GENETIC TESTING AND MOLECULAR BIOMARKERS Volume 19, Number 2, 2015 ª Mary Ann Liebert, Inc. Pp. 1–5 DOI: 10.1089/gtmb.2014.0239
ORIGINAL ARTICLES
CYP2B6 Gene Single-Nucleotide Polymorphisms in an Italian Population Sample and Relationship with Nicotine Dependence Laura Natalia Riccardi,1 Francesco Carano,2 Carla Bini,1 Stefania Ceccardi,1 Gianmarco Ferri,3 and Susi Pelotti1
The extensively polymorphic CYP2B6 gene metabolizes endogenous and exogenous compounds, among which are nicotine and bupropion, although its contribution to the systemic metabolism of nicotine still remains controversial. In the present study, the distribution of the CYP2B6 variant and genotype frequencies was analyzed in a sample of 202 Italian individuals who were also invited to answer the Fagerstro¨m test for nicotine dependence (FTND), in an effort to assess the involvement of CYP2B6 polymorphisms in nicotine dependence. Eight single-nucleotide polymorphisms of CYP2B6 were tested and seven different variants were identified showing frequencies similar to the European population. The reduced activity of the CYP2B6*6 variant was significantly ( p = 0.025) distributed among the nicotine-dependent individuals compared to non-nicotine dependents. Also, the CYP2B6*1/*6 genotype achieved statistical significance ( p = 0.016) within the nicotine-dependent individuals. The high occurrence of CYP2B6*6 carriers among nicotine-dependent individuals may suggest a possible involvement in nicotine dependence, with a potential impact on smoking cessation treatments tailored to the individual smoker’s genotype.
et al., 2007). However, the contribution of CYP2B6 to peripheral nicotine metabolism still remains controversial. No association of CYP2B6 polymorphism with plasma nicotine levels and smoking rate or smoking cessation was reported by Lee et al. (2007b), indicating that the CYP2B6 enzyme does not alter nicotine metabolism. N-demethylation to nornicotine is a minor pathway in the peripheral clearance of nicotine and CYP2B6 in vitro shows the highest nicotine N-demethylase activity. However, it was demonstrated that in the brain, nicotine is primarily metabolized to the pharmacologically active nornicotine, which may be involved in neurologic effects and tobacco usage (Yamanaka et al., 2005). Interestingly, it was reported that in the human brain, decreased CYP2B6 activity leads to high nicotine and low nornicotine concentrations affecting the smoking behavior (Ferguson and Tyndale, 2011). The CYP2B6 enzyme is expressed in different human brain regions and cell types at variable levels (Miksys et al., 2003). CYP2B6 induction by nicotine together with the enzyme involvement in the local metabolism of neuroactive CYP2B6 substrates, such as bupropion and nicotine, was demonstrated in African green monkey brains (Lee et al., 2006; Ferguson et al., 2013), suggesting that CYP2B6 decreased activity due to the CYP2B6*6 variant is related to
Introduction
T
he CYP2B6 gene is extensively polymorphic and nowadays 38 distinct star-alleles, associated with different activity levels, are listed at the Human CYP allele web page (Sim and Ingelman-Sundberg, 2010). The CYP2B6 enzyme contributes to the biotransformation of drugs and xenobiotics (Zanger and Klein, 2013), but population data on genetic polymorphism distribution are limited and CYP2B6 polymorphism involvement in peripheral nicotine metabolism still remains controversial. Although nicotine is mainly metabolized in the liver by the polymorphic CYP2A6 enzyme to the inactive metabolite cotinine through C-oxidation, at high substrate concentrations, CYP2B6 also was found to be involved (Yamazaki et al., 1999). Actually, it has been observed that subjects carrying the CYP2B6*4 variant showed an increased rate of nicotine metabolism ( Johnstone et al., 2006). The CYP2B6*6 variant, related to a 50–75% decreased protein level (Hofmann et al., 2008), was found to have an association with nicotine and cotinine clearance levels among individuals possessing CYP2A6 reduced function alleles, if interactions were assumed between genotypes of the two genes without evidence of linkage disequilibrium (Ring 1 2 3
Department of Medical and Surgical Sciences (DIMEC), Institute of Legal Medicine, University of Bologna, Bologna, Italy. Department for Biomedical and Neuromotor Sciences (DIBINEM), University of Bologna, Bologna, Italy. Department of Diagnostics, Clinical and Public Health Medicine, University of Modena and Reggio Emilia, Modena, Italy.
1
2
RICCARDI ET AL.
Table 1. Primer Pairs for Amplification of CYP2B6 Gene Fragments Primer CYP2B6_1F CYP2B6_1R CYP2B6_3Fa CYP2B6_3Ra CYP2B6_4F CYP2B6_4R CYP2B6_5F CYP2B6_5R CYP2B6_7F CYP2B6_7R CYP2B6_9F CYP2B6_9R a
Sequence 5¢-3¢
Length
ACACATTCACTTGCTCACCTG TTCACCATGCTCCGTACT GAGCCTTCTTCCAACTTCTTCTA TTGTCTTTCTTTCCTATTCATCC AACTGTACTCACTCCCAGAGT CTGATTCTTCACATGTCTGCG CTCTCTCCCTGTGACCTGCTA CTCCCTCTGTCTTTCATTCTGTC CCACCCACCTCAACCTCCAA TCCAACCCTCCACACACTCC ACACTGGTGACCTTCTGTGT CCTGCACTCACTTGCAATGT
21 18 23 23 21 21 21 23 20 20 20 20
Product size (bp)
Concentration (lM)
584
0.6
Jacob et al. (2004)
238
0.6
Blievernicht et al. (2007)
679
0.6
Jacob et al. (2004)
496
0.2
Lang et al. (2004)
443
0.2
Lang et al. (2004)
380
0.2
Blievernicht et al. (2007)
References
Modified in 5¢ in this study.
higher cravings and a higher relapse rate was demonstrated in smoking cessation clinical trials with bupropion (Lerman et al., 2002; Lee et al., 2007a). In the current study, we analyzed the polymorphisms of the CYP2B6 gene in Italian individuals considering also their nicotine dependence to evaluate the distribution of allele and genotype frequencies and the involvement of CYP2B6 polymorphisms in nicotine dependence. Materials and Methods
Informed consent was signed by all the 202 healthy unrelated Italian residents who has been invited to fill out the Fagerstro¨m test for nicotine dependence (FTND), a validated 6-item questionnaire (scores 0–10) used to measure selfreported nicotine dependence (Fagerstro¨m and Schneider, 1989). According to Thorgeirsson et al. (2008), the association with nicotine dependence was assigned to participants scoring 4 or higher and used to subdivide our samples in two groups: nicotine-dependent individuals (n = 95) scoring ‡ 4 at the FTDN and non-nicotine-dependent individuals (n = 107) showing an FTDN score of 0. The CYP2B6 gene analysis was performed, after DNA extraction using the PrepFiler Forensic DNA Extraction Kit
(Life Technologies, Carlsbad, CA), by multiplex polymerase chain reaction (PCR) amplifying simultaneously six CYP2B6specific fragments in a reaction volume of 25 mL containing 0.9X AmpliTaq Gold PCR buffer, 2 mM MgCl2, 0.2 mM each deoxynucleoside triphosphate, primer pairs at different concentrations (Table 1), 2 units of AmpliTaq Gold (Life Technologies), and 20–50 ng of target DNA. The PCR cycling protocol consisted of denaturation at 95C for 7 min, followed by 30 cycles of 95C for 30 s, 60C for 30 s, 72C for 2 min, and a final step at 72C for 5 min. DNA fragments were checked on a 2% agarose gel stained with GelRed (Biotium, Inc., Hayward, CA). Amplicon purification was performed with ExoSAP (USB Corporation, Cleveland, OH) for 15 min at 37C and 15 min at 80C and genotyping by SNaPshot Multiplex System (Life Technologies), which tested simultaneously eight single-nucleotide polymorphisms (SNPs) ( - 82T > C, 64C > T, 415A > G, 516G > T, 785A > G, 983T > C, 1006C > T, 1459C > T/A) using single-base extension primers (Table 2) to define CYP2B6 common variants (*2, *4, *5, *6, *7, *8, *9, *13, *16, *18, *19) and the newly described variants *33, *34, and *36 (Radloff et al., 2013). Before capillary electrophoresis performed by the ABI 310 Genetic Analyzer (Life Technologies), samples were purified with 1U calf intestinal phosphatase (New England BioLabs, Ipswich,
Table 2. Designed Extension Primers Used for CYP2B6 Genotyping in the SNaPshot Reaction
Primer 2B6_ - 82 2B6_64 2B6_415a 2B6_516 2B6_785
Length
Accession number
SNP
Concentration in SNaPshot reaction (lM)
GTGGGGAATGGATGAAATTT (ct)4TTGCTACTCCTGGTTCAG t(ct)4AGGGACTTCGGGATGGGA (tc)9CCCCACCTTCCTCTTCCA
20 26 27 36
rs34223104 rs8192709 rs12721655 rs3745274
T>C C>T A>G G>T
0.9 3 0.1 1.2
(t)23TGGACCCCAGCGCCCCCA
41
rs2279343
A>G
0.2
46 51 56
rs28399499 T > C rs34826503 C > T rs3211371 C > T
0.9 0.1 0.9
Sequence 5¢-3¢ a
2B6_983Ra (tc)14GGGCCAATCACCTGTTCA 2B6_1006Ra c(tc)16CATGAAGCTCTGGAGGGC 2B6_1459 (t)36TACCCCCAACATACCAGATC a
From Blievernicht et al. (2007) with modifications. SNP, single-nucleotide polymorphism.
Detected allele *22 *34 *36 *2 *10 *8 *13 *6 *7 *9 *13 *19 *20 *34 *36 *4 *6 *7 *13 *16 *19 *20 *34 *36 *18 *16 *19 *5 *7 *33 *34
CYP2B6 POLYMORPHISM
3
Table 3. Variants and Genotype Frequencies of CYP2B6 in the Whole Sample of 202 Italian Subjects and in Nicotine-Dependent/Non-Nicotine-Dependent Groups Nicotine-dependent individuals (n = 95)
Variants *1 *2 *4 *5 *6 *7 *13 *22 Genotypes *1/*1 *1/*2 *1/*4 *1/*5 *1/*6 *1/*22 *2/*2 *2/*5 *2/*6 *2/*7 *2/*13 *2/*22 *4/*6 *4/*7 *5/*5 *5/*6 *6/*6 *6/*22 a
Mutation(s) None or undetected 64C > T 785A > G 1459C > T 516G > T; 785A > G 516G > T; 785A > G; 1459C > T 415A > G; 516G > T; 785A > G - 82T > C
Non-nicotine-dependent individuals (n = 107)
All subjects (n = 202)
n
Frequency
n
Frequency
n
Frequency
90 11 6 16 61 1 1 4
0.474 0.058 0.032 0.084 0.321a 0.005 0.005 0.021
119 9 4 27 47 1 0 7
0.556 0.042 0.019 0.126 0.220 0.005 0.000 0.033
209 20 10 43 108 2 1 11
0.517 0.050 0.025 0.106 0.267 0.005 0.003 0.027
19 4 3 7 34 4 1 2 1 1 1 0 3 0 1 5 9 0
0.200 0.042 0.032 0.074 0.358a 0.042 0.011 0.021 0.011 0.011 0.011 0.000 0.032 0.000 0.011 0.053 0.095 0.000
35 5 2 16 22 4 0 1 1 0 0 2 1 1 1 8 7 1
0.327 0.047 0.019 0.150 0.206 0.037 0.000 0.009 0.009 0.000 0.000 0.019 0.009 0.009 0.009 0.075 0.065 0.009
54 9 5 23 56 8 1 3 2 1 1 2 4 1 2 13 16 1
0.267 0.045 0.025 0.114 0.277 0.040 0.005 0.015 0.010 0.005 0.005 0.010 0.020 0.005 0.010 0.064 0.079 0.005
Significant at p < 0.05 when compared to all other variants/genotypes.
MA) according to the manufacturer’s protocol. The software PHASE v 2.1.1 (Stephens and Donnelly, 2003) was used to infer the gametic phase assigning the most probable haplotype to every subject included in this study ranging from 0.737 to 1. Samples bearing none of the tested SNPs variants were referred to as wild-type CYP2B6*1, including the combined frequency of the wild-type and all undetected variants. The Hardy–Weinberg equilibrium was measured using the software Arlequin v3.5 (Excoffier and Lischer, 2010). The intergroup differences for variant and genotype frequencies were assessed by Fisher’s exact test using the RxC software (Miller, 1997), which was employed also to test differences in allele frequencies with the European population. p-Values £ 0.05 were considered statistically significant. Results
The CYP2B6 variant and genotype frequencies in the whole sample and in the two groups are summarized in Table 3. No deviations from the Hardy–Weinberg equilibrium were observed for all the analyzed genetic polymorphisms. In the whole sample of 202 subjects, the frequency of CYP2B6*1 wild type was 51.7%. The most common variant was the CYP2B6*6 reaching a 26.7% frequency. The CYP2B6*5 variant showed a frequency of 10.6%, whereas the remaining variants CYP2B6*2, *4, *7, *13, and *22 were found at frequencies of 5%, 2.5%, 0.5%, 0.3%, and 2.7%, respectively.
The CYP2B6*6 was mostly frequent in nicotine-dependent individuals reaching a frequency of 32.1% and decreasing to 22% in the non-nicotine-dependent individuals group. Using an allele-pooling strategy (Boehnke and Langefeld, 1998) for the most common reduced activity variants (*5,*6), only CYP2B6*6 frequency compared to all other variant frequencies was significant ( p = 0.025). Among the 18 detected genotypes, the wild-type CYP2B6*1/ *1 (26.7%) and the variant genotype CYP2B6*1/*6 (27.7%) occurred at a similar frequency and were the most represented accounting for 54.4% of the overall genotype frequencies. The CYP2B6*1/*6 reached a frequency of 35.8% within the nicotine-dependent individuals group, whereas only about 20% of non-nicotine-dependent individuals showed this genotype. The genotypes carrying at least one CYP2B6*6 variant achieved statistical significance ( p = 0.016) when tested against all other genotypes. No CYP2B6 allele frequency differences between the study population and European population from Yuce-Artun et al. (2014) were observed ( p = 0.129). Discussion
In this study, we analyzed the distribution of the most common CYP2B6 variants, and also of minor ones not determined in most pharmacogenetics studies and for which, to our knowledge, only limited data are available. Altogether
4
RICCARDI ET AL.
seven different CYP2B6 variants were found and their frequencies were similar to the European population. CYP2B6*6 (516G > T, 785A > G) was the most represented variant followed by CYP2B6*5 (1459C > T), consistent with the most frequent SNPs in the Europeans: 516G > T, 785A > G, and 1459C > T (Lang et al., 2001; Jacob et al., 2004; Rotger et al., 2007; Arenaz et al., 2010; Yuce-Artun et al., 2014). The CYP2B6*7 bearing all the three SNPs has been poorly investigated in population studies and shows a low frequency in the Turkish population (Yuce-Artun et al., 2014). In our study, CYP2B6*4 occurred at 2.5%, whereas CYP2B6*9 was not found, in contrast to its high prevalence in the Colombian and West African populations (Mehlotra et al., 2006; Restrepo et al., 2011). The 415A > G SNP as a triple mutant on a *6 background (CYP2B6*13) was detected only in one sample in agreement with the reported low frequencies among Caucasians (Zanger et al., 2007). The - 82T > C SNP in the promoter, distinctive for the increased activity variant CYP2B6*22 and the CYP2B6*2 (64C > T) are similar to previously reported frequencies (Zukunft et al., 2005; Rotger et al., 2007; Zanger et al., 2007). Our results showed that the CYP2B6*6 corresponded to a 50–75% decreased protein level and was differently distributed in the two groups since it was mainly present in individuals with nicotine dependence. Hence, its association with the wild type accounts for the significant distribution of CYP2B6*1/*6 genotype, which occurs mostly in nicotine-dependent individuals, suggesting an involvement of CYP2B6*6 in nicotine dependence, in agreement with the smoking behavior of CY2B6 slow metabolizers (Ferguson and Tyndale, 2011). In addition, it is noteworthy that smokers with CYP2B6*6/*6 or CYP2B6*1/*6 genotypes were associated with a higher likelihood to relapse on placebo and they were considered good candidates for bupropion treatment for smoking cessation (Lee et al., 2007a). This evidence is also supported by the findings that CYP2B6 contributes to in vitro nicotine metabolism (Yamazaki et al., 1999), brain CYPs are active in vivo contributing significantly to local metabolism (Miksys and Tyndale, 2009), and CYP2B6 differential expression in specific brain areas as well as its upregulation in smokers’ brains (Miksys et al., 2003). However, the potential biological mechanism underlying altered CYP2B6 activity and nicotine dependence remains unclear. Actually, although no contribution of CYP2B6 genotypes to systemic nicotine metabolism, smoking behavior, or response to nicotine replacement therapies (Lee et al., 2007b) were reported; nevertheless, the CYP2B6*6 variant was associated with faster systemic nicotine clearance in vivo (Ring et al., 2007). In conclusion, our data, providing a picture of the CYP2B6 polymorphism in Italians, may be useful for personalized therapy and, also in conjunction with the individual nicotine dependence level, may be included in future research regarding the genetic role in smoking cessation treatments tailored to the individual smoker’s genotype. Author Disclosure Statement
No competing financial interests exist. References
Arenaz I, Vicente J, Fanlo A, et al. (2010) Haplotype structure and variant frequencies of CYP2B6 in Spaniards and Central Americans. Fundam Clin Pharmacol 24:247–253.
Blievernicht JK, Schaeffeler E, Klein K, et al. (2007) MALDITOF mass spectrometry for multiplex genotyping of CYP2B6 single-nucleotide polymorphisms. Clin Chem 53:24–33. Boehnke M, Langefeld CD (1998) Genetic association mapping based on discordant sib pairs: the discordant-alleles test. Am J Hum Genet 62:950–961. Excoffier L, Lischer HE (2010) Arlequin suite ver 3.5: a new series of programs to perform population genetics analyses under Linux and Windows. Mol Ecol Resour 10:564–567. Fagerstro¨m KO, Schneider NG (1989) Measuring nicotine dependence: a review of the Fagerstrom Tolerance Questionnaire. J Behav Med 12:159–182. Ferguson CS, Miksys S, Palmour RM, et al. (2013) Ethanol self-administration and nicotine treatment induce brain levels of CYP2B6 and CYP2E1 in African green monkeys. Neuropharmacology 72:74–81. Ferguson CS, Tyndale RF (2011) Cytochrome P450 enzymes in the brain: emerging evidence of biological significance. Trends Pharmacol Sci 32:708–714. Hofmann MH, Blievernicht JK, Klein K, et al. (2008) Aberrant splicing caused by single nucleotide polymorphism 516G > T [Q172H], a marker of CYP2B6*6, is responsible for decreased expression and activity of CYP2B6 in liver. J. Pharmacol Exp Ther 325:284–292. Jacob RM, Johnstone EC, Neville MJ, Walton RT (2004) Identification of CYP2B6 sequence variants by use of multiplex PCR with allele-specific genotyping. Clin Chem 50:1372–1377. Johnstone E, Benowitz N, Cargill A, et al. (2006) Determinants of the rate of nicotine metabolism and effects on smoking behavior. Clin Pharmacol Ther 80:319–330. Lang T, Klein K, Fischer J, et al. (2001) Extensive genetic polymorphism in the human CYP2B6 gene with impact on expression and function in human liver. Pharmacogenetics 11:399–415. Lang T, Klein K, Richter T, Zibat A, et al. (2004) Multiple novel nonsynonymous CYP2B6 gene polymorphisms in Caucasians: demonstration of phenotypic null alleles. J Pharmacol Exp Ther 311:34–43. Lee AM, Jepson C, Hoffmann E, et al. (2007a) CYP2B6 genotype alters abstinence rates in a bupropion smoking cessation trial. Biol Psychiatry 62:635–641. Lee AM, Jepson C, Shields PG, et al. (2007b) CYP2B6 genotype does not alter nicotine metabolism, plasma levels, or abstinence with nicotine replacement therapy. Cancer Epidemiol Biomarkers Prev 16:1312–1314. Lee AM, Miksys S, Palmour R, et al. (2006) CYP2B6 is expressed in African Green monkey brain and is induced by chronic nicotine treatment. Neuropharmacology 50:441–450. Lerman C, Shields PG, Wileyto EP, et al. (2002) Pharmacogenetic investigation of smoking cessation treatment. Pharmacogenetics 12:627–634. Mehlotra RK, Ziats MN, Bockarie MJ, Zimmerman PA (2006) Prevalence of CYP2B6 alleles in malaria-endemic populations of West Africa and Papua New Guinea. Eur J Clin Pharmacol 62:267–275. Miksys S, Lerman C, Shields PG, et al. (2003) Smoking, alcoholism and genetic polymorphisms alter CYP2B6 levels in human brain. Neuropharmacology 45:122–132. Miksys S, Tyndale RF (2009) Brain drug-metabolizing cytochrome P450 enzymes are active in vivo, demonstrated by mechanism-based enzyme inhibition. Neuropsychopharmacology 34:634–640. Miller MP (1997) R by C: A Program That Performs Fisher’s Exact Test on Any Sized Contingency Table Through the Use
CYP2B6 POLYMORPHISM
of the Metropolis Algorithm. Available at www.marksgenetic software.net (accessed July 2014). Radloff R, Gras A, Zanger UM, et al. (2013) Novel CYP2B6 enzyme variants in a Rwandese population: functional characterization and assessment of in silico prediction tools. Hum Mutat 34:725–734. Restrepo JG, Martı´nez C, Garcı´a-Agu´ndez A, et al. (2011) Cytochrome P450 CYP2B6 genotypes and haplotypes in a Colombian population: identification of novel variant CYP2B6 alleles. Pharmacogenet Genomics 21:773–778. Ring HZ, Valdes AM, Nishita DM, et al. (2007) Gene-gene interactions between CYP2B6 and CYP2A6 in nicotine metabolism. Pharmacogenet Genomics 17:1007–1015. Rotger M, Tegude H, Colombo S, et al. (2007) Predictive value of known and novel alleles of CYP2B6 for efavirenz plasma concentrations in HIV-infected individuals. Clin Pharmacol Ther 81:557–566. Sim SC, Ingelman-Sundberg M (2010) The Human Cytochrome P450 (CYP) Allele Nomenclature website: a peer-reviewed database of CYP variants and their associated effects. Hum Genomics 4:278–281. Stephens M, Donnelly P (2003) A comparison of bayesian methods for haplotype reconstruction from population genotype data. Am J Hum Genet 73:1162–1169. Thorgeirsson TE, Geller F, Sulem P, et al. (2008) A variant associated with nicotine dependence, lung cancer and peripheral arterial disease. Nature 452:638–642. Yamanaka H, Nakajima M, Fukami T, et al. (2005) CYP2A6 and CYP2B6 are involved in nornicotine formation from
5
nicotine in humans: interindividual differences in these contributions. Drug Metab Dispos 33:1811–1818. Yamazaki H, Inoue K, Hashimoto M, et al. (1999) Roles of CYP2A6 and CYP2B6 in nicotine C-oxidation by human liver microsomes. Arch Toxicol 73:65–70. Yuce-Artun N, Kose G, Suzen HS (2014) Allele and genotype frequencies of CYP2B6 in a Turkish population. Mol Biol Rep 41:3891–3896. Zanger UM, Klein K (2013) Pharmacogenetics of cytochrome P450 2B6 (CYP2B6): advances on polymorphisms, mechanisms, and clinical relevance. Front Genet 4:24. Zanger UM, Klein K, Saussele T, et al. (2007) Polymorphic CYP2B6: molecular mechanisms and emerging clinical significance. Pharmacogenomics 8:743–759. Zukunft J, Lang T, Richter T, et al. (2005) A natural CYP2B6 TATA box polymorphism (-82T— > C) leading to enhanced transcription and relocation of the transcriptional start site. Mol Pharmacol 67:1772–1782.
Address correspondence to: Laura Natalia Riccardi, PhD Department of Medical and Surgical Sciences (DIMEC) Institute of Legal Medicine University of Bologna Via Irnerio 49 Bologna 40126 Italy E-mail: [email protected]
ORIGINAL ARTICLES
CYP2B6 Gene Single-Nucleotide Polymorphisms in an Italian Population Sample and Relationship with Nicotine Dependence Laura Natalia Riccardi,1 Francesco Carano,2 Carla Bini,1 Stefania Ceccardi,1 Gianmarco Ferri,3 and Susi Pelotti1
The extensively polymorphic CYP2B6 gene metabolizes endogenous and exogenous compounds, among which are nicotine and bupropion, although its contribution to the systemic metabolism of nicotine still remains controversial. In the present study, the distribution of the CYP2B6 variant and genotype frequencies was analyzed in a sample of 202 Italian individuals who were also invited to answer the Fagerstro¨m test for nicotine dependence (FTND), in an effort to assess the involvement of CYP2B6 polymorphisms in nicotine dependence. Eight single-nucleotide polymorphisms of CYP2B6 were tested and seven different variants were identified showing frequencies similar to the European population. The reduced activity of the CYP2B6*6 variant was significantly ( p = 0.025) distributed among the nicotine-dependent individuals compared to non-nicotine dependents. Also, the CYP2B6*1/*6 genotype achieved statistical significance ( p = 0.016) within the nicotine-dependent individuals. The high occurrence of CYP2B6*6 carriers among nicotine-dependent individuals may suggest a possible involvement in nicotine dependence, with a potential impact on smoking cessation treatments tailored to the individual smoker’s genotype.
et al., 2007). However, the contribution of CYP2B6 to peripheral nicotine metabolism still remains controversial. No association of CYP2B6 polymorphism with plasma nicotine levels and smoking rate or smoking cessation was reported by Lee et al. (2007b), indicating that the CYP2B6 enzyme does not alter nicotine metabolism. N-demethylation to nornicotine is a minor pathway in the peripheral clearance of nicotine and CYP2B6 in vitro shows the highest nicotine N-demethylase activity. However, it was demonstrated that in the brain, nicotine is primarily metabolized to the pharmacologically active nornicotine, which may be involved in neurologic effects and tobacco usage (Yamanaka et al., 2005). Interestingly, it was reported that in the human brain, decreased CYP2B6 activity leads to high nicotine and low nornicotine concentrations affecting the smoking behavior (Ferguson and Tyndale, 2011). The CYP2B6 enzyme is expressed in different human brain regions and cell types at variable levels (Miksys et al., 2003). CYP2B6 induction by nicotine together with the enzyme involvement in the local metabolism of neuroactive CYP2B6 substrates, such as bupropion and nicotine, was demonstrated in African green monkey brains (Lee et al., 2006; Ferguson et al., 2013), suggesting that CYP2B6 decreased activity due to the CYP2B6*6 variant is related to
Introduction
T
he CYP2B6 gene is extensively polymorphic and nowadays 38 distinct star-alleles, associated with different activity levels, are listed at the Human CYP allele web page (Sim and Ingelman-Sundberg, 2010). The CYP2B6 enzyme contributes to the biotransformation of drugs and xenobiotics (Zanger and Klein, 2013), but population data on genetic polymorphism distribution are limited and CYP2B6 polymorphism involvement in peripheral nicotine metabolism still remains controversial. Although nicotine is mainly metabolized in the liver by the polymorphic CYP2A6 enzyme to the inactive metabolite cotinine through C-oxidation, at high substrate concentrations, CYP2B6 also was found to be involved (Yamazaki et al., 1999). Actually, it has been observed that subjects carrying the CYP2B6*4 variant showed an increased rate of nicotine metabolism ( Johnstone et al., 2006). The CYP2B6*6 variant, related to a 50–75% decreased protein level (Hofmann et al., 2008), was found to have an association with nicotine and cotinine clearance levels among individuals possessing CYP2A6 reduced function alleles, if interactions were assumed between genotypes of the two genes without evidence of linkage disequilibrium (Ring 1 2 3
Department of Medical and Surgical Sciences (DIMEC), Institute of Legal Medicine, University of Bologna, Bologna, Italy. Department for Biomedical and Neuromotor Sciences (DIBINEM), University of Bologna, Bologna, Italy. Department of Diagnostics, Clinical and Public Health Medicine, University of Modena and Reggio Emilia, Modena, Italy.
1
2
RICCARDI ET AL.
Table 1. Primer Pairs for Amplification of CYP2B6 Gene Fragments Primer CYP2B6_1F CYP2B6_1R CYP2B6_3Fa CYP2B6_3Ra CYP2B6_4F CYP2B6_4R CYP2B6_5F CYP2B6_5R CYP2B6_7F CYP2B6_7R CYP2B6_9F CYP2B6_9R a
Sequence 5¢-3¢
Length
ACACATTCACTTGCTCACCTG TTCACCATGCTCCGTACT GAGCCTTCTTCCAACTTCTTCTA TTGTCTTTCTTTCCTATTCATCC AACTGTACTCACTCCCAGAGT CTGATTCTTCACATGTCTGCG CTCTCTCCCTGTGACCTGCTA CTCCCTCTGTCTTTCATTCTGTC CCACCCACCTCAACCTCCAA TCCAACCCTCCACACACTCC ACACTGGTGACCTTCTGTGT CCTGCACTCACTTGCAATGT
21 18 23 23 21 21 21 23 20 20 20 20
Product size (bp)
Concentration (lM)
584
0.6
Jacob et al. (2004)
238
0.6
Blievernicht et al. (2007)
679
0.6
Jacob et al. (2004)
496
0.2
Lang et al. (2004)
443
0.2
Lang et al. (2004)
380
0.2
Blievernicht et al. (2007)
References
Modified in 5¢ in this study.
higher cravings and a higher relapse rate was demonstrated in smoking cessation clinical trials with bupropion (Lerman et al., 2002; Lee et al., 2007a). In the current study, we analyzed the polymorphisms of the CYP2B6 gene in Italian individuals considering also their nicotine dependence to evaluate the distribution of allele and genotype frequencies and the involvement of CYP2B6 polymorphisms in nicotine dependence. Materials and Methods
Informed consent was signed by all the 202 healthy unrelated Italian residents who has been invited to fill out the Fagerstro¨m test for nicotine dependence (FTND), a validated 6-item questionnaire (scores 0–10) used to measure selfreported nicotine dependence (Fagerstro¨m and Schneider, 1989). According to Thorgeirsson et al. (2008), the association with nicotine dependence was assigned to participants scoring 4 or higher and used to subdivide our samples in two groups: nicotine-dependent individuals (n = 95) scoring ‡ 4 at the FTDN and non-nicotine-dependent individuals (n = 107) showing an FTDN score of 0. The CYP2B6 gene analysis was performed, after DNA extraction using the PrepFiler Forensic DNA Extraction Kit
(Life Technologies, Carlsbad, CA), by multiplex polymerase chain reaction (PCR) amplifying simultaneously six CYP2B6specific fragments in a reaction volume of 25 mL containing 0.9X AmpliTaq Gold PCR buffer, 2 mM MgCl2, 0.2 mM each deoxynucleoside triphosphate, primer pairs at different concentrations (Table 1), 2 units of AmpliTaq Gold (Life Technologies), and 20–50 ng of target DNA. The PCR cycling protocol consisted of denaturation at 95C for 7 min, followed by 30 cycles of 95C for 30 s, 60C for 30 s, 72C for 2 min, and a final step at 72C for 5 min. DNA fragments were checked on a 2% agarose gel stained with GelRed (Biotium, Inc., Hayward, CA). Amplicon purification was performed with ExoSAP (USB Corporation, Cleveland, OH) for 15 min at 37C and 15 min at 80C and genotyping by SNaPshot Multiplex System (Life Technologies), which tested simultaneously eight single-nucleotide polymorphisms (SNPs) ( - 82T > C, 64C > T, 415A > G, 516G > T, 785A > G, 983T > C, 1006C > T, 1459C > T/A) using single-base extension primers (Table 2) to define CYP2B6 common variants (*2, *4, *5, *6, *7, *8, *9, *13, *16, *18, *19) and the newly described variants *33, *34, and *36 (Radloff et al., 2013). Before capillary electrophoresis performed by the ABI 310 Genetic Analyzer (Life Technologies), samples were purified with 1U calf intestinal phosphatase (New England BioLabs, Ipswich,
Table 2. Designed Extension Primers Used for CYP2B6 Genotyping in the SNaPshot Reaction
Primer 2B6_ - 82 2B6_64 2B6_415a 2B6_516 2B6_785
Length
Accession number
SNP
Concentration in SNaPshot reaction (lM)
GTGGGGAATGGATGAAATTT (ct)4TTGCTACTCCTGGTTCAG t(ct)4AGGGACTTCGGGATGGGA (tc)9CCCCACCTTCCTCTTCCA
20 26 27 36
rs34223104 rs8192709 rs12721655 rs3745274
T>C C>T A>G G>T
0.9 3 0.1 1.2
(t)23TGGACCCCAGCGCCCCCA
41
rs2279343
A>G
0.2
46 51 56
rs28399499 T > C rs34826503 C > T rs3211371 C > T
0.9 0.1 0.9
Sequence 5¢-3¢ a
2B6_983Ra (tc)14GGGCCAATCACCTGTTCA 2B6_1006Ra c(tc)16CATGAAGCTCTGGAGGGC 2B6_1459 (t)36TACCCCCAACATACCAGATC a
From Blievernicht et al. (2007) with modifications. SNP, single-nucleotide polymorphism.
Detected allele *22 *34 *36 *2 *10 *8 *13 *6 *7 *9 *13 *19 *20 *34 *36 *4 *6 *7 *13 *16 *19 *20 *34 *36 *18 *16 *19 *5 *7 *33 *34
CYP2B6 POLYMORPHISM
3
Table 3. Variants and Genotype Frequencies of CYP2B6 in the Whole Sample of 202 Italian Subjects and in Nicotine-Dependent/Non-Nicotine-Dependent Groups Nicotine-dependent individuals (n = 95)
Variants *1 *2 *4 *5 *6 *7 *13 *22 Genotypes *1/*1 *1/*2 *1/*4 *1/*5 *1/*6 *1/*22 *2/*2 *2/*5 *2/*6 *2/*7 *2/*13 *2/*22 *4/*6 *4/*7 *5/*5 *5/*6 *6/*6 *6/*22 a
Mutation(s) None or undetected 64C > T 785A > G 1459C > T 516G > T; 785A > G 516G > T; 785A > G; 1459C > T 415A > G; 516G > T; 785A > G - 82T > C
Non-nicotine-dependent individuals (n = 107)
All subjects (n = 202)
n
Frequency
n
Frequency
n
Frequency
90 11 6 16 61 1 1 4
0.474 0.058 0.032 0.084 0.321a 0.005 0.005 0.021
119 9 4 27 47 1 0 7
0.556 0.042 0.019 0.126 0.220 0.005 0.000 0.033
209 20 10 43 108 2 1 11
0.517 0.050 0.025 0.106 0.267 0.005 0.003 0.027
19 4 3 7 34 4 1 2 1 1 1 0 3 0 1 5 9 0
0.200 0.042 0.032 0.074 0.358a 0.042 0.011 0.021 0.011 0.011 0.011 0.000 0.032 0.000 0.011 0.053 0.095 0.000
35 5 2 16 22 4 0 1 1 0 0 2 1 1 1 8 7 1
0.327 0.047 0.019 0.150 0.206 0.037 0.000 0.009 0.009 0.000 0.000 0.019 0.009 0.009 0.009 0.075 0.065 0.009
54 9 5 23 56 8 1 3 2 1 1 2 4 1 2 13 16 1
0.267 0.045 0.025 0.114 0.277 0.040 0.005 0.015 0.010 0.005 0.005 0.010 0.020 0.005 0.010 0.064 0.079 0.005
Significant at p < 0.05 when compared to all other variants/genotypes.
MA) according to the manufacturer’s protocol. The software PHASE v 2.1.1 (Stephens and Donnelly, 2003) was used to infer the gametic phase assigning the most probable haplotype to every subject included in this study ranging from 0.737 to 1. Samples bearing none of the tested SNPs variants were referred to as wild-type CYP2B6*1, including the combined frequency of the wild-type and all undetected variants. The Hardy–Weinberg equilibrium was measured using the software Arlequin v3.5 (Excoffier and Lischer, 2010). The intergroup differences for variant and genotype frequencies were assessed by Fisher’s exact test using the RxC software (Miller, 1997), which was employed also to test differences in allele frequencies with the European population. p-Values £ 0.05 were considered statistically significant. Results
The CYP2B6 variant and genotype frequencies in the whole sample and in the two groups are summarized in Table 3. No deviations from the Hardy–Weinberg equilibrium were observed for all the analyzed genetic polymorphisms. In the whole sample of 202 subjects, the frequency of CYP2B6*1 wild type was 51.7%. The most common variant was the CYP2B6*6 reaching a 26.7% frequency. The CYP2B6*5 variant showed a frequency of 10.6%, whereas the remaining variants CYP2B6*2, *4, *7, *13, and *22 were found at frequencies of 5%, 2.5%, 0.5%, 0.3%, and 2.7%, respectively.
The CYP2B6*6 was mostly frequent in nicotine-dependent individuals reaching a frequency of 32.1% and decreasing to 22% in the non-nicotine-dependent individuals group. Using an allele-pooling strategy (Boehnke and Langefeld, 1998) for the most common reduced activity variants (*5,*6), only CYP2B6*6 frequency compared to all other variant frequencies was significant ( p = 0.025). Among the 18 detected genotypes, the wild-type CYP2B6*1/ *1 (26.7%) and the variant genotype CYP2B6*1/*6 (27.7%) occurred at a similar frequency and were the most represented accounting for 54.4% of the overall genotype frequencies. The CYP2B6*1/*6 reached a frequency of 35.8% within the nicotine-dependent individuals group, whereas only about 20% of non-nicotine-dependent individuals showed this genotype. The genotypes carrying at least one CYP2B6*6 variant achieved statistical significance ( p = 0.016) when tested against all other genotypes. No CYP2B6 allele frequency differences between the study population and European population from Yuce-Artun et al. (2014) were observed ( p = 0.129). Discussion
In this study, we analyzed the distribution of the most common CYP2B6 variants, and also of minor ones not determined in most pharmacogenetics studies and for which, to our knowledge, only limited data are available. Altogether
4
RICCARDI ET AL.
seven different CYP2B6 variants were found and their frequencies were similar to the European population. CYP2B6*6 (516G > T, 785A > G) was the most represented variant followed by CYP2B6*5 (1459C > T), consistent with the most frequent SNPs in the Europeans: 516G > T, 785A > G, and 1459C > T (Lang et al., 2001; Jacob et al., 2004; Rotger et al., 2007; Arenaz et al., 2010; Yuce-Artun et al., 2014). The CYP2B6*7 bearing all the three SNPs has been poorly investigated in population studies and shows a low frequency in the Turkish population (Yuce-Artun et al., 2014). In our study, CYP2B6*4 occurred at 2.5%, whereas CYP2B6*9 was not found, in contrast to its high prevalence in the Colombian and West African populations (Mehlotra et al., 2006; Restrepo et al., 2011). The 415A > G SNP as a triple mutant on a *6 background (CYP2B6*13) was detected only in one sample in agreement with the reported low frequencies among Caucasians (Zanger et al., 2007). The - 82T > C SNP in the promoter, distinctive for the increased activity variant CYP2B6*22 and the CYP2B6*2 (64C > T) are similar to previously reported frequencies (Zukunft et al., 2005; Rotger et al., 2007; Zanger et al., 2007). Our results showed that the CYP2B6*6 corresponded to a 50–75% decreased protein level and was differently distributed in the two groups since it was mainly present in individuals with nicotine dependence. Hence, its association with the wild type accounts for the significant distribution of CYP2B6*1/*6 genotype, which occurs mostly in nicotine-dependent individuals, suggesting an involvement of CYP2B6*6 in nicotine dependence, in agreement with the smoking behavior of CY2B6 slow metabolizers (Ferguson and Tyndale, 2011). In addition, it is noteworthy that smokers with CYP2B6*6/*6 or CYP2B6*1/*6 genotypes were associated with a higher likelihood to relapse on placebo and they were considered good candidates for bupropion treatment for smoking cessation (Lee et al., 2007a). This evidence is also supported by the findings that CYP2B6 contributes to in vitro nicotine metabolism (Yamazaki et al., 1999), brain CYPs are active in vivo contributing significantly to local metabolism (Miksys and Tyndale, 2009), and CYP2B6 differential expression in specific brain areas as well as its upregulation in smokers’ brains (Miksys et al., 2003). However, the potential biological mechanism underlying altered CYP2B6 activity and nicotine dependence remains unclear. Actually, although no contribution of CYP2B6 genotypes to systemic nicotine metabolism, smoking behavior, or response to nicotine replacement therapies (Lee et al., 2007b) were reported; nevertheless, the CYP2B6*6 variant was associated with faster systemic nicotine clearance in vivo (Ring et al., 2007). In conclusion, our data, providing a picture of the CYP2B6 polymorphism in Italians, may be useful for personalized therapy and, also in conjunction with the individual nicotine dependence level, may be included in future research regarding the genetic role in smoking cessation treatments tailored to the individual smoker’s genotype. Author Disclosure Statement
No competing financial interests exist. References
Arenaz I, Vicente J, Fanlo A, et al. (2010) Haplotype structure and variant frequencies of CYP2B6 in Spaniards and Central Americans. Fundam Clin Pharmacol 24:247–253.
Blievernicht JK, Schaeffeler E, Klein K, et al. (2007) MALDITOF mass spectrometry for multiplex genotyping of CYP2B6 single-nucleotide polymorphisms. Clin Chem 53:24–33. Boehnke M, Langefeld CD (1998) Genetic association mapping based on discordant sib pairs: the discordant-alleles test. Am J Hum Genet 62:950–961. Excoffier L, Lischer HE (2010) Arlequin suite ver 3.5: a new series of programs to perform population genetics analyses under Linux and Windows. Mol Ecol Resour 10:564–567. Fagerstro¨m KO, Schneider NG (1989) Measuring nicotine dependence: a review of the Fagerstrom Tolerance Questionnaire. J Behav Med 12:159–182. Ferguson CS, Miksys S, Palmour RM, et al. (2013) Ethanol self-administration and nicotine treatment induce brain levels of CYP2B6 and CYP2E1 in African green monkeys. Neuropharmacology 72:74–81. Ferguson CS, Tyndale RF (2011) Cytochrome P450 enzymes in the brain: emerging evidence of biological significance. Trends Pharmacol Sci 32:708–714. Hofmann MH, Blievernicht JK, Klein K, et al. (2008) Aberrant splicing caused by single nucleotide polymorphism 516G > T [Q172H], a marker of CYP2B6*6, is responsible for decreased expression and activity of CYP2B6 in liver. J. Pharmacol Exp Ther 325:284–292. Jacob RM, Johnstone EC, Neville MJ, Walton RT (2004) Identification of CYP2B6 sequence variants by use of multiplex PCR with allele-specific genotyping. Clin Chem 50:1372–1377. Johnstone E, Benowitz N, Cargill A, et al. (2006) Determinants of the rate of nicotine metabolism and effects on smoking behavior. Clin Pharmacol Ther 80:319–330. Lang T, Klein K, Fischer J, et al. (2001) Extensive genetic polymorphism in the human CYP2B6 gene with impact on expression and function in human liver. Pharmacogenetics 11:399–415. Lang T, Klein K, Richter T, Zibat A, et al. (2004) Multiple novel nonsynonymous CYP2B6 gene polymorphisms in Caucasians: demonstration of phenotypic null alleles. J Pharmacol Exp Ther 311:34–43. Lee AM, Jepson C, Hoffmann E, et al. (2007a) CYP2B6 genotype alters abstinence rates in a bupropion smoking cessation trial. Biol Psychiatry 62:635–641. Lee AM, Jepson C, Shields PG, et al. (2007b) CYP2B6 genotype does not alter nicotine metabolism, plasma levels, or abstinence with nicotine replacement therapy. Cancer Epidemiol Biomarkers Prev 16:1312–1314. Lee AM, Miksys S, Palmour R, et al. (2006) CYP2B6 is expressed in African Green monkey brain and is induced by chronic nicotine treatment. Neuropharmacology 50:441–450. Lerman C, Shields PG, Wileyto EP, et al. (2002) Pharmacogenetic investigation of smoking cessation treatment. Pharmacogenetics 12:627–634. Mehlotra RK, Ziats MN, Bockarie MJ, Zimmerman PA (2006) Prevalence of CYP2B6 alleles in malaria-endemic populations of West Africa and Papua New Guinea. Eur J Clin Pharmacol 62:267–275. Miksys S, Lerman C, Shields PG, et al. (2003) Smoking, alcoholism and genetic polymorphisms alter CYP2B6 levels in human brain. Neuropharmacology 45:122–132. Miksys S, Tyndale RF (2009) Brain drug-metabolizing cytochrome P450 enzymes are active in vivo, demonstrated by mechanism-based enzyme inhibition. Neuropsychopharmacology 34:634–640. Miller MP (1997) R by C: A Program That Performs Fisher’s Exact Test on Any Sized Contingency Table Through the Use
CYP2B6 POLYMORPHISM
of the Metropolis Algorithm. Available at www.marksgenetic software.net (accessed July 2014). Radloff R, Gras A, Zanger UM, et al. (2013) Novel CYP2B6 enzyme variants in a Rwandese population: functional characterization and assessment of in silico prediction tools. Hum Mutat 34:725–734. Restrepo JG, Martı´nez C, Garcı´a-Agu´ndez A, et al. (2011) Cytochrome P450 CYP2B6 genotypes and haplotypes in a Colombian population: identification of novel variant CYP2B6 alleles. Pharmacogenet Genomics 21:773–778. Ring HZ, Valdes AM, Nishita DM, et al. (2007) Gene-gene interactions between CYP2B6 and CYP2A6 in nicotine metabolism. Pharmacogenet Genomics 17:1007–1015. Rotger M, Tegude H, Colombo S, et al. (2007) Predictive value of known and novel alleles of CYP2B6 for efavirenz plasma concentrations in HIV-infected individuals. Clin Pharmacol Ther 81:557–566. Sim SC, Ingelman-Sundberg M (2010) The Human Cytochrome P450 (CYP) Allele Nomenclature website: a peer-reviewed database of CYP variants and their associated effects. Hum Genomics 4:278–281. Stephens M, Donnelly P (2003) A comparison of bayesian methods for haplotype reconstruction from population genotype data. Am J Hum Genet 73:1162–1169. Thorgeirsson TE, Geller F, Sulem P, et al. (2008) A variant associated with nicotine dependence, lung cancer and peripheral arterial disease. Nature 452:638–642. Yamanaka H, Nakajima M, Fukami T, et al. (2005) CYP2A6 and CYP2B6 are involved in nornicotine formation from
5
nicotine in humans: interindividual differences in these contributions. Drug Metab Dispos 33:1811–1818. Yamazaki H, Inoue K, Hashimoto M, et al. (1999) Roles of CYP2A6 and CYP2B6 in nicotine C-oxidation by human liver microsomes. Arch Toxicol 73:65–70. Yuce-Artun N, Kose G, Suzen HS (2014) Allele and genotype frequencies of CYP2B6 in a Turkish population. Mol Biol Rep 41:3891–3896. Zanger UM, Klein K (2013) Pharmacogenetics of cytochrome P450 2B6 (CYP2B6): advances on polymorphisms, mechanisms, and clinical relevance. Front Genet 4:24. Zanger UM, Klein K, Saussele T, et al. (2007) Polymorphic CYP2B6: molecular mechanisms and emerging clinical significance. Pharmacogenomics 8:743–759. Zukunft J, Lang T, Richter T, et al. (2005) A natural CYP2B6 TATA box polymorphism (-82T— > C) leading to enhanced transcription and relocation of the transcriptional start site. Mol Pharmacol 67:1772–1782.
Address correspondence to: Laura Natalia Riccardi, PhD Department of Medical and Surgical Sciences (DIMEC) Institute of Legal Medicine University of Bologna Via Irnerio 49 Bologna 40126 Italy E-mail: [email protected]
