Article

Crystal Structure of the Carbapenem Intrinsic Resistance Protein CarG

E.M. Tichy, B.F. Luisi and G.P.C. Salmond Department of Biochemistry, University of Cambridge, Building O, Downing Site, Cambridge CB21QW, UK

Correspondence to G.P.C. Salmond: Department of Biochemistry, University of Cambridge, Building O, Downing Site, Cambridge CB21QW, UK. http://dx.doi.org/10.1016/j.jmb.2014.02.016 Edited by M. Guss

Abstract In the Gram-negative enterobacterium Erwinia (Pectobacterium) and Serratia sp. ATCC 39006, intrinsic resistance to the carbapenem antibiotic 1-carbapen-2-em-3-carboxylic acid is mediated by the CarF and CarG proteins, by an unknown mechanism. Here, we report a high-resolution crystal structure for the Serratia sp. ATCC 39006 carbapenem resistance protein CarG. This structure of CarG is the first in the carbapenem intrinsic resistance (CIR) family of resistance proteins from carbapenem-producing bacteria. The crystal structure shows the protein to form a homodimer, in agreement with results from analytical gel filtration. The structure of CarG does not show homology with any known antibiotic resistance proteins nor does it belong to any well-characterised protein structural family. However, it is a close structural homologue of the bacterial inhibitor of invertebrate lysozyme, PliI-Ah, with some interesting structural variations, including the absence of the catalytic site responsible for lysozyme inhibition. Both proteins show a unique β-sandwich fold with short terminal α-helices. The core of the protein is formed by stacked anti-parallel sheets that are individually very similar in the two proteins but differ in their packing interface, causing the splaying of the two sheets in CarG. Furthermore, a conserved cation binding site identified in CarG is absent from the homologue. © 2014 Published by Elsevier Ltd.

Introduction Emerging resistance to the broad-spectrum, bicyclic β-lactam antibiotics of last resort, the carbapenems, is a cause of increasing concern to public health, prompting a recent global health warning by the US Centers for Disease Control and Prevention [1]. The carbapenems are a relatively small group of predominantly semi-synthetic β-lactam antibiotics. Unfortunately, naturally occurring carbapenems such as thienamycin (the first carbapenem discovered, from Streptomyces cattleya) and 1-carbapen-2-em-3-carboxylic acid are too unstable for clinical use [2,3]. Among the Gram-negative bacteria, naturally occurring carbapenem production is limited to a small group of enterobacteria, including Serratia sp. ATCC 39006 (S. 39006), Photorhabdus luminescens TT01, various Erwinia carotovora subsp. carotovora (Ecc) strains, and Erwinia herbicola [4–6] (reviewed in Ref. [7]). However, cryptic car gene clusters have been reported in several strains [8]. To date, more than 80 carbapenem-derived compounds, 0022-2836/$ - see front matter © 2014 Published by Elsevier Ltd.

most with improved antimicrobial properties and stability, have been described in the literature, although few of these are currently clinically employed [9]. Their broad spectrum of target species, combined with their propensity to be poor substrates for most clinically encountered β-lactamases that hydrolytically inactivate β-lactams, makes them the antibiotic of choice in the treatment of many β-lactamaseproducing pathogens, particularly those expressing extended spectrum β-lactamases. However, in recent years, pathogen resistance to carbapenems has been emerging clinically and spreading at an accelerating rate [1]. In some Ecc strains and S. 39006, carbapenem production is under the control of the car gene cluster. This operon involves five well-characterised biosynthetic genes (carA, carB, carC, carD, and carE), intrinsic resistance genes (carF and carG), and a gene of unknown function (carH). The car cluster is controlled by a complex hierarchical regulatory network that includes quorum sensing [10]. In Ecc, the latter is mediated through diffusible N-acyl-homoserine J. Mol. Biol. (2014) 426, 1958–1970

1959

Crystal Structure of CarG

(a) 175

pEMT5

pQE80 ori T W

Sh

P

W

Sh

P

80 58 46 30 25 17

(b)

pQE80 ori T 175 W Sh P 80

pEMT5 W

Sh

P

58 46 30 25 17

Fig. 1. Cellular localisation of CarGS.39006. Overexpression of FLAG-tagged CarGS.39006 from pEMT5 was induced by addition of 1 mM IPTG. Cultures were subjected to osmotic shock by dilution of the slurry with two volumes of ice-cold water (wash, W). The periplasmic fraction was isolated by centrifugation (shockate, Sh) and the pellet was resuspended in an equal volume PBS (pellet, P). Proteins were separated by SDS-PAGE and detection of β-lactamase and the FLAG tag was carried out by Western blotting. (a) Blotting against β-lactamase. (b) Blotting against FLAG tag. Molecular masses of the standards are given in kilodaltons on the left-hand side. β-Lactamase expressing pQE80oriT was used as a fractionation control, as well as a negative control for CarG expression from pEMT5 (pQE80oriT-CarG-His 6).

lactone binding, ultimately leading to the transcription or activation of the product of the upstream regulator, carR [11]. This encodes a LuxR-type transcriptional activator of the carA–carH operon. While the biosynthesis of the carbapenem and the control of the cluster have been the subject of extensive research in recent years, little work has been performed to elucidate the function of the intrinsic resistance determinants, namely, the gene products of carF and carG. For more information and recent work on car cluster regulation and carbapenem biosynthesis in S. 39006 and Ecc, see Refs. [10] and [12–17].

Previous work in Ecc showed that intrinsic resistance proteins CarF Ecc and CarG Ecc are highly conserved among carbapenem-producing isolates. These proteins do not show β-lactamase activity, cross-resistance to clinically employed carbapenems (such as meropenem and imipenem), or homology with any proteins known to be involved in antibiotic resistance [11,18,19]. Mutagenesis of the resistance genes showed that CarF and CarG have complementary and additive effects, each individually conferring partial carbapenem resistance by an unknown mechanism [19]. CarF and CarG have no discernable sequence similarity. There are various possible mechanisms by which CarG might protect the carbapenem-producing bacterium from attack by the antibiotic that could result in the complementary and additive resistance phenotype observed with CarF. Generally, known β-lactam resistance mechanisms can be divided into five groups. These are (i) alterations to the molecular targets of β-lactams, the penicillin binding proteins (PBPs); (ii) reduction of antibiotic uptake by the deletion or modification of porin proteins in the membrane; (iii) the acquisition and activation of efflux exporters; (iv) cell wall modification to minimise β-lactam target access; and (v) the action of β-lactamases (reviewed in Refs. [20] and [21]). A number of these mechanisms have been reported for pathogen resistance to clinically employed carbapenem antibiotics, including porin loss and modification [22–25], efflux [26], and the production of “carbapenemases” [27–29]. Because of the serious clinical implications of emerging carbapenem resistance in pathogens, such resistance traits have been studied extensively in recent years [30,31]. However, because of strong positive selection though widespread antibiotic usage, new carbapenem resistance mechanisms are emerging, presumably driven in part by horizontal gene transfer into clinical isolates from naturally occurring, non-pathogenic strains [31,32]. This study describes the first structure of the carbapenem intrinsic resistance (CIR) family of intrinsic carbapenem resistance mechanisms. Understanding the mechanisms of intrinsic carbapenem resistance may serve to further our understanding of the emergence of resistance in clinical strains.

Results and Discussion CarGS.39006 is periplasmically located In previous studies, CarFEcc, CarGEcc, and CarHEcc were shown to be localised to the periplasm of Erwinia (also known as Pectobacterium) on the basis of functional phoA fusions, pulse-chase analyses, and cold osmotic shock experiments [19]. In Serratia sp. ATCC 39006, CarFS.39006, CarGS.39006, and CarHS.39006 have predicted classical (Sec-dependent)

1960

Crystal Structure of CarG

Table 1. Crystallographic data collection and refinement statistics for CarG6His Data collection CarG native

CarG-SeMet

0.978 P21

0.9793 P3221

45.47, 66.82, 50.46 90, 95.69, 90 28.91–1.74 (1.77–1.74) 30,381 (1526) 2.4 (2.3) 11.2 (1.9) 98.0 (87.3) 0.048 (0.469) — —

50.95, 50.95, 113.87 90, 90, 120 44.09–2.50 (2.60–2.50) 6376 (706) 8.8 (4.8) 14.6 (2.6) 100 (99.9) 0.079 (0.555) 99.7 (98.7) 4.6 (2.4)

Wavelength (Å) Space group Unit cell dimensions a, b, c (Å) α, β, γ, (°) Resolution (Å) No. of unique reflections Multiplicity I/σ(I) Completeness Rmergea Anomalous completeness Anomalous multiplicity Refinement Protomers per asymmetric unit Biological units per asymmetric unit Solvent content (%) Rwork (%)b Rfree (%)c Model resolution (Å) Ramachandran favoured (%) Ramachandran outliers (%) MolProbity score RMSD bonds/angles (Å/°)

2 1 38.7 0.182 0.237 30–1.8 97.48 0.6 2.01 0.021/1.9

1 1 45 0.230 0.319 30–2.5

Rfree was calculated from 5% total reflections, which were not used in refinement. ∑ ∑ I −angleðI Þj a R merge ¼ ∑j ∑ I : hkl

j

hkl; j

hkl

hkl j hkl; j ∑jj F obs j−j F calc jj ∑j F obs j

b

R work ¼

c

R free ¼ ∑j F∑j F− F j j:

:

obs

calc

obs

export signal sequences (data not shown). As shown in Fig. 1, CarGS.39006 was also localised to the periplasm in cold osmotic shock assays; these results are consistent with a periplasmic localisation for CarGS.39006. Structure determination of CarGS.39006 Recombinant CarGS.39006 with a C-terminal hexahistidine tag was overexpressed and purified as described in Materials and Methods. The hexahistidine tag does not affect protein function, as demonstrated by the Escherichia coli ESS (Escherichia coli β-lactam supersensitive) carbapenem lethality bioassay described in Materials and Methods (data not shown). The crystal structure of selenomethionine (SeMet)labelled CarGS.39006 was solved to 2.5 Å resolution by experimental single-wavelength anomalous diffraction phasing (see Table 1). This initial structure was used for molecular replacement with the native CarG data set in a different space group to solve the structure of CarG to 1.8 Å resolution. The observed asymmetric unit consists of a dimer of CarGS.39006, with dimensions of approximately 62 Å × 46 Å × 46 Å, and the monomers are related by 2-fold non-crystallographic symmetry. The dimensions of the monomer are approximately 34 Å ×

46 Å × 33 Å. The dimerisation of CarGS.39006 was confirmed by analytical gel filtration. CarGS.39006 eluted at a volume corresponding to a molecular mass of approximately 33 kDa, which is consistent with the predicted molecular mass of the CarGS.39006 dimer (38.8 kDa), within the error calculated (data not shown). As shown in Fig. 2, CarGS.39006 is predominantly a β-structural protein. The monomer is composed of two sheets of four anti-parallel β-strands each. Sheet 1 consists of β1–β4 and Sheet 2 comprises β5–β8. This is followed by two short C-terminal α-helices, α1 and α2 (see Fig. 3). The symmetry axis is roughly perpendicular to the direction of the β-sheets and is depicted as a filled oval in Fig. 2.The first of the helices, α1, which is 7 amino acids in length, is packed against the outer face of the second β-sheet and is flanked by the conserved residues Tyr139 and Ser141 (N-terminus) and Val150 (C-terminus). Interestingly, this helix is followed by a second, even shorter helix (residues 152–155), which is not conserved (for sequence comparisons, see Fig. 3c). In CarGS.39006, this second helix is also packed against the outer face of the second β-sheet. Packing of the second helix, α2, is stabilised by extensive hydrophobic interactions. The C-terminal Leu155 of helix α2 is packed into a non-polar pocket

1961

Crystal Structure of CarG

(a)

180° Loop 2 Loop 4

Loop 7

(b)

Fig. 2. The structure of CarGS.39006. (a) Cartoon representation of the CarGS.39006 dimer. CarG is represented by the blue ribbons. The complexed sodium atom is shown in green. The 2-fold non-crystallographic symmetry axis is represented by a black filled oval. (b) Calculated surface structure of the CarGS.39006 dimer.

generated by residues from strands β5 (Phe83), β6 (Tyr90 and Val92), and β7 (Ile111). Further hydrophobic contacts are made by Met154 of α2 with Leu109 (β7), Ile111 (β7), and Val134 (β8). Glu152 of the α2 helix is exposed to solvent. Helix α1 is not as strongly amphipathic as α2. Packing of α1 against Sheet 2 is stabilised by hydrophobic interactions of the side chain of Tyr147 with Arg81 (β5) and Val92 (β6), as well as interactions of Ala146 with Val107 (β7), Leu109 (β7), and Ala136 (β8). The N-terminal Ala143 of helix α1 makes hydrophobic interactions with Lys96 (β6) and Val107 (β7). The packing of α1 against Sheet 2 is also stabilised by the formation of a hydrogen bond between Tyr147 and Asp79 (β5). Furthermore, the relative conformations of the α1 and α2 helices are stabilised by hydrophobic interactions between Loop 9 and Sheet 2 [Val150 with Phe83 (β5), Val92 (α6), and Leu109 (β7)]. Many of the intrastrand loops are solvent exposed. The first of the exposed loops, L1, complexes a metal atom, described below. Interestingly, the exposed areas of the loops seem, in general, to be the most highly conserved areas when the

CarGS.39006 sequence is aligned with that of known functional homologues (see Fig. 3). The dimer interface of CarGS.39006 CarGS.39006 dimerisation occurs mainly through sheet–sheet interactions and involves residues from every strand in the N-terminal β-sheet, Sheet 1 (see Fig. 4). The size of the dimer interface was calculated as 1293 Å 2 using the PDBePISA algorithm [33]. The interaction is classified by PISA as essential for complex formation (CSS score, 0.677). Extensive hydrophobic interactions and good surface complementarity result in a well-consolidated interface that is stabilised by extensive hydrophobic β-sheet interactions, hydrogen bonds, and 2-fold symmetry (see Fig. 4) as detailed in Table 2. Additional stabilisation of the dimer interface is provided by the symmetric interactions of the L2 and L7 loops. As shown in Fig. 4, the dimer interface is consolidated by extensive interaction between these two loops, and these occur twice through symmetry. The L2–L7 loop interactions are also detailed in Table 2. Interaction with Asn32 in Loop 2 stabilises the conformation of

1962

Crystal Structure of CarG

Fig. 3. Structure of the CarG monomer. (a) Topology diagram of CarGS.39006. The indicated amino acids in Loop 1 are part of a conserved region among CarG homologues. The aspartate and asparagine residues (in orange) are used to complex a metal atom and are part of the putative active site of the protein. (b) Cartoon representation of CarGS.39006 forming a two-β-sheet sandwich. (c) Structure-based sequence alignment of CarG and its homologues. CarG secondary structure as determined by the crystal structure and aligned with the protein sequence. Amino acids are shaded in accordance with CarG sequence conservation within the CarG sequence homologues that are known to confer carbapenem resistance. A black background indicates a fully conserved residue. The observed secondary structural elements in the crystal structure of CarGS.39006 are shown in blue and numbered sequentially. Residues involved in CarG dimerisation are highlighted by green boxes. Residues involved in cation coordination (see also Fig. 5) are marked by an asterisk (*), orange for aspartate and yellow for asparagine.

Loop 7. The amide substituent of the Asn32 side chain is sandwiched between the two carbonyls of Val123 and Ser117. The carbonyl group of the Asn32 side

chain accepts a hydrogen bond from the backbone amide of Asp119, although the geometry is not optimal for hydrogen bonding. Furthermore, the L2 and L7

1963

Crystal Structure of CarG

(a)

(b)

Loop 2

Loop 7

Loop 7 Loop 2

(c)

(d)

Fig. 4. The CarGS.39006 dimer interface. (a) Overlay of native (in blue) and SeMet CarGS.39006 structures (in purple). Complexed metal atoms are shown in green. The RMSD is 0.159 Å. (b) Cartoon depictions of the native CarGS.39006 dimer (monomers in green and blue) showing loops involved in the dimerisation interface (in purple/dark blue) and residues likely to be involved in sheet–sheet interactions (in orange). (c) The L2–L7 dimer interface. (d) The sheet–sheet interface. The carbon backbone of the CarG monomers are shown in green and blue, respectively. Hydrogen bonds are shown as orange broken lines. van der Waals' interactions are shown as black broken lines.

loops engage in multiple van der Waals' interactions, as shown by black broken lines in Fig. 4 and summarised in Table 2. These residues are highly conserved within the known functional CarGS.39006

homologues. Residues involved in dimerisation are highlighted in Figs. 3c and 4b. Structural variation of the dimer interface was evaluated by overlaying the native CarGS.39006 dimer

1964

Crystal Structure of CarG

Table 2. Residues involved in CarG dimerisation Interaction type van der Waals Sheet–sheet

L2–L7 Loop

a b

Phe43

Asp30 Asn31

Thr41

Leu125 Pro124

Backbone-to-backbone interaction. Main chain-to-side chain interaction.

(a)

Hydrogen bond Acceptor Tyr23 Asp30 Asp30 Asp30 Tyr51a Gln28a Val123b Ser117b Asp120b Asn32b Asp30a

Donor Val10 Gln28 Arg46 Ser52 Gln28a Ile53a Asn32b Asn32b Asn32b Asp119b Leu125a

with the dimer of SeMet CarGS.39006 that is generated by crystal symmetry. As shown in Fig. 4a, there is no significant movement between the two independently refined crystal structures, suggesting that the dimerisation interface is quite rigid. Metal complexing A metal atom was seen to be complexed with Loop 1 of CarGS.39006. This metal atom is likely to be nickel, sodium, or potassium due to its typical octahedral coordination. As the metal atom did not yield an anomalous diffraction signal, nickel was ruled out. The complexed metal is more likely to be sodium than potassium as the CarGS.39006 purification and crystallisation buffers contained the former but not the latter. As illustrated in Fig. 5, the putative sodium is

Loop1 D18

N16

(b)

(c)

Fig. 5. The CarG putative active site. (a) CarGS.39006 monomer (in blue) with its complexed Na/K atom (in green). Residues involved in metal complexing are shown in orange (aspartate) and yellow (asparagine). (b) Close-up of residues involved in metal complexing. The coordinated sodium ion is depicted by green spheres. Pink spheres denote water. Hydrogen bonds are shown as orange broken lines. Chelating interactions are shown as green broken lines. (c) Stereoscopic view of omit map calculated with sodium removed from the model. The green density is the difference map, showing a positive feature at the missing sodium. The map has been contoured at five standard deviations. The blue map shows the weighted refined map. The sticks represent the superimposed refined model.

1965

Crystal Structure of CarG

complexed by an approximately octahedral conformation of Asp14, Asn16, Asp18, Asp22, and water. Sequence analyses of known functional CarGS.39006 homologues showed that Asp14, Asn16, and Asp22 are conserved across all functional homologues of known sequence. Asp18 is partially conserved and replaced by glycine in CarGEcc (see Fig. 3c). The complexing of sodium may be used to stabilise either the conformation of Sheet 1 or the dimer

interface. It is not, in itself, involved in dimerisation of CarGS.39006 because this site is not part of the dimer interface. It may also serve to present an exposed flat surface with a protruding Lys21 residue. The extensive stabilisation of the loops in CarGS.39006, in conjunction with an unusually high degree of conservation of these areas, invites speculation that the presentation of these loops, particularly Loop 1 with its complexed metal atom, may have functional significance. It is

(b)

(a)

CarG

L4 PliI-Ah

PliI-Ah Loop 4 CarG

(c)

RMSD = 4.0Å

(d)

(e)

Loop 4 RMSD = 2.5Å

RMSD = 2.6Å

Fig. 6. Overlay of CarG and PliI-Ah structures.CarG is shown in blue. PliI-Ah is shown in orange. (a) Overlay of CarGS.39006 and PliI-Ah monomers. The RMSD value is 4.0 Å (over 122 residues, with 10.4% sequence identity) and the Z-score from the Dali server is 4.8. (b) The CarG (top) and PliI-Ah dimers (bottom). Reference frame as in (a). (c) Composite overlay of CarGS.39006 and PliI-Ah monomers generated by disconnecting Sheet 1 and Sheet 2. (d) Overlay of CarGS.39006 and PliI-Ah Sheet 1. The RMSD value is 2.5 Å (over 56 residues, with 25% sequence identity). (e) Overlay of CarGS.39006 and PliI-Ah Sheet 2. The RMSD value is 2.6 Å (over 56 residues, with 7.1% sequence identity).

1966 formally possible that the exposed loops may allow docking of CarGS.39006 onto a partner molecule such as peptidoglycan. CarG shows structural homology with inhibitors of invertebrate lysozyme CarGS.39006 does not show structural homology to any proteins known to be involved in β-lactam resistance. The closest structural homologue found was the Aeromonas hydrophila lysozyme inhibitor PliI-Ah using the Dali server [34] as shown in Fig. 6. PliI family proteins are dimeric periplasmic inhibitors of invertebrate (I-type) lysozymes and are thought to inactivate I-type lysozymes using a conserved SGxY motif located on Loop 6 [34]. This inactivation is thought to involve an insertion of Loop 6 into the active site of the enzyme. However, the precise mechanism of this interaction is unknown [35,36]. While there are many structural similarities between CarGS.39006 and PliI-Ah, there is little sequence identity. No PliI family lysozyme inhibitors were identified in the genera Serratia and Erwinia or in P. luminescens. As shown in Fig. 6, in the dimer, PliI-Ah monomers are related by a 2-fold non-crystallographic symmetry axis perpendicular to the direction of the β-sheets in a similar fashion to CarGS.39006. Like CarGS.39006 and, indeed, like all known periplasmic lysozyme inhibitors including members of the PliG and PliC families [36], PliI-Ah is a predominantly β-structural protein. Similar to CarGS.39006, PliI-Ah reveals a double-β-sandwich structure. This sandwich consists of two sheets of four strands each and is followed by a single C-terminal α-helix (as opposed to two α-helices in CarGS.39006). While the two helices of CarGS.39006 make extensive interactions with the strands of Sheet 2, the PliI-Ah helix is conserved by a single leucine–isoleucine interaction with the β6 strand of Sheet 2 [35]. PliI-Ah and CarGS.39006 share the same anti-parallel sheet topology. However, while the β1 and β4 strands in Sheet 1 of CarGS.39006 are significantly shorter than β2 and β3, this is not the case in PliI-Ah. As shown in Fig. 6b, superimposition shows that the sheets are splayed in CarGS.39006 relative to PliI-Ah. Interestingly, it is possible to obtain a much closer overlay of Sheets 1 and 2 independently of each other (compare Fig. 6c and d with b). These overlays showed that the core β-strands of each sheet (particularly in Sheet 2) correspond well, while the loops connecting the strands are highly variable. RMSD values for these superimpositions are shown in Fig. 6. Independent superimposition of the two PliI-Ah sheets onto the CarGS.39006 monomer (Fig. 6e) showed that the β-sheets are splayed in CarGS.39006 in a fan-like effect when compared to PliI-Ah. This shift is accompanied by the elongation of Loop 4 to 23 amino acids in CarGS.39006. As shown in Figs. 2 and 3, this inserted

Crystal Structure of CarG

bulge is exposed on the surface of the protein and is highly conserved within the functional CarGS.39006 homologues. It is interesting that the β-sheets have changed their relative orientations in the course of evolution. While the PliI-Ah dimerisation interface is formed predominantly by hydrophobic interactions of residues in strands β3 and β4 in addition to hydrogen bonds formed by residues in β3 and β4 and loops L2 and L3 [35], CarGS.39006 dimerisation occurs mainly through sheet–sheet interactions and involves residues from every strand in the N-terminal β-sheet, Sheet 1 (see Fig. 4). PliI-Ah is known to function by inserting the catalytic residues of Loop 6 into the lysozyme active site. The inhibitory SGxY motif is not present in CarGS.39006. The conserved S. 39006 metal complexing DLNxxGxxD motif is not present in the PliI-Ah homologue described above. Furthermore, the PliI-Ah structure does not show any complexed metal atoms.

Concluding Remarks Here, we report the X-ray crystallographic structure of CarGS.39006, the first in the CIR family of proteins. CarGS.39006 is a dimer with a characteristic splayed β-sheet sandwich fold with two small C-terminal helices. A cation binding site with a conserved DLNxxGxxD motif was identified and presents a putative recognition surface. However, the CarGS.39006 structure does not show similarity with proteins known to be involved in β-lactam resistance such as PBPs, porins, or β-lactamases. The CarGS.39006 structure was found to be homologous with the periplasmic A. hydrophila lysozyme inhibitor PliI-Ah. It is not known whether CarGS.39006 exhibits lysozyme-inhibitory properties, as well as conferring resistance to carbapenem. The conservation of the core β-sheets between the periplasmic lysozyme inhibitor PliI-Ah and the periplasmic carbapenem resistance protein makes speculation on an evolutionary relationship between the two proteins appealing, particularly as both lysozymes and carbapenems act on peptidoglycan. Furthermore, structural studies of PBPs, the site of attack for β-lactam antibiotics, have shown striking similarities between PBP2S.aureus and PBP1a from the thermophilic extremophile Aquifex aeolicus and bacteriophage λ lysozyme [37]. These structural similarities suggest that CarGS.39006 may be interacting with PBPs. A number of formal possibilities exist as to its precise mode of action. Non-essential PBPs have been reported as “traps” for incoming β-lactam antibiotics, thus preventing attack on essential PBPs [38]. CarGS.39006 could also be protecting the PBPs from attack by the carbapenem by blocking the active site or modifying the enzyme. Alternatively,

1967

Crystal Structure of CarG

CarGS.39006 could be sequestering or modifying the carbapenem, although it does not show β-lactamase activity [18]. While it was not possible to infer the mode of action or target of CarGS.39006 from its structure, a number of possible sites of interest for CarG activity, and thus further study, were identified. Site-directed mutagenesis of these regions may elucidate the structural features involved in carbapenem resistance conferred by CarGS.39006. The clinical importance of the carbapenems for the treatment of life-threatening drug-resistant infections is undeniable. With the recent emergence and dissemination of carbapenemases in some pathogens, the clinical utility of these key antibiotics may now be under increasing threat. Consequently, there is a critical need to understand all possible mechanisms of carbapenem resistance and this includes the modes of intrinsic resistance in bacterial producers of carbapenems. Although, fortunately, the CarF and CarG proteins do not currently confer cross-resistance to the clinically efficacious carbapenems, increasing use of such antibiotics conceivably could enhance the positive selection for evolution of new forms of resistance. It is formally possible that mutant CarF or CarG derivatives may evolve to confer a broader spectrum of resistance than that currently seen against the simple carbapenem (1-carbapen-2-em-3-carboxylic acid). Were that to happen, then given the promiscuous capacity for horizontal gene transfer among the enterobacteria, such evolution could present a very worrying future scenario.

Materials and Methods

protein was amplified with its signal peptide and with a primer-encoded C-terminal hexahistidine tag using Phusion® High-Fidelity DNA Polymerase (New England Biolabs) with primers carG-F3 (5′-GATGAGGAGAAATTAACTATGATAA ATAAATGCTTC-3′) and carG-R2 (5′-CTAGCTCAGCT CAGTGATGGT GATGGTGATGTCTTGTTAACAT TGCCTC-3′). After digestion with BseRI and BlpI (recognition sites underlined in primers), the resulting fragment was ligated into pQE80oriT [45], placing expression of carG under the control of the IPTG-inducible T7 promoter. The resulting plasmid, pEMT2, was introduced into S. 39006 by mating with E. coli β2163 as described in Ref. [40]. CarG expression and purification All recombinant constructs were expressed in Serratia sp. ATCC 39006 lac − in LB medium at 16 °C and induced at OD600 (optical density at 600 nm) = 0.6 with IPTG at a final concentration of 1 mM. SeMet-labelled protein was produced according to the method published by Paterson et al. [46] but in S. 39006 at 30 °C. All constructs were purified by immobilised metal affinity chromatography followed by anion-exchange chromatography and gel filtration. Protein was purified from a clarified whole cell lysate with Ni-NTA agarose (Qiagen) according to the manufacturer's guidelines [lysis buffer: 50 mM NaH2PO4, 300 mM NaCl, 10 mM imidazole, and 0.02% Tween-20 (pH 8.0)]. Elution fractions were pooled and dialysed overnight against low-salt buffer [20 mM NaCl, 50 mM Tris, 1 mM DTT, and 0.02% Tween-20 (pH 8.0)] for further purification using a HiTrap™ Q Sepharose anion-exchange column (GE Healthcare) line with an ÄKTA explorer FPLC machine (GE Healthcare). Further purification was carried out by gel filtration of pooled, concentrated elution fractions using a Superdex 75 column (GE Healthcare) in 300 mM NaCl, 50 mM Tris, 1 mM DTT, and 0.02% Tween-20 (pH 8.0). Localisation by cold osmotic shock

Bacterial strains and plasmids All strains and plasmids used in this study are listed in Table 3. The S. 39006 carG gene encoding the CarG CIR

In order to localise CarGS.39006, we expressed the C-terminally FLAG-tagged protein in S. 39006 from the IPTG-inducible pEMT5 expression plasmid by addition of

Table 3. Bacterial strains and plasmids Strain E. coli DH5α β2163 ESS

Genotype/features

Reference

Derivative of Hoffmann-Berling strain 1100 F′ (Φ80dlacZ ΔM15) Δ(lacZYA-argF)U169 deoR recA1 hsdR17(rK-mK+) endA1 phoA supE44 λ- thi-1 (F) RP4-2-Tc∷Mu ΔdapA∷(erm-pir) [KmR EmR] β-Lactam supersensitive indicator strain

[39]

Erwinia carotovora subsp. carotovora ATTn10 ATCC 39048∷Tn10 restrictionless SM10 Derivative of ATTn10 ΔcarRABCDEFGH Serratia sp. ATCC 39006 LacA Lac- derivative of ATCC 39006 wild type (Car+ Pig+) Plasmids pEMT2 pQE80oriT-carG-His6 pEMT5 pQE80oriT-carG-FLAG pQE80oriT Derivative of pQE80 carrying oriT

[40] Beecham Pharmaceuticals, [41,42] [18] [19] [43,44] This study This study [45]

1968 1 μM IPTG at 16 °C overnight. Cold osmotic shock according to Rathore et al. [47] was used to isolate a periplasmic fraction (shockate) and a whole cell fraction (pellet). The presence of the protein was detected by Western blotting against the FLAG tag. As the pQE80oriT plasmid carries the blagene (encoding β-lactamase) to allow selection with ampicillin, it expresses periplasmically located β-lactamase. The expression of this protein was also detected via Western blotting as a control for periplasmic fractionation. ESS killing carbapenem resistance bioassay Carbapenem resistance in bacterial strains of interest was assayed using the E. coli ESS killing bioassay described previously [19]. Crystallisation and data collection Screening for crystallisation conditions was performed using the vapour diffusion method in sitting drops (50% precipitant in a drop volume of 0.4 μl). The following commercially available pre-dispensed screens in 96-well plates were used: AmSO4, Classics, Classics Lite, pH Clear I, pH Clear II, PEGs I, PEGs II, Protein Complex (Qiagen), JCSG +, MBClass II, MemGold, MIDAS, Morpheus (Molecular Dimensions), and Wizard I & II (Emerald Biosystems). Plates were set up using an Oryx6 robot (Douglas Instruments Ltd.) and monitored using a Rock Imager 1000 (Formulatrix) automated crystallisation imaging system. The best CarGS.39006 crystals were obtained with 30% PEG (polyethylene glycol) 1500. The best SeMet CarGS.39006 crystals were obtained at 30% PEG 400 and 0.1 M 4-morpholineethanesulfonic acid (pH 6.5). X-ray diffraction data were collected at the IO2 beamline (Diamond Light Source, Oxfordshire, UK). All data collection statistics are summarised in Table 1.

Crystal Structure of CarG

dine-tagged CarGS.39006 purified as described above. Gel filtration was performed on an S-200 analytical gel-filtration column (GE Healthcare) and elution volumes compared to those obtained using standards of known molecular mass (Gel Filtration Markers Kit for Protein Molecular Weights 12,000–200,000 Da; Sigma-Aldrich). Accession numbers Atomic coordinates and structure factor files have been deposited with the PDB (PDB ID 4O7J).

Acknowledgements The authors would like to thank Xue Pei and Jarrod Voss, as well as Francesca Short and Feng Rao for their guidance and advice on protein purification and crystallography. Thanks also to Harry Jubb for bioinformatic analyses and to Dima Chirgadze for help with crystallisation equipment. X-ray diffraction data collection was carried out at the IO2 beamline at Diamond Light Source. This work was supported by a Herchel Smith PhD scholarship to E.T. B.L. is supported by the Wellcome Trust. Received 30 December 2013; Received in revised form 15 February 2014; Accepted 20 February 2014 Available online 28 February 2014 Keywords: antibiotic; bacterial resistance; carbapenem operon; lysozyme inhibitor; CIR family

Structure solution, refinement, and validation X-ray diffraction data sets obtained from both native and SeMet crystals of CarGS.39006 were processed using iMOSFLM [48] and SCALA [49] in the CCP4 programme suite † [50]. Initial phase estimates and an electron density map were calculated from SeMet data sets using PHENIX AUTOSOL [51], which allowed the automatic building of a 45% complete model of CarGS.39006 with Buccaneer [52]. Structural refinement with REFMAC5 [53] and iterative manual model building using Coot [54] resulted in a 60% complete model of SeMet CarGS.39006. This was used as a model for molecular replacement with the higher-resolution native data set using Phaser [55]. Structural refinement of this model was performed using REFMAC5 and, in combination with iterative model building with Coot, yielded a 100% complete model of CarGS.39006. The quality of the final model was assessed with PROCHECK [56] and MolProbity [57]. Figures were prepared with PyMOL. Analytical gel filtration CarGS.39006 complex formation was assayed by analytical gel filtration as described by Whitaker [58], using hexahisti-

† http://www.ccp4.ac.uk Abbreviations used: CIR, carbapenem intrinsic resistance; PBP, penicillin binding protein; SeMet, selenomethionine.

References [1] McKenna M. Antibiotic resistance: the last resort. Nature 2013;499:394–6. [2] Moellering RC, Eliopoulos GM, Sentochnik DE. The carbapenems: new broad spectrum beta-lactam antibiotics. J Antimicrob Chemother 1989;24:1–7. [3] Fukasawa M, Sumita Y, Harabe ET, Tanio T, Nouda H, Kohzuki T, et al. Stability of meropenem and effect of 1 betamethyl substitution on its stability in the presence of renal dehydropeptidase 1. Antimicrob Agents Chemother 1992;36:1577–9.

Crystal Structure of CarG

[4] Parker WL, Rathnum ML, Wells JS, Trejo WH, Principe PA, Sykes RB. A simple carbapenem produced by species of Serratia and Erwinia. J Antibiot 1982;35:653–60. [5] McGowan SJ, Bycroft BW, Salmond GP. Bacterial production of carbapenems and clavams: evolution of β-lactam antibiotic pathways. Trends Microbiol 1998;6:203–8. [6] Derzelle S, Duchaud E, Kunst F, Danchin A, Bertin P. Identification, characterization, and regulation of a cluster of genes involved in carbapenem biosynthesis in Photorhabdus luminescens. Appl Environ Microbiol 2002;68:3780–9. [7] Whitehead NA, Barnard AM, Slater H, Simpson NJ, Salmond GP. Quorum sensing in Gram-negative bacteria. FEMS Microbiol Rev 2001;25:365–404. [8] Holden MT, McGowan SJ, Bycroft BW, Stewart GS, Williams P, Salmond GP. Cryptic carbapenem antibiotic production genes are widespread in Erwinia carotovora: facile trans activation by the carR transcriptional regulator. Microbiology 1998;144:1495–508. [9] Papp-Wallace KM, Endimiani A, Taracila MA, Bonomo RA. Carbapenems: past, present, and future. Antimicrob Agents Chemother 2011;55:4943–60. [10] Coulthurst SJ, Barnard AML, Salmond GPC. Regulation and biosynthesis of carbapenem antibiotics in bacteria. Nat Rev Microbiol 2005;3:295–306. [11] McGowan S, Sebaihia M, Jones S, Yu B, Bainton N, Chan P, et al. Carbapenem antibiotic production in Erwinia carotovora is regulated by CarR, a homologue of the LuxR transcriptional activator. Microbiology 1995;141:541–50. [12] Wilf NM, Williamson NR, Ramsay JP, Poulter S, Bandyra KJ, Salmond GP. The RNA chaperone, Hfq, controls two luxRtype regulators and plays a key role in pathogenesis and production of antibiotics in Serratia sp. ATCC 39006. Environ Microbiol 2011;13:2649–66. [13] Poulter S, Carlton TM, Spring DR, Salmond GP. The Serratia LuxR family regulator CarR39006 activates transcription independently of cognate quorum sensing signals. Mol Microbiol 2011;80:1120–31. [14] Clifton IJ, Doan LX, Sleeman MC, Topf M, Suzuki H, Wilmouth RC, et al. Crystal structure of carbapenem synthase (CarC). J Biol Chem 2003;278:20843–50. [15] Bodner MJ, Li RF, Phelan RM, Freeman MF, Moshos K, Lloyd EP, et al. Definition of the common and divergent steps in carbapenem beta-lactam antibiotic biosynthesis. ChemBioChem 2011;12:2159–65. [16] Phelan RM, Townsend CA. Mechanistic insights into the bifunctional non-heme iron oxygenase carbapenem synthase by active site saturation mutagenesis. J Am Chem Soc 2013;135:7496–502. [17] Hamed RB, Gomez-Castellanos JR, Henry L, Ducho C, McDonough MA, Schofield CJ. The enzymes of β-lactam biosynthesis. Nat Prod Rep 2013;30:21–107. [18] McGowan SJ, Sebaihia M, Porter LE, Stewart GSAB, Williams P, Bycroft BW, et al. Analysis of bacterial carbapenem antibiotic production genes reveals a novel β-lactam biosynthesis pathway. Mol Microbiol 1996;22:415–26. [19] McGowan SJ, Sebaihia M, O'Leary S, Hardie KR, Williams P, Stewart GSAB, et al. Analysis of the carbapenem gene cluster of Erwinia carotovora: definition of the antibiotic biosynthetic genes and evidence of a novel β-lactam resistance mechanism. Mol Microbiol 1997;26:545–56. [20] Fisher JF, Meroueh SO, Mobashery S. Bacterial resistance to β-lactam antibiotics: compelling opportunism, compelling opportunity. Chem Rev 2005;105:395–424.

1969 [21] Drawz SM, Bonomo RA. Three decades of beta-lactamase inhibitors. Clin Microbiol Rev 2010;23:160–201. [22] Tängden T, Adler M, Cars O, Sandegren L, Löwdin E. Frequent emergence of porin-deficient subpopulations with reduced carbapenem susceptibility in ESBL-producing Escherichia coli during exposure to ertapenem in an in vitro pharmacokinetic model. J Antimicrob Chemother 2013;68:1319–26. [23] Chow JW, Shales DM. Imipenem resistance associated with the loss of a 40 kDa outer membrane protein in Enterobacter aerogenes. J Antimicrob Chemother 1991;28:499–504. [24] Armand-Lefèvre L, Leflon-Guibout V, Bredin J, Barguellil F, Amor A, Pagès JM, et al. Imipenem resistance in Salmonella enterica serovar Wien related to porin loss and CMY-4 betalactamase production. Antimicrob Agents Chemother 2003;47:1165–8. [25] Correa L, Martino MDV, Siqueira I, Pasternak J, Gales AC, Silva CV, et al. A hospital-based matched case-control study to identify clinical outcome and risk factors associated with carbapenem-resistant Klebsiella pneumoniae infection. BMC Infect Dis 2013;13:80. [26] Bornet C, Chollet R, Mallèa M, Chevalier J, Davin-Regli A, Pagès JM, et al. Imipenem and expression of multidrug efflux pump in Enterobacter aerogenes. Biochem Biophys Res Commun 2003;301:985–90. [27] Yang YJ, Wu PJ, Livermore DM. Biochemical characterization of a beta-lactamase that hydrolyzes penems and carbapenems from two Serratia marcescens isolates. Antimicrob Agents Chemother 1990;34:755–8. [28] Queenan AM, Bush K. Carbapenemases: the versatile βlactamases. Clin Microbiol Rev 2007;20:440–58. [29] Nordmann P, Poirel L. Strategies for identification of carbapenemase-producing Enterobacteriaceae. J Antimicrob Chemother 2013;68:487–9. [30] Nordmann P, Naas T, Poirel L. Global spread of carbapenem-producing Enterobacteriaceae. Emerg Infect Dis 2011;17:1791–8. [31] Nordmann P, Dortet L, Poirel L. Carbapenem resistance in Enterobacteriaceae: here is the storm. Trends Mol Med 2012;18:263–72. [32] Walsh TR, Weeks J, Livermore DM, Toleman MA. Dissemination of NDM-1 positive bacteria in the New Delhi environment and its implications for human health: an environmental point prevalence study. Lancet Infect Dis 2011;11:355–62. [33] Krissinel E, Henrick K. Inference of macromolecular assemblies from crystalline state. J Mol Biol 1983;372:774–97. [34] Holm L, Rosenström P. Dali server: conservation mapping in 3D. Nucleic Acids Res 2010;38:W545–9. [35] Leysen S, Herreweghe JMV, Callewaert L, Heirbaut M, Buntinx P, Michiels CW, et al. Molecular basis of bacterial defense against host lysozymes: X-ray structures of periplasmic lysozyme inhibitors PliI and PliC. J Mol Biol 2011;405:1233–45. [36] Leysen S, Vanderkelen L, Asten KV, Vanheuverzwijn S, Theuwis V, Michiels CW, et al. Structural characterization of the PliG lysozyme inhibitor family. J Struct Biol 2012;180:235–42. [37] Vollmer W, Bertsche U. Murein (peptidoglycan) structure, architecture and biosynthesis in Escherichia coli. Biochim Biophys Acta 2008;1778:1714–34. [38] Moya B, Dötsch A, Juan C, Blázquez J, Zamorano L, Haussler S, et al. β-Lactam resistance response triggered by inactivation of a nonessential penicillin-binding protein. PLoS Pathog 2009;5:e1000353.

1970 [39] Hanahan D. Studies on transformation of Escherichia coli with plasmids. J Mol Biol 1983;166:557–80. [40] Demarre G, Guerout AM, Matsumoto-Mashimo C, Rowe-Magnus DA, Marlière P, Mazel D. A new family of mobilizable suicide plasmids based on the broad host range R388 plasmid (IncW) or RP4 plasmid (IncPalpha) conjugative machineries and their cognate E. coli host strains. Res Microbiol 2005;156:245–55. [41] Aharonowitz Y, Demain AL. Carbon catabolite regulation of cephalosporin production in Streptomyces clavuligerus. Antimicrob Agents Chemother 1978;14:159–64. [42] Bainton NJ, Stead P, Chhabra SR, Bycroft BW, Salmond GPC, Stewart GSAB, et al. N-(3-Oxohexanoyl) homoserine lactone regulates carbapenem antibiotic biosynthesis in Erwinia carotovora. Biochem J 1992;288:997–1004. [43] Bycroft BW, Maslen C, Box SJ, Brown A, Tyler JW. The isolation and characterisation of (3R,5R)- and (3S,5R)carbapenem-3-carboxylic acid from Serratia and Erwinia species and their putative biosynthetic role. J Chem Soc Chem Commun 1987;21:1623–5. [44] Thomson NR, Crow MA, McGowan SJ, Cox A, Salmond GPC. Biosynthesis of carbapenem antibiotic and prodigiosin pigment in Serratia is under quorum sensing control. Mol Microbiol 2000;36:539–56. [45] Ramsay JP, Williamson NR, Spring DR, Salmond GPC. A quorum sensing molecule acts as a morphogen controlling gas vesicle organelle biogenesis and adaptive flotation in an enterobacterium. Proc Natl Acad Sci U S A 2011;108:14932–24937. [46] Paterson NG, Riboldi-Tunnicliffe A, Mitchell TJ, Isaacs NW. Purification, crystallization and preliminary X-ray diffraction analysis of RafE, a sugar-binding lipoprotein from Streptococcus pneumoniae. Acta Crystallogr Sect F Struct Biol Cryst Commun 2006;62:676–9. [47] Rathore AS, Bilbrey RE, Steinmeyer DE. Optimization of an osmotic shock procedure for isolation of a protein product expressed in E. coli. Biotechnol Prog 2003;19:1541–6.

Crystal Structure of CarG

[48] Battye TGG, Kontogiannis L, Johnson O, Powell HR, Leslie AGW. iMOSFLM: a new graphical interface for diffractionimage processing with MOSFLM. Acta Crystallogr Sect D Biol Crystallogr 2011;67:271–81. [49] Evans P. Scaling and assessment of data quality. Acta Crystallogr Sect D Biol Crystallogr 2006;62:72–82. [50] Winn MD, Ballard CC, Cowtan KD, Dodson EJ, Emsley P, Evans PR, et al. Overview of the CCP4 suite and current developments. Acta Crystallogr Sect D Biol Crystallogr 2011;67:235–42. [51] Adams PD, Afonine PV, Bunkóczi G, Chen VB, Davis IW, Echols N, et al. PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta Crystallogr Sect D Biol Crystallogr 2010;66:213–21. [52] Cowtan K. The Buccaneer software for automated model building. 1. Tracing protein chains. Acta Crystallogr Sect D Biol Crystallogr 2006;62:1002–11. [53] Murshudov GN, Skubak P, Lebedev AA, Pannu NS, Steiner RA, Nicholls RA, et al. REFMAC5 for the refinement of macromolecular crystal structures. Acta Crystallogr Sect D Biol Crystallogr 1997;67:355–67. [54] Emsley P, Cowtan K. Coot: model-building tools for molecular graphics. Acta Crystallogr Sect D Biol Crystallogr 2004;60:2126–32. [55] McCoy AJ, Grosse-Kunstleve RW, Adams PD, Winn MD, Storoni LC, Read RJ. Phaser crystallographic software. J Appl Crystallogr 2007;40:658–74. [56] Laskowski RA, MacArthur MW, Moss DS, Thornton JM. PROCHECK: a program to check the stereochemical quality of protein. J Appl Crystallogr 1993;26:283–91. [57] Chen VB, Arendall WB, Headd JJ, Keedy DA, Immormino RM, Kapral GJ, et al. MolProbity: all-atom structure validation for macromolecular crystallography. Acta Crystallogr Sect D Biol Crystallogr 2010;66:12–21. [58] Whitaker JR. Determination of molecular weights of proteins by gel filtration of sephadex. Anal Chem 1963;35:1950–3.