Transboundary and Emerging Diseases

ORIGINAL ARTICLE

Cytokine Expression at Different Stages of Influenza A(H1N1) pdm09 Virus Infection in the Porcine Lung, Using Laser Capture Microdissection D. J. Hicks1, M. Kelly2, S. M. Brookes2, B. Z. Londt2, A. Ortiz Pelaez3, A. Orlowska1, I. H. Brown2, ~ ez1
n Y. I. Spencer1 and A. Nu 1 2 3

Pathology Department, Animal Health and Veterinary Laboratories Agency (AHVLA), New Haw, Addlestone, Surrey, UK Virology Department, Animal Health and Veterinary Laboratories Agency (AHVLA), New Haw, Addlestone, Surrey, UK Centre for Epidemiology and Risk Analysis, Animal Health and Veterinary Laboratories Agency (AHVLA), New Haw, Addlestone, Surrey, UK

Keywords: influenza A; pandemic H1N1; laser capture microdissection; pig; cytokines Correspondence: ~ez. Pathology Department, Animal
n A. Nu Health and Veterinary Laboratories Agency (AHVLA), New Haw, Addlestone KT15 3NB, UK. Tel.: +44 (0) 1932 357 550; Fax: +44 (0) 1932 357 217; E-mail: [email protected] Received for publication December 18, 2013 doi:10.1111/tbed.12232

Summary Pandemic influenza A(H1N1)pdm09 virus has retained its ability to infect swine whilst developing the ability to transmit effectively between humans, thus making the pig a valuable model for studying disease pathogenesis in both species. Lung lesions in pigs caused by infection with influenza A viruses vary in both their severity and distribution with individual lung lobes exhibiting lesions at different stages of infection pathogenic development and disease resolution. Consequently, investigating interactions between the virus and host and their implications for disease pathogenesis can be complicated. Studies were undertaken to investigate the discrete expression of pro- and anti-inflammatory mediators during lung lesion formation in pigs during infection with influenza A(H1N1)pdm09 (A/Hamburg/05/ 09) virus. Laser capture microdissection was used to identify and select lung lobules containing lesions at different stages of development. Dissected samples were analysed using quantitative RT-PCR to assess pro- and anti-inflammatory cytokine mRNA transcripts. Differential expression of the immune mediators IL8, IL-10 and IFN-c was observed depending upon the lesion stage assessed. Upregulation of IFN-c, IL-8 and IL-10 mRNA was observed in stage 2 lesions, whereas decreased mRNA expression was observed in stage 3 lesions, with IL-8 actively downregulated when compared with controls in both stage 3 and stage 4 lesions. This study highlighted the value of using laser capture microdissection to isolate specific tissue regions and investigate subtle differences in cytokine mRNA expression during lesion development in pigs infected with influenza A(H1N1)pdm09.

Introduction The emergence of a novel influenza A virus, A(H1N1) pdm09, exhibiting human, swine and avian genetic characteristics in 2009 demonstrated the potential of pigs to act as mixing vessels for influenza A virus reassortment (Webster et al., 1992; Olsen et al., 2006; Smith et al., 2009). Due to the similarity in clinical signs, pathology and immune response to influenza A(H1N1)pdm09 infection in both pigs and humans, the pig represents a useful model for investigating infection in reservoir and zoonotic host

species (Brookes et al., 2009; Peiris et al., 2009; Kuiken et al., 2010). Experimental infection of piglets using various avian and mammalian influenza A viruses has shown that the severity of disease and extent of lesions is not necessarily linked to the origin of the virus species or the host (Kuiken et al., 2012). Variations in disease severity and pathology indicate that host and pathogen factors affect the ability of the host to respond and resolve influenza A infection. A number of pro-inflammatory mediators including interferon (IFN)-a and c, tumour necrosis factor (TNF)-a, interleukin (IL)-1

© 2014 Crown copyright • Transboundary and Emerging Diseases. This article is published with the permission of the Controller of HMSO and Animal Health and Veterinary Laboratories Agency.

1

Cytokines in Pig Influenza Lesions

and interleukin (IL)-6 have been postulated to modulate the immune response to influenza infection in pigs (Van Reeth et al., 1999, 2002a,b). IFN-a, IFN-c and TNF-a have been shown to play a role in controlling viral replication and providing an anti-viral effect in mouse (in vitro and in vivo), human (in vitro) and porcine (in vivo) models (Seo and Webster, 2002; Szretter et al., 2009; Osterlund et al., 2010; Barb
e et al., 2011). Interleukin (IL)-8 is a chemoattractant belonging to the CXC chemokine subgroup primarily involved in neutrophil recruitment during inflammation (Hoffmann et al., 2002). The gene coding for IL-8 is one of the several genes thought to be antagonized by the NS1 protein of the influenza A virus (FernandezSesma et al., 2006). Interleukin-17a is a potent proinflammatory cytokine secreted by a subset of CD4 T cells that stimulates the production of other pro-inflammatory mediators including nitric oxide and chemokines by macrophages during inflammation (Lee, 2013). Upregulation and production of these cytokines, following infection by different influenza A subtypes in bronchioles, may be responsible for the different pathological outcomes of the disease. This variability between influenza A viruses is supported by the diverse ability of influenza A strains and subtypes to induce or suppress interferon responses (Hayman et al., 2007), and to escape the host anti-viral cytokine response (Seo et al., 2002). A frequent finding of influenza infection in the porcine lung is the simultaneous presence in affected pulmonary lobes of individual lobules showing lesions at different stages of infection and pathogenic development (Brookes et al., 2009, 2010). However, determination of cytokine expression changes is usually performed in alveolar lavage (Kim et al., 2009), in homogenized pulmonary tissues (Li et al., 2011) or primary cells (Lam et al., 2013; Muss
a et al., 2013), which cannot differentiate between the stage of lesion development and may obscure opposite regulatory changes during the course of disease. To counteract this, laser capture microdissection (LCMD) can be used for the identification, selection and dissection of target regions (e.g. cell populations or lesions) from tissue sections (Heinm€ oller et al., 2002; Elvers et al., 2005). LCMD thus allows analysis to be performed on the regions of interest in isolation from the tissue as a whole. In this study, changes in pro- and anti-inflammatory mediator mRNA expression during lesion progression following A(H1N1) pdm09 infection were assessed in porcine lung samples using LCMD. Materials and Methods Animals and viruses All animal work was performed in accordance with the rules and procedures of the AHVLA committee for

2

D. J. Hicks et al.

ethical studies, the UK 1986 Animal Scientific Procedure Act and the AHVLA code of practice for performing scientific studies using animals (Project licence number 70/ 7062) in appropriate biological containment level facilities. Six-week-old Landrace hybrid pigs sourced from a high health status herd were shown to be influenza A virus negative by both the haemagglutination test and by matrix (M) gene real-time RT-PCR prior to the study. The challenge group (n = 12) were inoculated with an influenza A (H1N1)pdm09 isolate: A/Hamburg/05/09 at a final dose of 5.8 logs (TCID50) using a mucosal atomization device (MAD R Nasal; Wolfe Tory Medical, Inc, Salt Lake City, UT, USA) via the intranasal (IN) route. The virus stock (of human origin and cultured as previously described by Liu et al., 2010) was kindly donated by Dr. Mikhail Matrosovich, Philipps University, Germany. The control group animals (n = 2) were mock-infected via the same route using cell culture supernatant diluted in PBS as per the virus inoculum. Challenged animals were killed humanely in pairs at 1, 2, 3, 4, 5 and 8 days post-infection (dpi) by intravenous administration of barbiturates. Mock-infected animals were killed at 1 and 3 dpi. Sample processing and immunohistochemistry Samples from the cranial and middle lung lobes were collected post-mortem from all animals and trimmed to a maximum thickness of 0.5 cm. After embedding in cryomolds containing Tissue-TEKâ O.C.TTM compound (Sakura Finetek UK Ltd, Thatcham, UK), the samples were snap frozen, by immersion in cooled isopentane (VWR International, Leicestershire, UK) held on Cardiceâ (Air Liquide UK Limited, Wolverhampton, West Midlands, UK), before storage at
80°C. Serial tissue sections 10 lm thick were cut in containment from the snap frozen samples using a Leica 1800 cryostat and placed onto either charged glass slides (VWR International) for immunohistochemistry or 2.0 lm membrane slides (PENMembrane; Leica Microsystems, Milton Keyes, UK) for LCMD (three sections per PEN-membrane slide). Slides were immersed in 70% ethanol (15 min), dehydrated in 100% ethanol (3 min) and air-dried (10 min) before storage at
80°C. An adapted immunohistochemistry technique based upon a published protocol (L€ ondt et al., 2013) was used for the detection of influenza A viral antigen in cryosections. Briefly, frozen sections were removed from
80°C storage and immersed in pre-cooled (
20°C) acetone (VWR International) for 5 min, rinsed in Tris-buffered saline with 0.05% Tween (TBST, 0.85% NaCl, pH 7.6) for 5 min before endogenous peroxidase activity was quenched using 3% H202 (VWR International)/distilled water solu-

© 2014 Crown copyright • Transboundary and Emerging Diseases. This article is published with the permission of the Controller of HMSO and Animal Health and Veterinary Laboratories Agency.

D. J. Hicks et al.

Cytokines in Pig Influenza Lesions

tion for 15 min. After rinsing in distilled water (5 min), the anti-influenza A nucleoprotein (1/4000 dilution in TBST; Statens Serum Institut, Copenhagen, Denmark) monoclonal antibody was applied to the sections for 60 min at room temperature. Detection, amplification and visualization of specific influenza nucleoprotein antigen binding by the primary antibody were undertaken as described by Brookes et al. (2009). Laser capture microdissection For LCMD, PEN-membrane slides were defrosted at room temperature for 1 min, dehydrated in 100% ethanol for 2 min, counterstained using Mayer’s haematoxylin (Surgipath, Peterborough, UK) for 3 min and ‘blued’ in DEPC (VWR International)-treated distilled water for 3 min. The slides were then dehydrated in 100% ethanol for 2 min and air-dried for 10 min, before being transferred to the LCMD microscope (LMD6500; Leica Microsystems) for sample microdissection. Pulmonary lobules were classified in four different stages of infection based on the pathogenesis of influenza infection using histopathological changes and viral antigen detection (Table 1, Fig. 1). Stage I or lesions of early infection consisted of lobules containing bronchioles with epithelial cell labelling without significant inflammatory cell infiltration. Stage II or early inflammation grouped lobules contained immunopositive bronchioles, with peribronchial and bronchiolar inflammatory changes, but lacked alveolar infiltration. In stage III or consolidation, lobules displayed infected cells (bronchiole epithelium, alveolar macrophages and pneumocytes) and loss of identifiable alveolar spaces due to inflammation and atelectasis. Finally, in stage IV or recovery, bronchial, bronchiolar and alveolar spaces were clear of exudation, but alveolar septa remained thickened, and/or prominent bronchus-associated lymphoid tissue Table 1. Histopathological criteria followed for the classification of pulmonary lesions in different pathogenic stages Stage

Lesion

Description

I

Early infection

Lobules containing immunopositive bronchioles without associated inflammatory infiltration Lobule containing immunopositive bronchioles, with peribronchial and bronchiolar infiltration, but without alveolar infiltration and consolidation Lobules totally or partially consolidated, presence of immunopositive cells, no alveolar spaces identifiable Recovering tissue, presence of BALT tissue, thickening of alveolar septa. No virus detected by IHC

II

Early inflammation

III

Consolidation

IV

Recovery

(BALT) was present, but specific immunolabelling for influenza virus was absent. Using inter-lobular septa as defined limits for target area, all lobules from the slide (three tissue sections repeats per slide) exhibiting any of the representative stages (Table 1) of influenza pathogenesis were selected for analysis using the Leica LMD6500 (Leica) system (910 magnification, Laser Microdissection 6000 software version 6.7.0.3754). Due to the variable presentation of lobules at the different stages in the time points (dpi) collected, stage I samples were collected from animals killed at 1 and 4 dpi (n = 3), stage II from 2, 3 and 4 dpi (n = 4), stage III from 2 and 3 dpi (n = 3) and stage IV from 5 and 8 dpi (n = 3). Negative control lobules were microdissected from mockinfected animals (n = 2). Dissected areas from different stages were collected separately for each individual animal into RNAse-free 1.5 ml PCR tubes, for minimum of 15 lobules per animal per stage. RNA was extracted using the RNAqueousâ-Micro Kit (Ambionâ; Life Technologies Ltd, Paisley, UK), following manufacturer’s instructions. RNA extracts were stored at
80°C until required. Porcine cytokine RT-PCR Relative mRNA expression levels of IFN-c, IL-8, IL-10, IL17a and the housekeeping gene glyceraldehyde-3 phosphate dehydrogenase (G3PDH) at each of the four pathogenic stages were assessed by real-time PCR using a Stratagene MX3000P real-time platform. The reaction buffer was based upon the Qiagen OneStep RT-PCR Kit (Qiagen, UK) supplemented with 4U RNase inhibitor, RNasin (Promega, Southampton, UK), 25 mM MgCl2 (Promega), 1 mM ROX Reference dye (Stratagene, UK), 2 lM of forward and reverse primers (Table 2) and 1.2 lM probe. The following thermal cycle was used for all reactions: 30 m at 50°C, 15 m at 95°C and 45 cycles of 10 s at 94°C, 20 s at 56°C, and 10 s at 72°C. Fluorescence data were interpreted using MxPro QPCR software, normalized using G3PDH, and was analysed analysis using Microsoft Excel 2007. Statistical analysis To enable comparison, the cytokine Ct values were normalized using the normalization equation ‘delta Ct’; R = 2 to the power of [Cytokine Ct – GAP Ct] for each of the four pathogenesis stages (Pfaffl, 2006). Fold increases or decreases in cytokine mRNA expression were then calculated by dividing the normalized pathogenesis stage mean value by the mean mock-infected control value. The data set was analysed using the t-test on the equality of the means, which compared the mean value of each stage with the mean of the control within each cytokine. P values ≤0.05 were considered significant.

© 2014 Crown copyright • Transboundary and Emerging Diseases. This article is published with the permission of the Controller of HMSO and Animal Health and Veterinary Laboratories Agency.

3

Cytokines in Pig Influenza Lesions

D. J. Hicks et al.

(a)

(b)

(c)

(d)

Fig. 1. Representative micrographs of immunolabelling for influenza A virus nucleoprotein and histopathological changes in the lungs of pigs infected with influenza A(H1N1) pdm09 virus. (a) Stage I – early infection: intense immunolabelling of the bronchiole epithelium with minimal peribronchial infiltration, (b) Stage II – early inflammation: immunopositive bronchioles and bronchiolar exudate, peribronchial infiltration and thickening of alveolar septa. (c) Stage III – consolidation: partial or total consolidation of the lobe with the loss of identifiable alveolar spaces, occupied by leucocytes or atelectatic and immunopositive labelling in bronchiole epithelium, alveolar macrophages and (d) Stage IV – recovery: alveolar septa remain thickened with a proliferation of bronchiole-associated lymphoid tissue, but no virus was detectable by IHC (original magnification a: 9100, b: 950, c: 950 and d: 9100).

Table 2. Primer sequences used for RT-PCR mRNA Transcript

Forward 50 ?30 Primer Sequence

Reverse 50 ?30 Primer Sequence

Probe 50 ?30 Sequence

IFNc IL-8 IL-10 IL-17A G3PDH

TTCAGCTTTGCGTGACTTTG AGCTGGAAATCCTGTTTTGG TCATCAATTTCTGCCCTGTG CATGAACTCTGTCCCCATCC GTTCCACGGCACAGTCAAG

AAGAAAAGAGGTCCACCATTAGG TGAGGTGCAGTTGAGCAGAG GGCTTTGTAGACACCCCTCTC AGCCCACTGTCACCATCACT CATGGTCGTGAAGACACCCAG

[TEXAS RED]-GCTCTTACTGCCAGGCGCCC-[BHQ2] [6FAM]-CCCTAGGCTGCTGGCCAGCA-[BHQ1] [TEXAS RED]-GCAAGGCCGTGGAGGAGGTG-[BHQ2] [6FAM]-GGAAGGGAGCCTGCGCACTG-[BHQ1] [6FAM]-CGGAGAACGGGAAGCTTGTCA-[BHQ1]

Primer sequences for IFNc, IL-8, IL-10, IL-17A and the housekeeping gene G3PDH were kindly provided by Phillipa Lait, Bristol University. All primers and probes were synthesized by Sigma-Aldrich (Gillingham, Dorset, UK) and purified by HPLC.

Results Pathology and virus distribution by immunohistochemistry All challenged animals exhibited gross pulmonary lung lesions of variable extension in the cranial and middle lung lobes consistent with influenza virus infection. Histologically, animals presented with a minimal to severe lymphohistiocytic bronchointerstitial pneumonia, mild to moderate acute to necrotizing bronchitis and bronchiolitis and acute alveolitis. The distribution of lesions followed a lobular pattern with affected lobules next to unaffected pulmonary lobules Immunolabelling of viral nucleoprotein was observed primarily in the epithelial cells of bronchi and

4

bronchioles and the bronchial and bronchiolar exudates and rarely presented in pneumocytes and alveolar macrophages throughout infection (Fig. 1). Stage I lesions were present mainly at 1 dpi, and less frequently at later time points, whereas stage II and III were common between 2 and 5 dpi. Stage IV lesions were only identified at 5 and 8 dpi. Differential regulation of inflammatory mediator mRNA expression Lung lobules containing lesions representative of the four identified pathogenic steps, as defined in Table 1, were selected and excised from frozen tissue sections using LCMD. After RNA extraction, the fold change in

© 2014 Crown copyright • Transboundary and Emerging Diseases. This article is published with the permission of the Controller of HMSO and Animal Health and Veterinary Laboratories Agency.

D. J. Hicks et al.

Cytokines in Pig Influenza Lesions

inflammatory mRNA expression over the normalized mean values obtained from mock-infected control material was assessed using qRT-PCR. Cytokine mRNA expression (average normalized Ct values) at different stages of infection is displayed in Fig. 2. A 4-fold increase in IFN-c mRNA expression, albeit not a significant increase, was observed in stage I (early infection) lesions when compared with the mock-infected control. However, a significant (P < 0.05) 16-fold increase in IFN-c mRNA expression was observed in the stage II (early inflammation) lesions. No distinctive up- or downregulation of IFN-c was observed in either stage III (consolidation) or stage IV (recovery) lesions during influenza A(H1N1) pdm09 disease pathogenesis (2a). Similarly, the small increase in IL-8 mRNA expression detected in stage I lesions was followed by significant IL-8 mRNA upregulation (1.7fold increase) in stage II lesions. IL-8 mRNA production was significantly downregulated with lesion progression, a 20-fold decrease in expression was observed in stage III lesions, and a 2-fold decrease detected in stage IV lesions when compared with mock-infected controls (2b). Upregulation of IL-10 mRNA expression was restricted to stage II lesions during influenza A(H1N1)pdm09 virus infection where a 3-fold increase in expression levels was observed. No distinctive up- or downregulation of IL-10 mRNA expression was observed during the earlier or later lesion stages (2c). IL-17a mRNA expression was not significantly different to the mock-infected control at any of the four stages of lesion development (2d).

Discussion Laser capture microdissection was used successfully in this study to identify and select lung lobules representing four different stages of influenza A virus-associated lesion development, as classified by histopathology. As with previous studies (Aranday-Cortes et al., 2012), the use of LCMD enabled subtle differences in cytokine regulation to be observed during lesion development that would not have been possible using whole tissues (Fend and Raffeld, 2000). However, the authors found this method time-consuming and yielded small amounts of RNA restricting the number of analyses possible and therefore may not be cost-effective for large throughput studies. Dissected samples were analysed using quantitative RTPCR, which demonstrated clear differences in the regulation of pro- and anti-inflammatory mRNA transcripts at different stages of lesion development. We observed a clear distinction between cytokine mRNA regulation in stage II and III lesions in this study. Upregulation of IFN-c, IL-8 and IL-10 mRNA was observed in stage II lesions, whereas decreased mRNA expression was observed in stage III lesions, with IL-8 actively downregulated when compared with controls. IL-17 mRNA expression was not observed to be different from the negative control material in either stage II or stage III lesions. This highlights the principle benefit of using LCMD for this type of investigation. Stage II and stage III lesions are commonly distributed together and therefore collected together. Consequently, the subtle differences in regulation observed in this study would be

(a)

(b)

(c)

(d)

Fig. 2. Regulation of interferon-gamma (a), interleukin-8 (b), interleukin-10 (c) and interleukin-17a (d) cytokine mRNA expression (average normalized Ct values + standard deviation) by lesion stage in samples LCMD from porcine lung after infection with influenza A(H1N1) pdm09 virus. *Significantly different to mock-infected controls (P < 0.05).

© 2014 Crown copyright • Transboundary and Emerging Diseases. This article is published with the permission of the Controller of HMSO and Animal Health and Veterinary Laboratories Agency.

5

Cytokines in Pig Influenza Lesions

lost if whole tissue homogenates, which comprise of multiple lesions at varying stages of development, were assessed. In this study, the specific selection of disease-associated lesions has enabled us to demonstrate a distinct upregulation in IFN-c mRNA during the early inflammatory stage (Stage II) similar to that described by Barb
e et al. (2011) where lung tissue homogenates were used as the basis for analysis. A previous study has reported that no significant increase in IFN-c mRNA expression was demonstrable from lung lavages samples taken from pigs experimentally infected with this influenza A(H1N1)pdm09 virus (H. For~ez, W. berg, A. Hauge, M. Valheim, F. Garcon, A. N
un Gerner, K. Mair, S. Graham, S. Brookes, and A. Storset, unpublished data). The discrepancy in IFN-c regulation between the studies may reflect the difference in source sample (i.e. tissue or lung lavage) used for analysis. IFN-c has been associated with lymphocyte infiltration (Taylor et al., 1989) and the activation of infected alveolar macrophages (Hennet et al., 1992), however, due to its upregulation later in the pathogenesis of infection when compared with type I interferons (Van Reeth et al., 2002b), evidence for a key role in the mediation or control of infection is scarce. The non-structural 1 (NS1) protein of the influenza A virus is a multifunctional protein that has been shown to inhibit the host innate immune response through active antagonism of the RIG-1 pathogen sensing type I interferon pathway (Ludwig et al., 2002; Mibayashi et al., 2007). NS1 can also disrupt gene expression by de-stabilizing mRNA nuclear export machinery (Satterly et al., 2007) and inhibiting host mRNA polyadenylation (Nemeroff et al., 1998) causing nuclear retention of the mRNA (Krug et al., 2003). Consequently, a similar form of transcription antagonism and the infancy of the host response could account for the lack of IFN-c expression in the early stage of lesion development. Whereas a transient infection and a marginalized role in disease pathogenesis could explain the lack of IFN-c mRNA expression observed in this study at the more advanced lesion stages. IL-8, a potent chemoattractant (Adachi et al., 1997; Sarmento et al., 2008), was the most actively regulated cytokine in this study. Unlike in previous reports (Choi and Jacoby, 1992; Adachi et al., 1997), a significant increase in IL-8 mRNA expression was not observed at the earliest stage of lesion development in this study. This may reflect the global effects of NS1 on the host response (Nemeroff et al., 1998; Krug et al., 2003; Satterly et al., 2007) or could reflect inherent differences in the pathogenic properties of influenza A(H1N1)pdm09 virus and the viruses previously studied (Choi and Jacoby 1992), factors which have been reported to have a significant effect on IL-8 mRNA transcription levels after infection with other influenza A viruses (Sarmento et al., 2008). The greatest fold increase in IL-8 mRNA expression was associated with stage II

6

D. J. Hicks et al.

lesions (early inflammation), suggesting that this stage in lesion development is the point at which cellular recruitment is considerably upregulated. Increased IL-8 mRNA expression level and extensive lung pathology, particularly pneumonia, has been previously reported in primate (Baskin et al., 2009), avian (Hayashi et al., 2011) and mammalian (Perrone et al., 2008; Peiris et al., 2009) studies investigating highly pathogenic avian influenza virus strains. However, in this study, stage III lesions (consolidation) and stage IV lesions (recovery) both exhibited a significant downregulation in IL-8 mRNA expression. This discrepancy may reflect the sampling and analysis of stage II and stage III lesions together in a homogenate in previous studies rather than the separate LCMD defined analysis used in this study, which appears to identify the true point of IL-8 upregulation. Alternatively, the increased number of cells observed in stage III lesions are more likely to be responding to IL-8 rather than producing it, which could cause a dilution effect in the subsequent analysis. The downregulation of IL-8 in stage IV lesions most likely indicates the control of the influenza A(H1N1)pdm09 virus infection negating the requirement for further active cellular recruitment and the detrimental effects that could have. Regulatory anti-inflammatory cytokines are produced to curb pro-inflammatory responses to pathogenic insult or tissue damage, thereby preventing excessive injury. Interleukin 10 (IL-10) performs such a role, principally through manipulation of macrophage cytokine production and their T-cell accessory functions (Abbas et al., 1994; Sun et al., 2009). Due to the significance of IL-10 to the host response, changes in or the failure of IL-10 regulation can have detrimental consequences for the host (Sun et al., 2010). In this study, control over the inflammatory response begins to be exerted during stage II lesions where the IL-8 cellular recruitment signal peaks and the cellular produced IFN-c is also increased. The absence of IL-10 mRNA expression in later lesion stages could indicate that the influenza A(H1N1)pdm09 virus infection is controlled fairly quickly in a porcine model of influenza. This is not the case in other infection models where highly virulent viruses (H5N1 and 1918 pandemic influenza) trigger a response where IL-10 regulation of inflammation fails, leading to extensive cellular infiltration of the infected lungs and excessive pro-inflammatory cytokine production or ‘cytokine storm’ (De Jong et al., 2006; Kobasa et al., 2007; Sun et al., 2009). Interleukin-17a (IL-17a) has previously been associated with a key role in acute lung injury after infection with influenza A(H1N1)pdm09 virus, features that were ameliorated in a murine infection model using IL-17 deficient mice or anti-IL-17 monoclonal antibody treatment (Li et al., 2012). This inflammatory mediator recruits neutrophils, which are believed to contribute to the control

© 2014 Crown copyright • Transboundary and Emerging Diseases. This article is published with the permission of the Controller of HMSO and Animal Health and Veterinary Laboratories Agency.

D. J. Hicks et al.

and clearance of influenza virus in infection models (Fujisawa, 2008; Tate et al., 2008) but can also cause acute tissue injury through the secretion of myeloperoxidase (Crowe et al., 2009). Active regulation of IL-17a was not observed in any of the lesion stages assessed in our LCMD study. This could indicate that IL-17a is not critical for the mediation of neutrophil recruitment in this pig model of influenza A(H1N1)pdm09 virus infection, potentially due to the high IL-8 mRNA expression levels observed. Cytokine expression during influenza virus infection of pigs in vivo is bisected broadly into ‘early’ cytokine responses, including IFN-a/b, IL-1 and IL-6, and ‘late’ cytokine responses, including IFN-c, IL-10 and IL17a (Van Reeth, 2000; Van Reeth and Nauwynck, 2000; Van Reeth et al., 2002b). However, there is considerable overlap as different stages of lesion development are present in the same lung samples. Consequently, subtle changes present at different stages of lesion development after influenza A virus infection may be masked due to the selection limitations of lung lavages and tissue homogenization (Fend and Raffeld, 2000; Van Reeth et al., 2002b). This study demonstrates the potential benefits of using LCMD to provide a more accurate assessment of the host response to influenza A virus infection [such as A(H1N1)pdm09], thus improving our understanding of the interactions between the influenza A virus and the pig host, which, due to the similarities in presentation, pathology and host response (Brookes et al., 2009; Barb
e et al., 2011; Meurens et al., 2012), may help our understanding of disease pathogenesis in humans infected with influenza A(H1N1)pdm09 virus. Acknowledgements We would like to thank Fanny Garcon, Ruth CorderoPeters, Vivian Coward, the Histopathology team and the animal services unit for their technical support and assistance during this study. The authors would also like to thank Dr. Mikhail Matrosovich (Institute of Virology, Philipps University, Hans-Meerwein-Str. 2, D-35043 Marburg, Germany as part of the Flupig project EU FP7 #258084) for kindly providing the A/Hamburg/05/09 H1N1/09pdm influenza virus isolate used in this study. The research was supported by the AHVLA Research and Development Internal Investment fund (RD0035) and Flupig – European Union FP7 project #258084. References Abbas, A., A. Lichtman, and J. Pober, 1994: Cellular and Molecular Immunology, 2nd edn. W.B. Saunders Company, Philadelphia. Adachi, M., S. Matsukura, H. Tokunaga, and F. Kokubu, 1997: Expression of cytokines on human bronchial epithelial cells

Cytokines in Pig Influenza Lesions

induced by influenza virus A. Int. Arch. Allergy Immunol. 113, 307–311. Aranday-Cortes, E., N. C. Bull, B. Villarreal-Ramos, J. Gough, D. Hicks, A. Ortiz-Pel
aez, H. M. Vordermeier, and F. J. Salguero, 2012: Upregulation of IL-17A, CXCL9 and CXCL10 in early-stage granulomas induced by Mycobacterium bovis in Cattle. Transbound. Emerg. Dis. 2012, 60, 525–537. Barb
e, F., K. Atanasova, and K. Van Reeth, 2011: Cytokines and acute phase proteins associated with acute swine influenza infection in pigs. Vet. J. 187, 48–53. Baskin, C. R., H. Bielefeldt-Ohmann, T. M. Tumpey, P. J. Sabourin, and J. P. Long, 2009: Early and sustained innate immune response defines pathology and death in nonhuman primates infected by highly pathogenic influenza virus. Proc. Natl Acad. Sci. USA 106, 3455–3460. Brookes, S. M., R. M. Irvine, A. Nunez, D. Clifford, S. Essen, I. H. Brown, K. Van Reeth, G. Kuntz-Simon, W. Loeffen, E. Foni, L. Larsen, M. Matrosovich, M. Bublot, J. Maldonado, M. Beer, and G. Cattoli, 2009: Influenza A (H1N1) infection in pigs. Vet. R. 164, 760–761. ~ez, B. Choudhury, M. Matrosovich, S. C. Brookes, S. M., A. N
un Essen, D. Clifford, M. J. Slomka, G. Kuntz-Simon, F. Garcon, B. Nash, A. Hanna, P. M. Heegaard, S. Qu
eguiner, C. Chiapponi, M. Bublot, J. M. Garcia, R. Gardner, E. Foni, W. Loeffen, L. Larsen, K. Van Reeth, J. Banks, R. M. Irvine, and I. H. Brown, 2010: Replication, pathogenesis and transmission of pandemic (H1N1) 2009 virus in non-immune pigs. PLoS One 5, 9. Choi, A. M., and D. B. Jacoby, 1992: Influenza virus A infection induces interleukin-8 gene expression in human airway epithelial cells. FEBS Lett. 309, 327–329. Crowe, C. R., K. Chen, D. A. Pociask, J. F. Alcorn, C. Krivich, R. I. Enelow, T. M. Ross, J. L. Witztum, and J. K. Kolls, 2009: Critical role of IL-17RA in immunopathology of influenza infection. J. Immunol. 183, 5301–5310. De Jong, M. D., C. P. Simmons, T. T. Thanh, V. M. Hien, G. J. Smith, T. N. Chau, D. M. Hoang, N. V. Chau, T. H. Khanh, V. C. Dong, P. T. Qui, B. V. Cam, Q. Ha do, Y. Guan, J. S. Peiris, N. T. Chinh, T. T. Hien, and J. Farrar, 2006: Fatal outcome of human influenza A (H5N1) is associated with high viral load and hypercytokinemia. Nat. Med. 12, 1203–1207. Elvers, D., L. Remer, N. Arnold, and D. B€auerle, 2005: Laser microdissection of biological tissues: process optimization. App. Phys. A. 80, 55–59. Fend, F., and M. Raffeld, 2000: Laser capture microdissection in pathology. J. Clin. Pathol. 53, 666–672. Fernandez-Sesma, A., S. Marukian, B. J. Ebersole, D. Kaminski, M. S. Park, T. Yuen, S. C. Sealfon, A. Garc
ıa-Sastre, and T. M. Moran, 2006: Influenza virus evades innate and adaptive immunity via the NS1 protein. J. Virol. 80, 6295–6304. Fujisawa, H., 2008: Neutrophils play an essential role in cooperation with antibody in both protection against and recovery from pulmonary infection with influenza virus in mice. J. Virol. 82, 2772–2783. Hayashi, T., Y. Hiromoto, K. Chaichoune, T. Patchimasiri, W. Chakritbudsabong, N. Prayoonwong, N. Chaisilp, W.

© 2014 Crown copyright • Transboundary and Emerging Diseases. This article is published with the permission of the Controller of HMSO and Animal Health and Veterinary Laboratories Agency.

7

Cytokines in Pig Influenza Lesions

Wiriyarat, S. Parchariyanon, P. Ratanakorn, Y. Uchida, and T. Saito, 2011: Host cytokine responses of pigeons infected with highly pathogenic Thai avian influenza viruses of subtype H5N1 isolated from wild birds. PLoS One 6, e23103. Hayman, A., S. Comely, A. Lackenby, L. C. Hartgroves, S. Goodbourn, J. W. McCauley, and W. S. Barclay, 2007: NS1 proteins of avian influenza A viruses can act as antagonists of the human alpha/beta interferon response. J. Virol. 81, 2318– 2327. Heinm€ oller, E., G. Schlake, B. Renke, Q. Liu, K. A. Hill, S. S. Sommer, and R€ uschoff,, 2002: Microdissection and molecular analysis of single cells or small cell clusters in pathology and diagnosis – significance and challenges. Anal. Cell. Pathol. 24, 125–134. Hennet, T., H. J. Ziltener, K. Frei, and Peterhans,, 1992: A kinetic study of immune mediators in the lungs of mice infected with influenza A virus. J. Immunol. 149, 932–939. Hoffmann, E., O. Dittrich-Breiholz, H. Holtmann, and M. Kracht, 2002: Multiple control of interleukin-8 gene expression. J. Leukoc. Biol. 72, 847–855. Kim, B., K. K. Ahn, Y. Ha, Y. H. Lee, D. Kim, J. H. Lim, S. H. Kim, M. Y. Kim, K. D. Cho, B. H. Lee, and C. Chae, 2009: Association of tumor necrosis factor-alpha with fever and pulmonary lesion score in pigs experimentally infected with swine influenza virus subtype H1N2. J. Vet. Med. Sci. 71, 611–616. Kobasa, D., S. M. Jones, K. Shinya, J. C. Kash, J. Copps, H. Ebihara, Y. Hatta, J. H. Kim, P. Halfmann, M. Hatta, F. Feldmann, J. B. Alimonti, L. Fernando, Y. Li, M. G. Katze, H. Feldmann, and Y. Kawaoka, 2007: Aberrant innate immune response in lethal infection of macaques with the 1918 influenza virus. Nature 445, 319–323. Krug, R. M., W. Yuan, D. L. Noah, and A. G. Latham, 2003: Intracellular warfare between human influenza viruses and human cells: the roles of the viral NS1 protein. Virology 309, 181–189. Kuiken, T., J. van den Brand, D. van Riel, M. Pantin-Jackwood, and D. E. Swayne, 2010: Comparative pathology of select agent influenza A virus infections. Vet. Pathol. 47, 893–914. Kuiken, T., B. Riteau, R. A. Fouchier, and G. F. Rimmelzwaan, 2012: Pathogenesis of influenza virus infection: the good, the bad and the ugly. Curr. Opin. Virol. 2, 276–286. Lam, W. Y., A. C. Yeung, K. L. Ngai, M. S. Li, K. F. To, S. K. Tsui, and P. K. Chan, 2013: Effect of avian influenza A H5N1 infection on the expression of microRNA-141 in human respiratory epithelial cells. BMC Microbiol. 13, 104. doi:1186/ 1741-2180-13-04. Lee, Y., 2013: The role of interleukin-17 in bone metabolism and inflammatory skeletal diseases. BMB Rep. 46, 479–483. Li, Y., H. Zhou, Z. Wen, S. Wu, C. Huang, G. Jia, H. Chen, and M. Jin, 2011: Transcription analysis on response of swine lung to H1N1 swine influenza virus. BMC Genomics 12, 398. Li, C., P. Yang, Y. Sun, T. Li, C. Wang, Z. Wang, Z. Zou, Y. Yan, W. Wang, C. Wang, Z. Chen, L. Xing, C. Tang, X. Ju, F. Guo, J. Deng, Y. Zhao, P. Yang, J. Tang, H. Wang, Z. Zhao, Z. Yin, B. Cao, X. Wang, and C. Jiang, 2012: IL-17 response mediates

8

D. J. Hicks et al.

acute lung injury induced by the 2009 pandemic influenza A (H1N1) virus. Cell Res. 22, 528–538. Liu, Y., R. Childs, T. Matrosovich, S. Wharton, A. Palma, W. Chai, R. Daniels, V. Gregory, J. Uhlendorff, M. Kiso, H. Klenk, A. Hay, T. Feizi, and M. Matrosovich, 2010: Altered receptor specificity and cell tropism of D222G hemagglutinin mutants isolated from fatal cases of pandemic A(H1N1) 2009 influenza virus. J. Virol. 84, 12069–12074. ~ez, D. A. Stagg, ondt, B. Z., S. M. Brookes, B. J. Nash, A. N
un L€ and I. H. Brown, 2013: The infectivity of pandemic 2009 H1N1 and avian influenza viruses for pigs: an assessment by ex vivo respiratory tract organ culture. Influenza Other Respir. Viruses 7, 393–402. Ludwig, S., X. Wang, C. Ehrhardt, H. Zheng, N. Donelan, O. PLanz, S. Pleschka, A. Garcia-Sastre, G. Heins, and T. Wolff, 2002: The influenza A virus NS1 protein inhibits activation of Jun N-terminal kinase and AP-1 transcription factors. J. Virol. 76, 11166–11171. Meurens, F., A. Summerfield, H. Nauwynck, L. Saif, and V. Gerdts, 2012: The pig: a model for human infectious diseases. Trends Microbiol. 20, 50–57. Mibayashi, M., L. Mart
ınez-Sobrido, Y. M. Loo, W. B. C
ardenas, M. Jr Gale, and A. Garc
ıa-Sastre, 2007: Inhibition of retinoic acid-inducible gene I-mediated induction of beta interferon by the NS1 protein of influenza A virus. J. Virol. 81, 514–524. Muss
a, T., M. Ballester, E. Silva-Campa, M. Baratelli, N. Busquets, M. P. Lecours, J. Dominguez, M. Amadori, L. Fraile, J. Hern
andez, and M. Montoya, 2013: Swine, human or avian influenza viruses differentially activates porcine dendritic cells cytokine profile. Vet. Immunol. Immunopathol. 154, 25–35. Nemeroff, M. E., S. M. Barabino, Y. Li, W. Keller, and R. M. Krug, 1998: Influenza virus NS1 protein interacts with the cellular 30 kDa subunit of CPSF and inhibits 30 end formation of cellular pre-mRNAs. Mol. Cell 1, 991–1000. Olsen, C. W., I. H. Brown, B. C. Easterday, and K. Van Reeth, 2006: Swine influenza. In: Straw, B. E., J. J. Zimmerman, S. D’Allaire and D. J. Taylor (eds), Diseases of Swine, pp. 469– 482. Blackwell Publishing, Oxford. Osterlund, P., J. Pirhonen, N. Ikonen, E. Ronkko, M. Strengell, S. M. Makela, M. Broman, O. J. Hamming, R. Hartmann, T. Ziegler, and I. Julkunen, 2010: Pandemic H1N1 2009 influenza A virus induces weak cytokine responses in human macrophages and dendritic cells and is highly sensitive to the antiviral actions of interferons. J. Virol. 84, 1414–1422. Peiris, J. S., C. Y. Cheung, C. Y. Leung, and J. M. Nicholls, 2009: Innate immune responses to influenza A H5N1: friend or foe? Trends Immunol. 30, 574–584. Perrone, L. A., J. K. Plowden, A. Garc
ıa-Sastre, J. M. Katz, and T. M. Tumpey, 2008: H5N1 and 1918 pandemic influenza virus infection results in early and excessive infiltration of macrophages and neutrophils in the lungs of mice. PLoS Pathog. 4, e1000115. Pfaffl, M. W., 2006: Relative quantification. In: Dorak, T. M. (ed.), Real-Time PCR (Advanced Methods), 1st edn. pp. 63–82. Taylor and Francis Group, Abingdon, Oxford, UK.

© 2014 Crown copyright • Transboundary and Emerging Diseases. This article is published with the permission of the Controller of HMSO and Animal Health and Veterinary Laboratories Agency.

D. J. Hicks et al.

Sarmento, L., C. L. Afonso, C. Estevez, J. Wasilenko, and M. Pantin-Jackwood, 2008: Differential host gene expression in cells infected with highly pathogenic H5N1 avian influenza viruses. Vet. Immunol. Immunopathol. 123, 291–302. Satterly, N., P. L. Tsai, J. van Deursen, D. R. Nussenzveig, Y. Wang, P. A. Faria, A. Levay, D. E. Levy, and B. M. Fontoura, 2007: Influenza virus targets the mRNA export machinery and the nuclear pore complex. Proc. Natl Acad. Sci. USA 104, 1853–1858. Seo, S. H., and R. G. Webster, 2002: Tumor necrosis factor alpha exerts powerful anti-influenza virus effects in lung epithelial cells. J. Virol. 76, 1071–1076. Seo, S. H., E. Hoffmann, and R. G. Webster, 2002: Lethal H5N1 influenza viruses escape host anti-viral cytokine responses. Nat. Med. 8, 950–954. Smith, G. J., D. Vijaykrishna, J. Bahl, S. J. Lycett, M. Worobey, O. G. Pybus, S. K. Ma, C. L. Cheung, J. Raghwani, S. Bhatt, J. S. Peiris, Y. Guan, and A. Rambaut, 2009: Origins and evolutionary genomics of the 2009 swine-origin H1N1 influenza A pandemic. Nature 459, 1122–1125. Sun, J., R. Madan, C. L. Karp, and T. J. Braciale, 2009: Effector T cells control lung inflammation during acute influenza virus infection by producing IL-10. Nat. Med. 15, 277–284. Sun, K., L. Torres, and D. W. Metzger, 2010: A detrimental effect of interleukin-10 on protective pulmonary humoral immunity during primary influenza A virus infection. J. Virol. 84, 5007– 5014. Szretter, K. J., S. Gangappa, J. A. Belser, H. Zeng, H. Chen, Y. Matsuoka, S. Sambhara, D. E. Swayne, T. M. Tumpey, and J. M. Katz, 2009: Early control of H5N1 influenza virus

Cytokines in Pig Influenza Lesions

replication by the type I interferon response in mice. J. Virol. 83, 5825–5834. Tate, M. D., A. G. Brooks, and P. C. Reading, 2008: The role of neutrophils in the upper and lower respiratory tract during influenza virus infection of mice. Respir. Res. 9, 57. Taylor, P. M., A. Meager, and B. A. Askonas, 1989: Influenza virus-specific T cells lead to early interferon-gamma in lungs of infected hosts: development of a sensitive radioimmunoassay. J. Gen. Virol. 70, 975–978. Van Reeth, K., 2000: Cytokines in the pathogenesis of influenza. Vet. Microbiol. 74, 109–116. Van Reeth, K., and H. Nauwynck, 2000: Pro-inflammatory cytokines and viral respiratory disease in pigs. Vet. Res. 31, 187– 213. Van Reeth, K., G. Labarque, H. Nauwynck, and M. Pensaert, 1999: Differential production of proinflammatory cytokines in the pig lung during different respiratory virus infections: correlations with pathogenicity. Res. Vet. Sci. 67, 47–52. Van Reeth, K., S. Van Gucht, and M. Pensaert, 2002a: Correlations between lung proinflammatory cytokine levels, virus replication, and disease after swine influenza virus challenge of vaccination-immune pigs. Viral Immunol. 15, 583–594. Van Reeth, K., S. Van Gucht, and M. Pensaert, 2002b: In vivo studies on cytokine involvement during acute viral respiratory disease of swine: troublesome but rewarding. Vet. Immunol. Immunopathol. 87, 161–168. Webster, R. G., W. J. Bean, O. T. Gorman, T. M. Chambers, and Y. Kawaoka, 1992: Evolution and ecology of influenza A viruses. Microbiol. Rev. 56, 152–179.

© 2014 Crown copyright • Transboundary and Emerging Diseases. This article is published with the permission of the Controller of HMSO and Animal Health and Veterinary Laboratories Agency.

9