January - March 2015
6.
7.
8.
165
Case Reports
Rev 2006;19:95-110. Wu TC, Chan JW, Ng C, Tsang DN, Lee M, Li PC. Clinical presentations and outcomes of Penicillium marneffei infections: A series from 1994 to 2004. Hong Kong Med J 2008;14:103-9. Antinori S, Gianelli E, Bonaccorso C, Ridolfo AL, Croce F, Sollima S, et al. Disseminated Penicillium marneffei infection in an HIVIVositive italian patient and a review of cases reported outside endemic regions. J Travel Med 2006;13:181-8. Hamilton AJ, Jeavons L, Youngchim S, Vanittanakom N, Hay RJ. Sialic acid-dependent recognition of laminin by Penicillium marneffei conidia. Infect Immun 1998;66:6024-6.
Access this article online Quick Response Code:
Website: www.ijmm.org PMID: *** DOI: 10.4103/0255-0857.148433
How to cite this article: Ye F, Luo Q, Zhou Y, Xie J, Zeng Q, Chen G, et al. Disseminated penicilliosis marneffei in immunocompetent patients: A report of two cases. Indian J Med Microbiol 2015;33:161-5.
Source of Support: Nil, Conflict of Interest: None declared
Cutaneous fungal infection in a renal transplantation patient due to a rare fungus belonging to order Pleosporales S Galipothu, *U Kalawat, R Ram, C Kishore, AVSSN Sridhar, A Chaudhury, VS Kumar
Abstract Fungal infections are being increasingly reported from immuno-compromised as well as immuno-competent patients. Transplant patients are on long term immunosuppressive therapy which makes them highly vulnerable to opportunistic fungal infections .These infections can be cutaneous or systemic. Several fungi have been reported to be the culprits such as Candida spp., Aspergillus spp., C. neoformans, P. carinii, and zygomycetes group of fungi. Cutaneous infections are most commonly caused by Pityriasis (tinea) versicolor, dermatophytes, and candida sp but these days the demtiaceous fungi are becoming more frequently reported .Here we report a case of post renal transplant cutaneous infection caused by dematiaceous fungus belonging to the order Pleosporales Key words: Fungal infection, pleosporale, renal transplant
Introduction Renal transplant recipients on long-term graft-preserving immunosuppressive treatment are predisposed to various fungal infections. These infections are primarily of two types: Cutaneous or sub-cutaneous and Systemic.[1] Although Candida spp., Aspergillus spp., C. neoformans, P. carinii, zygomycetes group of fungi, and the geographically restricted endemic mycoses play a major role in causing fungal infections among solid-organ transplant recipients, infections due to previously uncommon hyaline and dematiaceous filamentous fungi are being increasingly reported.[2]
*Corresponding author (email: ) Department of Microbiology (SG, UK, AC), Department of Nephrology (RR, CK, AVSSNS, VSK), Sri Venkateswara Institute of Medical Sciences, Tirupati, Andhra Pradesh, India Received: 17-12-2013 Accepted: 27-03-2014
Pityriasis (tinea) versicolor, dermatophytosis (ring worm), candidiasis are the most common culprits causing cutaneous fungal infections in renal transplant patients. But, despite their rarity in clinical practice, melanised or dematiaceous fungal infections have become increasingly important in immunocompromised as well as apparently healthy individuals.[3] Here, we present a case report of cutaneous fungal infection caused by a dematiaceous fungi belonging to the order Pleosporales. Case Report A 47-year-old male, who had undergone live donor renal transplantation for progressive renal failure due to Cresenteric Glomerulonephritis 8 years back, developed a swelling on right great toe with no history of fever or pain [Figure 1]. There was purulent discharge without signs of acute inflammation. On clinical examination presumptive diagnosis of chronic abscess was made. Patient was on immunosuppressive therapy after renal transplantation. He was a hypertensive but not a known diabetic.
www.ijmm.org
166
Indian Journal of Medical Microbiology
vol. 33, No. 1
Figure 2: The direct microscopy of the pus - Dematiceous fungal elements can be seen Figure 1: The wound on great toe before treatment
Figure 4: The microscopy of the fungal colonies using lactophenol cotton blue Figure 3: The fungal colonies of Saboraud’s dextrose agar
All the relevant investigations were carried out which were as follows- Complete haemogram revealed Hb 7.6 g/dl, WBC count 3,500 Cells/cu.mm, platelet count 0.55 lakhs/cumm. Serum urea was 106 mg/dl, serum creatinine 6.5 mg/dl, serum potassium 3.0 mmol/L, total Bilirubin 1.1 mg/dl, bilirubin (conjugate) 0.2 mg/dl, serum alkaline phosphatase 56 IU/L, and SGOT 26 IU/L. Bleeding time and clotting time were 3 min 30 sec and 7 min 30 sec, respectively, PT 12.5 sec; APTT/PTT 32.0 sec. and INR - 1.06. Serum sodium, total protein and serum albumin were in normal limits. Urine routine showed mild albuminuria. His past history was not significant except an episode of loose motion with decreased platelet count, and worsening renal failure which was evaluated and infection with CMV was diagnosed and treated accordingly. Pus was drained and sent to the department of microbiology. Gram staining of pus showed plenty of pus cells but no organisms. Ziehl-Neelsen’s staining for acid-fast bacilli was negative. Pus was inoculated on blood agar and Mackonkey’s agar for aerobic bacterial culture which was incubated at 370C for 48 hours. Pus was also inoculated on
Lowenstein-Jensen agar for mycobacterial culture. Culture for aerobic bacteria and mycobacteria were negative. Viral markers for HIV, HCV and HBV were negative. In suspicion of any possible fungal infection, secretions and wound tissue were sent for fungal culture and KOH mount. Fungus culture was done on saboraud’s dextrose agar. KOH mount of the tissue showed dematiceous fungal elements without any hyphae [Figure 2]. Growth on saboraud’s agar was slightly velvety; initially whitish in colour which later on became light green [Figure 3]. Lactophenol cotton blue mount was prepared from the growth which showed septate hyphae with structures resembling arthrospores [Figure 4]. As we could not arrive at a diagnosis, the isolate was sent to mycology division, PGI Chandigarh and RAS Life Sciences Pvt. Ltd. Hyderabad, India for molecular detection. Both the centres reported it to be genotypically similar to order Pleosporales and further identification up to species level could not be done due to lack of specific primers. The genomic sequence was as follows: GAAAAAAAATGCAGGGGGGGGGCAGACAGC T C C A A G G C C G C C G G C C C C C G C G TA C A C G
www.ijmm.org
January - March 2015
167
Case Reports
C AT TAT C C A C C C T T G A C T T T G A G C A C C GTTTGTTTCCTCGGCGGGGACGCCCGCCAGCGAG GACCCCATTGAACCCTTTGCAGTAGCAGTATTTGTC T G A A A A A A A A C A C A A A A AT C A C A A C T T T C A A C A AT G G AT C T C T T G G T T C T G G C A T C G AT G A A G A A C G C A G C G A A AT G C G AT A A G TA G T G T G A AT T G C A G A AT T C A G T G A AT C AT C G A AT C T T T G A A C G C A C AT T G C G C C C C T C G G TAT T C C T T G G G G C AT G C C T G GTTTGTTTCCTCGGCGGGGACGCCCGCCAGCGAG GACCCCATTGAACCCTTTGCAGTAGCAGTATTTGTC GGTGCTTGTCCCGCCTCCCGCGCGGCGACTC GTTTGTTTCCTCGGCGGGGACGCCCGCCAGCGAG GACCCCATTGAACCCTTTGCAGTAGCAGTATTTGTC C C G C A C C C G C C G G C C AT G A G C G C A G C A C A G T GTTTGTTTCCTCGGCGGGGACGCCCGCCAGCGAG GACCCCATTGAACCCTTTGCAGTAGCAGTATTTGTC ACCCCCCAAAATTGACCTCGGATCAGGTAGGATT GTTTGTTTCCTCGGCGGGGACGCCCGCCAGCGAG CAATAAGCGGAGGAACC The patient was promptly started on antifungal therapy with Voriconazole 200 mg OD, the lesion had got completely healed and he is on regular maintenance haemodialysis. Discussion Fungal infections are an important consequence in renal transplantation and a cause of concern to patients and the physicians. Risk factors for fungal infections in transplant recipients include the use of large doses of corticosteroids, poor transplant function, recent or multiple rejection episodes, hyperglycemia, leukopenia and older age.[4,5] Reduction in the number of epidermal antigen presenting Langerhans cells, corticosteroid induced thickening and delayed desquamation of the stratum corneum because of the treatment, have also been suggested to play a role in the development of these superficial or cutaneous fungal infections.[6,7]
fungal infections especially in immunocompromised patients. Careful diagnosis and aggressive treatment play a vital role in the outcome of these infections. References 1.
Badiee P, Alborzi A. Invasive fungal infections in renal transplant recipients. Exp Clin Transplant 2011;9:355-62. 2. Patel R, Paya CV. Infections in solid-organ transplant recipients. Clin Microbiol Rev 1997;10:86-124. 3. Revankar SG, Patterson JE, Sutton DA, Pullen R, Rinaldi MG. Disseminated phaeohyphomycosis: Review of an emerging mycosis. Clin Infect Dis 2002;34:467-76. 4. Bach MC, Adler JL, Breman J, P'eng FK, Sahyoun A, Schlesinger RM, et al. Influence of rejection therapy on fungal and nocardial infections in renal transplant recipients. Lancet 1973;1:180-4. 5. Howard RJ, Simmons RL, Najarian JS. Fungal infections in renal transplant recipients. Ann Surg 1978;188:598-605. 6. Virgili A, Zampino MR, La Malfa V, Strumia R, Bedani PL. Prevalence of superficial dermatomycosis in 73 renal transplant recipients. Dermatology 1999;199:31-4. 7. Strumia R, Perini L, Tarroni G, Fiocchi O, Gilli P. Skin lesions in kidney transplant recipients. Nephron 1992;62:137-41. 8. Güleç AT, Demirbilek M, Seçkin D, Can F, Saray Y, Sarifakioglu E, et al. Superficial fungal infections in 102 renal transplant recipients: A case-control study. J Am Acad Dermatol 2003;49:187-92. 9. Gené J, Azón-Masoliver A, Guarro J, Ballester F, Pujol I, Llovera M, et al. Cutaneous phaeohyphomycosis caused by Alternaria longipes in an immunosuppressed patient. J Clin Microbiol 1995;33:2774-6. 10. McGinnis MR, Rinaldi MG, Winn RE. Emerging agents of phaeohyphomycosis: Pathogenic species of Bipolaris and Exserohilum. J Clin Microbiol 1986;24:250-9. 11. Yau YC, de Nanassy J, Summerbell RC, Matlow AG, Richardson SE. Fungal sternal wound infection due to Curvularia lunata in a neonate with congenital heart disease: Case report and review. Clin Infect Dis 1994;19:735-40. 12. Hsu MM, Lee JY. Cutaneous and subcutaneous phaeohyphomycosis caused by Exsero- hilum rostratum. J Am Acad Dermatol 1993;28:340-4. Access this article online
A study reported pityriasis versicolor as the most common cutaneous fungal infection in renal transplant recipients.[8] Although rare in clinical practice, melanised or dematiaceous fungi have become an important opportunistic pathogen, especially in immunocompromised patients. Among the dematiaceous fungi belonging to the order Pleosporales, Alternaria spp, Bipolaris spp, Curvularia spp., and Exserohilum spp, have been commonly reported to cause cutaneous and subcutaneous infections.[9-12] The fungus isolated in our case did not match with any of the above mentioned species. And this report being another case of cutaneous phaeohyphomycosis caused by a dematiaceous fungi belonging to Pleosporales, enlightens us to be aware of these unusual
Quick Response Code:
Website: www.ijmm.org PMID: *** DOI: 10.4103/0255-0857.148435
How to cite this article: Galipothu S, Kalawat U, Ram R, Kishore C, Sridhar A, Chaudhury A, et al. Cutaneous fungal infection in a renal transplantation patient due to a rare fungus belonging to order Pleosporales. Indian J Med Microbiol 2015;33:165-7.
Source of Support: Nil, Conflict of Interest: None declared
www.ijmm.org
Copyright of Indian Journal of Medical Microbiology is the property of Medknow Publications & Media Pvt. Ltd. and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use.
6.
7.
8.
165
Case Reports
Rev 2006;19:95-110. Wu TC, Chan JW, Ng C, Tsang DN, Lee M, Li PC. Clinical presentations and outcomes of Penicillium marneffei infections: A series from 1994 to 2004. Hong Kong Med J 2008;14:103-9. Antinori S, Gianelli E, Bonaccorso C, Ridolfo AL, Croce F, Sollima S, et al. Disseminated Penicillium marneffei infection in an HIVIVositive italian patient and a review of cases reported outside endemic regions. J Travel Med 2006;13:181-8. Hamilton AJ, Jeavons L, Youngchim S, Vanittanakom N, Hay RJ. Sialic acid-dependent recognition of laminin by Penicillium marneffei conidia. Infect Immun 1998;66:6024-6.
Access this article online Quick Response Code:
Website: www.ijmm.org PMID: *** DOI: 10.4103/0255-0857.148433
How to cite this article: Ye F, Luo Q, Zhou Y, Xie J, Zeng Q, Chen G, et al. Disseminated penicilliosis marneffei in immunocompetent patients: A report of two cases. Indian J Med Microbiol 2015;33:161-5.
Source of Support: Nil, Conflict of Interest: None declared
Cutaneous fungal infection in a renal transplantation patient due to a rare fungus belonging to order Pleosporales S Galipothu, *U Kalawat, R Ram, C Kishore, AVSSN Sridhar, A Chaudhury, VS Kumar
Abstract Fungal infections are being increasingly reported from immuno-compromised as well as immuno-competent patients. Transplant patients are on long term immunosuppressive therapy which makes them highly vulnerable to opportunistic fungal infections .These infections can be cutaneous or systemic. Several fungi have been reported to be the culprits such as Candida spp., Aspergillus spp., C. neoformans, P. carinii, and zygomycetes group of fungi. Cutaneous infections are most commonly caused by Pityriasis (tinea) versicolor, dermatophytes, and candida sp but these days the demtiaceous fungi are becoming more frequently reported .Here we report a case of post renal transplant cutaneous infection caused by dematiaceous fungus belonging to the order Pleosporales Key words: Fungal infection, pleosporale, renal transplant
Introduction Renal transplant recipients on long-term graft-preserving immunosuppressive treatment are predisposed to various fungal infections. These infections are primarily of two types: Cutaneous or sub-cutaneous and Systemic.[1] Although Candida spp., Aspergillus spp., C. neoformans, P. carinii, zygomycetes group of fungi, and the geographically restricted endemic mycoses play a major role in causing fungal infections among solid-organ transplant recipients, infections due to previously uncommon hyaline and dematiaceous filamentous fungi are being increasingly reported.[2]
*Corresponding author (email: ) Department of Microbiology (SG, UK, AC), Department of Nephrology (RR, CK, AVSSNS, VSK), Sri Venkateswara Institute of Medical Sciences, Tirupati, Andhra Pradesh, India Received: 17-12-2013 Accepted: 27-03-2014
Pityriasis (tinea) versicolor, dermatophytosis (ring worm), candidiasis are the most common culprits causing cutaneous fungal infections in renal transplant patients. But, despite their rarity in clinical practice, melanised or dematiaceous fungal infections have become increasingly important in immunocompromised as well as apparently healthy individuals.[3] Here, we present a case report of cutaneous fungal infection caused by a dematiaceous fungi belonging to the order Pleosporales. Case Report A 47-year-old male, who had undergone live donor renal transplantation for progressive renal failure due to Cresenteric Glomerulonephritis 8 years back, developed a swelling on right great toe with no history of fever or pain [Figure 1]. There was purulent discharge without signs of acute inflammation. On clinical examination presumptive diagnosis of chronic abscess was made. Patient was on immunosuppressive therapy after renal transplantation. He was a hypertensive but not a known diabetic.
www.ijmm.org
166
Indian Journal of Medical Microbiology
vol. 33, No. 1
Figure 2: The direct microscopy of the pus - Dematiceous fungal elements can be seen Figure 1: The wound on great toe before treatment
Figure 4: The microscopy of the fungal colonies using lactophenol cotton blue Figure 3: The fungal colonies of Saboraud’s dextrose agar
All the relevant investigations were carried out which were as follows- Complete haemogram revealed Hb 7.6 g/dl, WBC count 3,500 Cells/cu.mm, platelet count 0.55 lakhs/cumm. Serum urea was 106 mg/dl, serum creatinine 6.5 mg/dl, serum potassium 3.0 mmol/L, total Bilirubin 1.1 mg/dl, bilirubin (conjugate) 0.2 mg/dl, serum alkaline phosphatase 56 IU/L, and SGOT 26 IU/L. Bleeding time and clotting time were 3 min 30 sec and 7 min 30 sec, respectively, PT 12.5 sec; APTT/PTT 32.0 sec. and INR - 1.06. Serum sodium, total protein and serum albumin were in normal limits. Urine routine showed mild albuminuria. His past history was not significant except an episode of loose motion with decreased platelet count, and worsening renal failure which was evaluated and infection with CMV was diagnosed and treated accordingly. Pus was drained and sent to the department of microbiology. Gram staining of pus showed plenty of pus cells but no organisms. Ziehl-Neelsen’s staining for acid-fast bacilli was negative. Pus was inoculated on blood agar and Mackonkey’s agar for aerobic bacterial culture which was incubated at 370C for 48 hours. Pus was also inoculated on
Lowenstein-Jensen agar for mycobacterial culture. Culture for aerobic bacteria and mycobacteria were negative. Viral markers for HIV, HCV and HBV were negative. In suspicion of any possible fungal infection, secretions and wound tissue were sent for fungal culture and KOH mount. Fungus culture was done on saboraud’s dextrose agar. KOH mount of the tissue showed dematiceous fungal elements without any hyphae [Figure 2]. Growth on saboraud’s agar was slightly velvety; initially whitish in colour which later on became light green [Figure 3]. Lactophenol cotton blue mount was prepared from the growth which showed septate hyphae with structures resembling arthrospores [Figure 4]. As we could not arrive at a diagnosis, the isolate was sent to mycology division, PGI Chandigarh and RAS Life Sciences Pvt. Ltd. Hyderabad, India for molecular detection. Both the centres reported it to be genotypically similar to order Pleosporales and further identification up to species level could not be done due to lack of specific primers. The genomic sequence was as follows: GAAAAAAAATGCAGGGGGGGGGCAGACAGC T C C A A G G C C G C C G G C C C C C G C G TA C A C G
www.ijmm.org
January - March 2015
167
Case Reports
C AT TAT C C A C C C T T G A C T T T G A G C A C C GTTTGTTTCCTCGGCGGGGACGCCCGCCAGCGAG GACCCCATTGAACCCTTTGCAGTAGCAGTATTTGTC T G A A A A A A A A C A C A A A A AT C A C A A C T T T C A A C A AT G G AT C T C T T G G T T C T G G C A T C G AT G A A G A A C G C A G C G A A AT G C G AT A A G TA G T G T G A AT T G C A G A AT T C A G T G A AT C AT C G A AT C T T T G A A C G C A C AT T G C G C C C C T C G G TAT T C C T T G G G G C AT G C C T G GTTTGTTTCCTCGGCGGGGACGCCCGCCAGCGAG GACCCCATTGAACCCTTTGCAGTAGCAGTATTTGTC GGTGCTTGTCCCGCCTCCCGCGCGGCGACTC GTTTGTTTCCTCGGCGGGGACGCCCGCCAGCGAG GACCCCATTGAACCCTTTGCAGTAGCAGTATTTGTC C C G C A C C C G C C G G C C AT G A G C G C A G C A C A G T GTTTGTTTCCTCGGCGGGGACGCCCGCCAGCGAG GACCCCATTGAACCCTTTGCAGTAGCAGTATTTGTC ACCCCCCAAAATTGACCTCGGATCAGGTAGGATT GTTTGTTTCCTCGGCGGGGACGCCCGCCAGCGAG CAATAAGCGGAGGAACC The patient was promptly started on antifungal therapy with Voriconazole 200 mg OD, the lesion had got completely healed and he is on regular maintenance haemodialysis. Discussion Fungal infections are an important consequence in renal transplantation and a cause of concern to patients and the physicians. Risk factors for fungal infections in transplant recipients include the use of large doses of corticosteroids, poor transplant function, recent or multiple rejection episodes, hyperglycemia, leukopenia and older age.[4,5] Reduction in the number of epidermal antigen presenting Langerhans cells, corticosteroid induced thickening and delayed desquamation of the stratum corneum because of the treatment, have also been suggested to play a role in the development of these superficial or cutaneous fungal infections.[6,7]
fungal infections especially in immunocompromised patients. Careful diagnosis and aggressive treatment play a vital role in the outcome of these infections. References 1.
Badiee P, Alborzi A. Invasive fungal infections in renal transplant recipients. Exp Clin Transplant 2011;9:355-62. 2. Patel R, Paya CV. Infections in solid-organ transplant recipients. Clin Microbiol Rev 1997;10:86-124. 3. Revankar SG, Patterson JE, Sutton DA, Pullen R, Rinaldi MG. Disseminated phaeohyphomycosis: Review of an emerging mycosis. Clin Infect Dis 2002;34:467-76. 4. Bach MC, Adler JL, Breman J, P'eng FK, Sahyoun A, Schlesinger RM, et al. Influence of rejection therapy on fungal and nocardial infections in renal transplant recipients. Lancet 1973;1:180-4. 5. Howard RJ, Simmons RL, Najarian JS. Fungal infections in renal transplant recipients. Ann Surg 1978;188:598-605. 6. Virgili A, Zampino MR, La Malfa V, Strumia R, Bedani PL. Prevalence of superficial dermatomycosis in 73 renal transplant recipients. Dermatology 1999;199:31-4. 7. Strumia R, Perini L, Tarroni G, Fiocchi O, Gilli P. Skin lesions in kidney transplant recipients. Nephron 1992;62:137-41. 8. Güleç AT, Demirbilek M, Seçkin D, Can F, Saray Y, Sarifakioglu E, et al. Superficial fungal infections in 102 renal transplant recipients: A case-control study. J Am Acad Dermatol 2003;49:187-92. 9. Gené J, Azón-Masoliver A, Guarro J, Ballester F, Pujol I, Llovera M, et al. Cutaneous phaeohyphomycosis caused by Alternaria longipes in an immunosuppressed patient. J Clin Microbiol 1995;33:2774-6. 10. McGinnis MR, Rinaldi MG, Winn RE. Emerging agents of phaeohyphomycosis: Pathogenic species of Bipolaris and Exserohilum. J Clin Microbiol 1986;24:250-9. 11. Yau YC, de Nanassy J, Summerbell RC, Matlow AG, Richardson SE. Fungal sternal wound infection due to Curvularia lunata in a neonate with congenital heart disease: Case report and review. Clin Infect Dis 1994;19:735-40. 12. Hsu MM, Lee JY. Cutaneous and subcutaneous phaeohyphomycosis caused by Exsero- hilum rostratum. J Am Acad Dermatol 1993;28:340-4. Access this article online
A study reported pityriasis versicolor as the most common cutaneous fungal infection in renal transplant recipients.[8] Although rare in clinical practice, melanised or dematiaceous fungi have become an important opportunistic pathogen, especially in immunocompromised patients. Among the dematiaceous fungi belonging to the order Pleosporales, Alternaria spp, Bipolaris spp, Curvularia spp., and Exserohilum spp, have been commonly reported to cause cutaneous and subcutaneous infections.[9-12] The fungus isolated in our case did not match with any of the above mentioned species. And this report being another case of cutaneous phaeohyphomycosis caused by a dematiaceous fungi belonging to Pleosporales, enlightens us to be aware of these unusual
Quick Response Code:
Website: www.ijmm.org PMID: *** DOI: 10.4103/0255-0857.148435
How to cite this article: Galipothu S, Kalawat U, Ram R, Kishore C, Sridhar A, Chaudhury A, et al. Cutaneous fungal infection in a renal transplantation patient due to a rare fungus belonging to order Pleosporales. Indian J Med Microbiol 2015;33:165-7.
Source of Support: Nil, Conflict of Interest: None declared
www.ijmm.org
Copyright of Indian Journal of Medical Microbiology is the property of Medknow Publications & Media Pvt. Ltd. and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use.
