temperatures are to be avoided due to the toxicity of Dam overexpression (see Note 1). 3.2 Genomic DNA Preparation from Whole Flies
This protocol is modeled after the protocol of Van Steensel and Henikoff [1]. 1. Six adult flies per genotype to be tested (not forgetting the nontargeted control) (see Note 2) are placed individually in PCR tubes. 2. Standard micropipette tips containing 100 μl of fly homogenization buffer are used to crush the flies without expelling the held liquid. After the fly is sufficiently crushed, the held liquid should be expelled onto the fly remains. 3. Tubes are placed at 50 ºC for 3 h. 4. Fly extracts are then phenol/chloroform and then chloroform extracted, retaining the aqueous phase (see Note 3).
3.3 DpnII Digestion of Genomic DNA
1. For each genomic DNA extraction, set up the following two reactions: Incubate reactions overnight at 37 ºC. DpnII(−) Control 5 μl Genomic DNA 2 μl DpnII buffer (NEB) 13 μl H2O 20 μl Total volume DpnII digest 5 μl Genomic DNA 2 μl DpnII buffer (NEB) 0.2 DpnII (2 units) 12.8 μl H2O 20 μl Total volume
2. Heat inactivate at 80 ºC for 10 min. 3. DNA quality can be assessed using standard fly PCR reactions using the control primers, which are centered on regions containing no GATC (DpnII) sites (the GAPDH and EF1G primers). 3.4 DNA Preparation and Digestion from Dissected Fly Parts
Genomic DNA was isolated from dissected fly parts using a similar protocol to that used for whole flies. The only modifications to this protocol were the following: 1. Three adult heads or three adult abdomens were pooled and used as sources for the genomic DNA.
Finding Long Distance Chromatin with DamID
285
2. DpnII digestions were performed with or without 2 units of DpnII enzyme in a reaction volume of 25 μl. 3.5 Selection of Oligonucleotides for Q-PCR
Oligonucleotides were selected using the default parameters of the Primer Express v. 2.0 software from Applied Biosystems, centered on single DpnII cut sites in the area being examined. In general, primers are designed to have melting temperatures in the range of 61–64 ºC and product lengths of
1
Introduction DamID is a method where one targets the Dam methyltransferase (Dam) to a site in the genome (generally by fusing Dam to a chromatin-recruiting protein) and monitors DNA methylation (at GATC sites) near the site of targeting [1]. As DNA methylation is mostly nonexistent in flies, this method has proven to be quite powerful in localizing the binding sites of proteins in the Drosophila genome as an alternative to ChIP experiments. On a small scale, monitoring DNA methylation is done by simple restriction enzyme digestion using the methylation-sensitive DpnII enzyme and Q-PCR with primers centered around methylation site being tested. For a wider, genomic scale experiment, the DpnII enzyme can be replaced by the DpnI enyzme, which cuts at methylated GATC sites. Following DpnI digestion, the digested chromatin is size fractionated and DNA linkers are added to the DpnI-cleaved
Yacine Graba and René Rezsohazy (eds.), Hox Genes: Methods and Protocols, Methods in Molecular Biology, vol. 1196, DOI 10.1007/978-1-4939-1242-1_17, © Springer Science+Business Media New York 2014
279
280
Fabienne Cléard et al.
Fig. 1 DamID to study long-distance chromatin interactions. The top panel shows in a cartoon form the 37 kb long chromatin loop between the Fab-7 boundary and the Abd-B promoter region as deduced from the DamID experiment described here. Dam was recruited at Fab-7 by the mean of a fusion with the Gal4 DNA-binding domain (Gal4DBD) and the introduction of UAS sites in the immediate vicinity of Fab-7 by gene conversion (Cléard et al. [3]). The bottom part shows the methylation frequency (also in a cartoon form) of GATC sites as measured by resistance to DpnII digestion across the region. In addition to a peak of methylation at the recruitment site (cis-methylation), a second of peak of methylation is detected in the vicinity of the Abd-B promoter (trans-methylation)
ends for subsequent analysis on microarrays or using a mass sequencing-based approach [2]. We adapted the DamID method for studying long-distance chromatin interactions involving the boundary elements of the Drosophila bithorax complex (BX-C; Fig. 1) [3]. Although boundary elements behave as insulators in transgenic assays (blocking enhancer-promoter interactions), it was clear from their location in the complex that they do not act as simple insulators within the BX-C. The Fab-7 boundary element, for example, lies in between all of the enhancers of the iab-5 and iab-6 domains and their target Abd-B promoter [4]. A number of hypotheses have been proposed to account for the transgenic insulator activity of BX-C boundary elements. Many of these mechanisms, like enhancer trapping/ promoter decoys and the creation of chromatin loops to prevent enhancer-promoter communication, hypothesize that boundary elements may specifically interact with other elements in the BX-C to form chromatin-chromatin interactions [5]. This idea
Finding Long Distance Chromatin with DamID
281
of insulators mediating chromatin-chromatin interactions was supported by work on other elements with insulator activity, such as the Su(Hw) insulator from the gypsy retrotransposon [6, 7]. Thus, we were interested in understanding if the Fab-7 boundary element contacted other elements in the BX-C to perform its function. To investigate this, we turned to the method of DamID. Previous studies had shown that a Dam methyltransferase fused to a Gal4 DNA-binding domain (Gal4DBD) could methylate GATC sites within a range of a couple of kilobases from the initial site of targeting [1]. This “spreading” of methyltransferase activity suggested to us that DamID might be able to methylate interacting DNAs in trans to visualize DNA elements in close proximity to Fab-7 within the nucleus. Of course the major difficulty of DamID is the requirement of a protein to target the methyltransferase to the specific region of the genome. At that time, outside of the GAGA factor, which binds to numerous sites in the genome, we knew nothing of other Fab-7 proteins. Thus, we modified the sequence immediately adjacent to the Fab-7 boundary to include 14 binding sites for the Gal4 protein and flanked the Fab-7 boundary with loxP sites. Using this line, we were able to monitor longdistance chromatin interactions at various sites in the BX-C by monitoring DNA methylation levels away from the targeting site. As a control, we also performed experiments in the absence of Fab-7 to determine which interactions were Fab-7 dependent. Based on our results, we determined that the Fab-7 boundary element interacted with an area near the Abd-B promoter (>35 kb away) in tissues where Abd-B was not expressed. In areas where Abd-B was expressed, this interaction was absent. Thus, using DamID, we were able to determine a role for Fab-7 in long-distance chromatin interactions in vivo, and determine that this activity was regulated along the A-P axis of the fly [3]. One of the advantages of DamID as a method for probing long-distance interactions is its relative simplicity. If one follows the protocol described below, respecting the warnings mentioned in the text and footnotes, one can expect fairly reproducible results. The hardest part of DamID, and its most limiting element, is the creation of proper fly lines in which to do the experiments. While one can make Dam fusions to proteins that bind to a particular element of interest (for example to an insulator), we recommend, instead, spending the time to add heterologous binding sites near the element to be tested. We recommend this approach because of the controls it allows. First, one can remove the element while keeping the targeting sites to check for the specificity of the interactions. Second, one can use a chromosome without targeting sites, but expressing the same Dam fusion protein to characterize the nonspecific level of methylation with the fusion protein.
282
Fabienne Cléard et al.
Obviously, making these modifications to the genome is time consuming and challenging. But, with the advent of numerous new gene targeting methods, these difficulties are not as hard to overcome as in the past. Because of the experimental constraints of DamID, one must consider DamID in the context of other methods used to probe long-distance interactions. Even with the improvements and developments in other technologies such as 3C, 4C, 5C, and Chia-PET [8–12], DamID remains a powerful option to investigate long-distance chromatin interactions. Once again, its limitation is the fact that one needs to target Dam to a specific site in the genome. But, if this is possible, DamID has a number of positive advantages. First, although the quantitation is performed in vitro, it is monitoring marks that occurred in the living organism and does not suffer from artifacts stemming from fixation. Next, it requires very little materials to perform. Our non-genomic scale experiments were performed on DNA isolated from as little as three fly heads, which yielded enough DNA to be used for 40 experiments. Given that flies are small, and fly tissues even smaller, this can be a huge advantage. This advantage might even become more important if combined with tissue-specific expression of Dam fusion proteins. The creation of such tissue-specific forms of Dam has been problematic in the past because high-level expression of Dam (such as the levels one might expect from a UAScontrolled transgene) is lethal. This problem, however, has recently been overcome by the lab of Andrea Brand, who showed that low-level, tissue-specific expression of Dam can be achieved if Dam is made as the second coding sequence in a polycistronic transcript without an internal ribosome entry site under the control of a UAS promoter [13]. Thus, Dam can now be cell- or tissue-specifically expressed, precluding the requirement for tedious dissections. Given the low amount of tissue required to see signal, one might potentially be able to visualize interactions coming from only a small number of cells. The technique described here has been described previously in Cleard et al. [3]. It is a method to determine long-range interactions at selected GATC sites in the genome. As this method is relatively quick and easy to perform with standard molecular biology lab equipment, it is a protocol that should be usable by a wide variety of scientists. If a more genomic approach is required, please refer to Van Steensel et al. [2].
2
Materials 1. Standard cornmeal-agar fly growth media. 2. Fly stocks carrying a Dam fusion protein (with targeting sites inserted near the genomic elements to study if the fusion protein does not possess native targeting sites in the genome;
Finding Long Distance Chromatin with DamID
283
that is, for Gal-Dam fusions one must have UAS targeting sites in the genome near the element to be investigated). Control flies expressing the Dam fusion protein without targeting sites in the genome, or flies expressing Dam not fused to a DNA bind domain for background methylation controls. As DamID requires target sites in the genome for a Dam fusion protein, this review assumes the availability of a Dam fusion protein to a DNA-binding protein with binding sites near the element being studied. These can be Dam fusions to a DNA-binding protein that normally binds the element in question, or, as in our case, a Dam fusion to the Gal4 DNA-binding domain (Gal4DBD) whose binding sites (UAS) have been added next to an element of interest [1]. 3. A quantitative PCR apparatus like an ABI Prism SDS 7900 HT system. 4. 2× Power SYBR Green Master Mix (Applied Biosystems). 5. Applied Biosystems Primer Express Software package (Applied Biosystems). 6. Control primers designed to amplify a genomic region lacking Dam methylation sites (GATC) from the D. melanogaster Gapdh1-F gene (Dm Gapdh1-F) and from the D. melanogaster EF1g-F gene (DmEF1g-F) to be used to standardize the input DNA concentrations for each reaction. Dm Gapdh1-F: ATTTCGCTGAACGATAAGTTCGT (Tm=61.3 °C). Dm Gapdh1-R: CGATGACGCGGTTGGAGTA (Tm = 63.1 °C). Dm EF1g-F: GTGTTCATGTCGTGCAATCTCA (Tm = 62.1 °C). Dm EF1g-R: CGCCTTGCGCATCTTGT (Tm = 62.1 °C). 7. Control primers designed to amplify a region of the genome containing a Dam methyltransferase site (GATC). These primers are used to determine the background level of methylation at a location not targeted by the Dam fusion protein. We use the following primers to amplify a region from the TBP gene: TBP-74 F: CAAAGGTGCGGCAGGAGAT (Tm = 63.6 °C). TBP-155R: CCTATTTATGACTGCTTCTTGAACTTCTT (Tm = 61.7 °C). 8. Fly homogenization buffer: 10 mM Tris-HCl pH 7.5, 10 mM EDTA, 100 mM NaCl, 0.5 % SDS, 100 μg/ml Proteinase K (diluted freshly from 20 mg/ml stock). 9. Restriction enzyme DpnII.
3
Methods
3.1 Fly Growth Conditions
All flies were raised on a standard cornmeal-agar food mixture and grown at room temperature (22 ºC). Higher growing
284
Fabienne Cléard et al.
temperatures are to be avoided due to the toxicity of Dam overexpression (see Note 1). 3.2 Genomic DNA Preparation from Whole Flies
This protocol is modeled after the protocol of Van Steensel and Henikoff [1]. 1. Six adult flies per genotype to be tested (not forgetting the nontargeted control) (see Note 2) are placed individually in PCR tubes. 2. Standard micropipette tips containing 100 μl of fly homogenization buffer are used to crush the flies without expelling the held liquid. After the fly is sufficiently crushed, the held liquid should be expelled onto the fly remains. 3. Tubes are placed at 50 ºC for 3 h. 4. Fly extracts are then phenol/chloroform and then chloroform extracted, retaining the aqueous phase (see Note 3).
3.3 DpnII Digestion of Genomic DNA
1. For each genomic DNA extraction, set up the following two reactions: Incubate reactions overnight at 37 ºC. DpnII(−) Control 5 μl Genomic DNA 2 μl DpnII buffer (NEB) 13 μl H2O 20 μl Total volume DpnII digest 5 μl Genomic DNA 2 μl DpnII buffer (NEB) 0.2 DpnII (2 units) 12.8 μl H2O 20 μl Total volume
2. Heat inactivate at 80 ºC for 10 min. 3. DNA quality can be assessed using standard fly PCR reactions using the control primers, which are centered on regions containing no GATC (DpnII) sites (the GAPDH and EF1G primers). 3.4 DNA Preparation and Digestion from Dissected Fly Parts
Genomic DNA was isolated from dissected fly parts using a similar protocol to that used for whole flies. The only modifications to this protocol were the following: 1. Three adult heads or three adult abdomens were pooled and used as sources for the genomic DNA.
Finding Long Distance Chromatin with DamID
285
2. DpnII digestions were performed with or without 2 units of DpnII enzyme in a reaction volume of 25 μl. 3.5 Selection of Oligonucleotides for Q-PCR
Oligonucleotides were selected using the default parameters of the Primer Express v. 2.0 software from Applied Biosystems, centered on single DpnII cut sites in the area being examined. In general, primers are designed to have melting temperatures in the range of 61–64 ºC and product lengths of
