VOLUME
33
䡠
NUMBER
9
䡠
MARCH
20
2015
JOURNAL OF CLINICAL ONCOLOGY
O R I G I N A L
R E P O R T
Crizotinib Therapy for Advanced Lung Adenocarcinoma and a ROS1 Rearrangement: Results From the EUROS1 Cohort Julien Mazières, Gérard Zalcman, Lucio Crinò, Pamela Biondani, Fabrice Barlesi, Thomas Filleron, Anne-Marie C. Dingemans, Hervé Léna, Isabelle Monnet, Sacha I. Rothschild, Federico Cappuzzo, Benjamin Besse, Luc Thiberville, Damien Rouvière, Rafal Dziadziuszko, Egbert F. Smit, Jurgen Wolf, Christian Spirig, Nicolas Pecuchet, Frauke Leenders, Johannes M. Heuckmann, Joachim Diebold, Julie D. Milia, Roman K. Thomas, and Oliver Gautschi See accompanying editorial on page 972 Author affiliations appear at the end of this article. Published online ahead of print at www.jco.org on February 9, 2015. Supported in part by the Cancer Pharmacology of Toulouse–Oncopole and Region (CAPTOR) academic project (Grant No. ANR-11-PHUC-0001). Presented in part at the 50th Annual Meeting of the American Society of Clinical Oncology, May 29-June 2, 2014, Chicago, IL. Authors’ disclosures of potential conflicts of interest are found in the article online at www.jco.org. Author contributions are found at the end of this article. Corresponding author: Julien Mazières, MD, PhD, Thoracic Oncology Unit, Respiratory Disease Department, Hôpital Larrey, Centre Hospitalier Universitaire Toulouse, Chemin de Pouvourville, 31059 Toulouse Cedex, France; e-mail: [email protected]. © 2015 by American Society of Clinical Oncology 0732-183X/15/3309w-992w/$20.00 DOI: 10.1200/JCO.2014.58.3302
A
B
S
T
R
A
C
T
Purpose Approximately 1% of lung adenocarcinomas are driven by oncogenic ROS1 rearrangement. Crizotinib is a potent inhibitor of both ROS1 and ALK kinase domains. Patients and Methods In the absence of a prospective clinical trial in Europe, we conducted a retrospective study in centers that tested for ROS1 rearrangement. Eligible patients had stage IV lung adenocarcinoma, had ROS1 rearrangement according to fluorescent in situ hybridization, and had received crizotinib therapy through an individual off-label use. Best response was assessed locally using RECIST (version 1.1). All other data were analyzed centrally. Results We identified 32 eligible patients. One patient was excluded because next-generation sequencing was negative for ROS1 fusion. Median age was 50.5 years, 64.5% of patients were women, and 67.7% were never-smokers. Thirty patients were evaluable for progressionfree survival (PFS), and 29 patients were evaluable for best response. We observed four patients with disease progression, two patients with stable disease, and objective response in 24 patients, including five complete responses (overall response rate, 80%; disease control rate, 86.7%). Median PFS was 9.1 months, and the PFS rate at 12 months was 44%. No unexpected adverse effects were observed. Twenty-six patients received pemetrexed (either alone or in combination with platinum and either before or after crizotinib) and had a response rate of 57.7% and a median PFS of 7.2 months. Conclusion Crizotinib was highly active at treating lung cancer in patients with a ROS1 rearrangement, suggesting that patients with lung adenocarcinomas should be tested for ROS1. Prospective clinical trials with crizotinib and other ROS1 inhibitors are ongoing or planned. J Clin Oncol 33:992-999. © 2015 by American Society of Clinical Oncology
INTRODUCTION
In the last decade, scientists have characterized key molecular alterations that drive lung carcinogenesis.1 On the basis of these seminal findings, large phase III trials have been conducted, leading to the approval of epidermal growth factor receptor (EGFR) –targeting and anaplastic lymphoma kinase (ALK) –targeting therapies in molecularly defined populations.2-5 Targeted therapies for patients with other molecular aberrations are also in development. Promising early results have been reported 992
from clinical trials on selumetinib to target KRAS exon 2 mutations,6 neratinib for HER2 insertion 20,7 dabrafenib for BRAF V600E,8 and cabozantinib for RET fusion.9 Moreover, individual reports suggest trastuzumab may be useful in patients with HER2 insertion 20,10,11 vemurafenib for BRAF V600E,12 and vandetanib for RET fusion-positive lung cancer.13 The c-ros oncogene 1 (ROS1) is also a new target for lung cancer. It encodes a tyrosine kinase receptor from the insulin receptor family. Chromosomal rearrangements involving the ROS1 gene
© 2015 by American Society of Clinical Oncology
Information downloaded from jco.ascopubs.org and provided by at UNIVERSITY OF SASKATCHEWAN on March 19, 2015 Copyright © 2015 Americanfrom Society of Clinical Oncology. All rights reserved. 128.233.210.97
Crizotinib for ROS1 Lung Cancer
were originally described in glioblastomas, where ROS1 (chromosome 6q22) was fused to the FIG gene; results showed transformation in transgenic mice.14-17 In non–small-cell lung cancer (NSCLC) cell lines and primary tumors, ROS1 fusion has been identified as a driver mutation.18 ROS1 fusion partners include SLC34A2, CD74, TPM3, SDC4, EZR, LRIG3, KDELR2, and CCDC6.19 ROS1 rearrangement occurs in 1% to 2% of NSCLCs.19-21 The kinase domain is always fully retained on the ROS1 fusion protein, and the junction point at the mRNA level always occurs at the 5= end of exons 32 to 36.22 Interestingly, the ROS1 kinase domain has significant homology with the ALK kinase domain. ROS1-positive patients share similar characteristics with ALK-positive patients, such as adenocarcinoma histology, histomorphology, young age, and a high prevalence of nonsmoker status.23 Crizotinib is an oral tyrosine kinase inhibitor with an affinity for ALK, MET, and ROS1 kinase domains.24 Crizotinib is currently approved for patients with advanced lung cancer and ALK rearrangement and also has clinical activity in lung cancers that have high levels of MET amplification.5,24-26 Preclinical experiments have revealed that cell lines harboring ROS1 rearrangement were sensitive to ROS1 kinase inhibition,18,27 which led to the expansion of the initial crizotinib phase I trial. This demonstrated impressive clinical activity of crizotinib against ROS1-positive lung cancer.21,28 In turn, this prompted many centers to start ROS1 testing in routine clinical practice, with striking results reported in individual patients.29,30 The current cohort study, European Study of ROS1 Patients (EUROS1), was conducted in the absence of a prospective clinical trial in Europe to characterize the outcomes of ROS1-positive patients who had undergone documented crizotinib therapy.
with crizotinib in European centers that test for ROS1. Clinical and biologic data were collected from each patient by pathologists and treating physicians. The data were anonymized at the local center and then analyzed in Toulouse, France. Histology was assessed locally by a specialist lung cancer pathologist using WHO criteria, and the adenocarcinoma was described according to the new International Association for the Study of Lung Cancer classification.31 TTF1 and other immunostains were used in every patient to validate the diagnosis of NSCLC and to exclude other malignancies. All reports were reviewed centrally. Some patients were also analyzed using a comprehensive, multigene, hybrid, capture-based, parallel-sequencing assay, termed CAGE (Blackfield, Cologne, Germany). 32 Clinicopathologic stage was assigned according to the seventh edition TNM staging system.33 We retrospectively collected clinical data (age at diagnosis, date of diagnosis, tobacco consumption, and tumor stage), outcome variables (recurrence and survival events), and lines of systemic therapies. For all patients, we collected information on the type of chemotherapy or targeted therapy, the date of initiation and end of treatment, best response, and the occurrence of grade 4 or 5 toxicities. Eligible patients needed to have undergone adequate follow-up visits that included thoracic and abdominal computed tomography scans at baseline and after 6 to 8 weeks of crizotinib therapy. Responses were defined as the best response from the start of treatment until disease progression, according to RECIST (version 1.1). Tumor assessment was not centrally analyzed, but the coordinating investigators reviewed the radiologic reports and obtained original images for central assessment if the report and the local assessment were discordant. Treatments All patients enrolled onto this study were treated with crizotinib (250 mg two times per day) for a minimum duration of 2 weeks. Health insurances supported treatment for patients based on individual applications for off-label use. Because this was a retrospective study, we were not able to prospectively monitor safety. We asked every investigator to retrospectively declare all grade 4 and 5 adverse effects their patients reported while receiving crizotinib.
PATIENTS AND METHODS Patients This study was conducted in six European countries (France, Switzerland, Italy, Germany, Poland, and the Netherlands) and represents a consecutive series of identified patients carrying a ROS1 rearrangement and treated
False positive (NGS)
ROS1+ patients treated with crizotinib
(n = 32)
ROS1+ patients treated with crizotinib
(n = 31)
(n = 1)
PFS for pemetrexed- (n = 26) treated patients (Fig 2)
www.jco.org
Ethical Considerations Individual consent from patients, to collect anonymized clinical and biologic data, were obtained by the physicians according to the local regulations for observational studies in each European country. Institutional review board approval was granted by the University Hospital of
Death before 2-week treatment
(n = 1)
Not evaluable for tumor response
(n = 1)
Fig 1. CONSORT diagram. NGS, nextgeneration sequencing; PFS, progressionfree survival. Crizotinib-treated patients PFS (Fig 4)
(n = 30)
% of best response (RECIST; Fig 3)
(n = 29)
© 2015 by American Society of Clinical Oncology
Information downloaded from jco.ascopubs.org and provided by at UNIVERSITY OF SASKATCHEWAN on March 19, 2015 Copyright © 2015 Americanfrom Society of Clinical Oncology. All rights reserved. 128.233.210.97
993
Mazières et al
1.0
A
B
C
D Fig 2. Diagnosis of ROS1 rearrangement in lung cancer tissues. Immunohistochemistry analyses with positivity for (A) TTF1 and (B) ROS1 antibodies (magnification, ⫻20). (C and D) Examples of positive fluorescent in situ hybridization for ROS1 performed on unstained 3- to 4-m formalin-fixed, paraffin-embedded tumor tissue sections with the use of a ROS1 break-apart probe set (courtesy S. Lecot-Cotigny, E. LechaptZalcman, Caen, France). (E) Next-generation sequencing panel provided by Frauke Leenders and Roman Thomas (Department of Genetics, University Hospital Cologne, Cologne, Germany).
E
ROS1
ATG
chr6: 117646625
ex34
CD74
ex33
chr5: 149783239
ex7
ATG
ex6
ATG ex34
Genomic structure of the fusion point
ex6
…tctctgtcccaaagtgataggaggttaacac…
CD74-ROS1 ex6 ex34
Potential fusion protein
………ACT GAC GCT CCA CCG AAA GAT GAT TTT TGG ATA CCA …….
T D A P P K E D F W I P
Toulouse (France) for central data analyses. The patients’ data were anonymized by the treating physicians and forwarded to the central statistical office in an electronic format. ROS1 Diagnostics Fluorescence in situ hybridization (FISH) was performed on cytology or tissue samples, using commercially available ROS1 probes, such as the Zytoli994
© 2015 by American Society of Clinical Oncology
ght SPEC ROS1 dual-color break-apart rearrangement probe (ZytoVision, Bremerhaven, Germany), and other commercial products. FISH scoring was performed by experienced technicians in certified laboratories, and the results were reviewed by expert pathologists. The scoring system established for ALK FISH was applied. A tumor was defined as positive for a ROS1 rearrangement if a split signal (single red and single green signal, with a signal-separation distance of at least two signal diameters) was present in at least 15% of the JOURNAL OF CLINICAL ONCOLOGY
Information downloaded from jco.ascopubs.org and provided by at UNIVERSITY OF SASKATCHEWAN on March 19, 2015 Copyright © 2015 Americanfrom Society of Clinical Oncology. All rights reserved. 128.233.210.97
Crizotinib for ROS1 Lung Cancer
tumor cells analyzed. At least 50 tumor cells were counted in each sample. Inflammatory and stromal cells served as internal controls and showed two fused or adjacent red and green signals, with a signal-separation distance of less than two signal diameters. In France, according to recommendations of a national expert pathologist panel, patients were first screened using ROS1 immunohistochemistry.34 The percentages of positively stained cells were evaluated, and staining scores were assessed as follows: 0, no staining; 1⫹, faint cytoplasmic staining; 2⫹, moderate cytoplasmic staining; and 3⫹, intense granular cytoplasmic staining. Samples with a positive ROS1 immunohistochemistry (1⫹ to 3⫹) were further assessed by FISH. Samples from individual patients who were refractory to crizotinib or displayed other activating mutations were validated by hybrid capture based on a targeted genomic sequencing assay (CAGE). This sequenced a genomic partition that covered exonic and intronic regions of ROS1 between exons 31 and 34, as well as other known driver mutations.32 Further local test results collected in this study included EGFR exons 18 to 21, KRAS exon 2, HER2 exon 20, BRAF exon 600, EML4-ALK (FISH), and KIF5B-RET (FISH; Fig 1). Statistics Data were summarized according to frequency and percentage for categorical variables and by medians and ranges for continuous variables. Progression-free survival (PFS) was measured as the time from the beginning of treatment to progression or death. Patients alive without progression at the time of analysis were censored at their last follow-up assessment. Survival rates were estimated using the Kaplan-Meier method. Statistical analyses were performed using STATA 12.0 software (StataCorp, College Station, TX).
RESULTS
Genetic Characteristics of Patients With a ROS1 Translocation We identified 32 patients with ROS1 FISH–positive lung cancer treated with crizotinib in 16 centers from six European countries. ROS1 rearrangement was diagnosed in every patient by FISH testing using a standard break-apart procedure (Fig 2). All patients were previously tested for EGFR, ALK, and KRAS mutations, and most were tested for BRAF, PI3KCA, HER2, and RET. Most ROS1 translocations were exclusive drivers, except in two patients, who had a tumor that harbored a concomitant KRAS exon 2 mutation. The tumors with concomitant KRAS mutations and ROS1 fusion (by FISH) were reassessed using next-generation sequencing. One patient was positive for KRAS and negative for breakpoint detection in ROS1 exons 31 to 34 and was thus excluded from the analyses. The other patient was undoubtedly positive for both KRAS and ROS1 and was included. Clinicopathologic Characteristics of Patients With a ROS1 Translocation Clinical and diagnostic features of the 31 patients who harbored a ROS1 translocation were analyzed (Table 1). Patients were diagnosed at a median age of 50.5 years (range, 34 to 78 years). There was a higher proportion of women (20 women v 11 men; 64.5% v 35.5%, respectively) and of never-smokers (22 neversmokers v six former smokers and three current smokers; 71% v 19.3% and 9.7%, respectively). All patients had stage IV disease at the time of crizotinib treatment. All tumors were adenocarcinomas, including five with a lepidic component and one tumor with a composite adenosquamous histology. www.jco.org
Table 1. Clinical and Biologic Characteristics of Patients With Lung Cancer and a ROS1 Rearrangement Characteristics Age at diagnosis, years Mean Standard deviation Median Sex F M Tobacco use Never Former Current Unknown Tumor stage (at the time of initial diagnosis) I II III IV Metastasis sites for stage IV disease Lung Brain Bone Multiple organs Lymph node Pleural Other or unknown ROS1 detection methods IHC and FISH (France) FISH alone FISH and NGS
No. of Patients (N ⫽ 31)
%
53.4 11.9 50.5 20 11
64.5 35.5
22 6 3 0
71 19.3 9.7
1 1 4 25 31 5 1 2 8 5 3 7
3.2 3.2 12.9 80.7 16.2 3.2 6.5 25.8 16.2 9.7 22.6
12 15 4
38.7 48.4 12.9
Abbreviations: FISH, fluorescent in situ hybridization; IHC, immunohistochemistry; NGS, next-generation sequencing.
Treatment Response to Chemotherapy in Patients With NSCLC Who Harbored a ROS1 Translocation Patients received zero (n ⫽ 1), one (n ⫽ 9), two (n ⫽ 5), three (n ⫽ 3), or more than three (n ⫽ 13) lines of chemotherapy before crizotinib. Because ALK-positive tumors are known to be sensitive to pemetrexed and because preliminary reports suggest the same in ROS1 patients,35 we also analyzed the outcomes of patients who received pemetrexed chemotherapy given either alone or in combination with platinum at any time in the past. Indeed, most patients (n ⫽ 26, 84%) had received pemetrexed-based chemotherapy. The treatment was given more frequently at the beginning of the disease (first- or second-line treatment, n ⫽ 22, 85%; and later lines in four patients). Partial responses were observed in 15 patients (57.7%). The median PFS time with pemetrexed-based chemotherapy was 7.2 months (95% CI, 4.8 to 9.6 months), with the survival curve presented in Figure 3. Treatment Response to Crizotinib in Patients With NSCLC Who Harbored a ROS1 Translocation All patients received crizotinib at 250 mg twice per day. Because of the retrospective nature of our study, we were only able to collect information on grade 4 and 5 toxicities. In our series, no patients experienced a grade 4 or 5 adverse effect. One patient experienced a © 2015 by American Society of Clinical Oncology
Information downloaded from jco.ascopubs.org and provided by at UNIVERSITY OF SASKATCHEWAN on March 19, 2015 Copyright © 2015 Americanfrom Society of Clinical Oncology. All rights reserved. 128.233.210.97
995
Mazières et al
1.0
Progression-Free Survival (proportion)
Progression-Free Survival (proportion)
1.0
0.8
0.6
0.4
0.2
0
26
52
78
104
130 156
182
208
0.8
0.6
0.4
0.2
0
234
6 12 18 24 30 36 42 48 54 60 66 72 78 84
Time (weeks)
Time (weeks)
Fig 5. Progression-free survival on crizotinib in patients with lung cancer and an ROS1 rearrangement.
Fig 3. Progression-free survival on pemetrexed-based chemotherapy in patients with lung cancer and an ROS1 rearrangement.
grade 3 liver toxicity, leading to temporary withdrawal of crizotinib and dose reduction, but no patient definitely discontinued crizotinib as a result of an adverse effect. Thirty patients were evaluated for PFS analyses and 29 patients were evaluated for best response according to RECIST criteria, because one patient died after 1 week of treatment (and was not included in the PFS analysis) and another patient died after 2 weeks but before tumor assessment (and was not included in the best response analysis). Patients received crizotinib as a first- or second-line treatment (n ⫽ 10, 32%) or, more frequently, after two or more lines of chemo-
therapy (n ⫽ 21, 68%). All patients had progressive disease at the time of crizotinib initiation (except the chemotherapy-naive patient). On crizotinib, four patients had progressive disease, two had stable disease, and 24 achieved objective responses, which included five complete responses (overall response rate, 80%; disease control rate, 86.6%). A waterfall plot of patients evaluable for best response (n ⫽ 29) is shown in Figure 4. Median PFS time was 9.1 months, and the PFS rate at 12 months was 44% (Fig 5). At the time of analysis, 18 patients were still receiving treatment (Fig 6). Examples of tumor
120 100 100
93
80 60
Change (%)
40
28
20 0
0
0 -20 -30 -30
-40
-40 -40 -40 -40 -60
-44 -45
-50 -52 -55
-59
-80
-65 -66 -69 -70
-75
-80 -90
-100
-100 -100 -100 -100 -100 -120 No. of previous lines of chemotherapy before crizotinib
5
3
4
4
5
1
1
1
1
4
6
3
4
1
1
5
4
3
9
2
1
4
2
5
0
1
1
2
2
Fig 4. Waterfall plot of the best response to crizotinib in patients with lung cancer and an ROS1 rearrangement. 996
© 2015 by American Society of Clinical Oncology
JOURNAL OF CLINICAL ONCOLOGY
Information downloaded from jco.ascopubs.org and provided by at UNIVERSITY OF SASKATCHEWAN on March 19, 2015 Copyright © 2015 Americanfrom Society of Clinical Oncology. All rights reserved. 128.233.210.97
Crizotinib for ROS1 Lung Cancer
32 22 17 7 12 5 3† 28 10 23 4 1 24 18 21 8 16 15 25
Fig 6. Duration of crizotinib treatment in patients with lung cancer and an ROS1 rearrangement.
19† 26† 2 29 13† 27 11† 6 20† 30 32† 14†
Relapse Ongoing crizotinib treatment
†
0
20
40
60
80
Death
100
120
Time (weeks)
response are shown in Appendix Figure A1 (online only). Interestingly, crizotinib primary resistance was associated with KRAS concomitant mutation, isolated brain progression, poor health status, or reduction of crizotinib dosing as a result of liver toxicity. DISCUSSION
Precision medicine for patients with lung cancer is a rapidly developing field. One of the most recently identified therapeutic targets is ROS1, which was described for the first time in a series of lung cancer patients in 2012.21 Since then, only a handful of retrospective series have improved characterization of this subset population with a ROS1 rearrangement. The incidence of the ROS1 rearrangement is low (0.6% to 2% of unselected adenocarcinomas) and has been associated with adenocarcinoma with extracellular mucin,23 lepidic patterns, and coexpression of TTF1.36 A high prevalence of solid cribriform and acinar adenocarcinoma, with signet ring cells, has been also reported.34 Of interest, we observed ROS1 translocation in five adenocarcinomas with lepidic features, which suggests that adenocarcinomas with a lepidic pattern should be screened for ROS1. The patient characteristics from our series were consistent with those reported earlier, with a predominance of women and of being never-smokers or light smokers.21,34,37 Interestingly, brain metastases seem to be less frequent than in patients with ALK translocation. However, there was no exact correlation, suggesting that the patient characteristics should not necessarily guide decisions on testing for ROS1. The discovery of ROS1 as an oncogenic driver in lung cancer is paralleled to the discovery of crizotinib as a targeted therapy.38 Early clinical data support the potency of crizotinib in patients with www.jco.org
a ROS1 rearrangement.29,30 We report here a high response rate (80%). Because our study is retrospective, it is possible there is an overestimation in our results that might be a result of the small sample size, patient selection, investigator-based response assessment, or population-based pharmacologic differences. We did not perform a central review of tumor assessment but made a special effort to review all of the computed tomography scan reports and original images if needed. Moreover, all of the authors are experienced in clinical research and RECIST evaluation. Our study mirrors the recently published phase I study that showed an overall response rate of 72%.28 It is noteworthy that, in our study, the patients were pretreated with chemotherapy (except one patient who received first-line crizotinib) and were unselected for health status or comorbidities. Thus, we have shown that the findings reported in highly selected patients in a phase I trial can be translated to the routine use of a drug. The size of our cohort was larger than expected, indicating that many European centers implemented ROS1 testing in clinical practice shortly after the first phase I report in 2012.21 The timeline of this process is remarkable, as already observed with imatinib in gastrointestinal stromal tumor.39,40 Consistent with ALK-positive patients and with a preliminary report, pemetrexed in our cohort was also associated with encouraging activity in ROS1-positive patients.35 We observed an overall response rate of 57.7% and a median PFS time of 7.2 months. However, our cohort included patients who received pemetrexed alone or in combination with a platinum-based therapy. These results are only preliminary, and no clinical decisions should be made at present for ROS1-positive patients with regard to the choice of optimal chemotherapy. © 2015 by American Society of Clinical Oncology
Information downloaded from jco.ascopubs.org and provided by at UNIVERSITY OF SASKATCHEWAN on March 19, 2015 Copyright © 2015 Americanfrom Society of Clinical Oncology. All rights reserved. 128.233.210.97
997
Mazières et al
Crizotinib seems to be the current treatment of choice for ROS1positive patients. In 2014, the prospective phase II trials European Trial on Crizotinib in ROS1 Translocated Lung Cancer (EUCROSS; Germany, Switzerland, and Spain), METROS (Italy), and Accès Sécurisé aux Médicaments Innovants (AcSé) Crizotinib (France) were initiated to confirm the activity of crizotinib to treat ROS1-positive lung cancer in Europe. Other trials with PF-06463922 (NCT01970865), ceritinib (NCT01964157), and RXDX-101 (NCT02097810) are also ongoing or are planned. Other compounds have shown potent in vitro activity against ROS1-mutated tumors in animal and ex vivo cultures (foretinib and cabozantinib). To identify patients for these trials or for crizotinib off-label use, ROS1 testing is indispensable. Nevertheless, because of the rarity of ROS1 rearrangement, systematic high-throughput testing is challenging. Because ROS1 rearrangement occurs almost exclusively with other genomic aberrations, it should be preferentially analyzed in triple-negative (EGFR, ALK, and KRAS) patients even though we, and others, have identified some comutated tumors with KRAS and EGFR mutations.41 This strategy has allowed some centers to increase their rate of identification of ROS1 rearrangement by 5% to 7%.34,42 In line with these data, the National Comprehensive Cancer Network 2014 guidelines recommend that all patients with advanced triple-negative lung adenocarcinoma should be tested for additional molecular markers, including ROS1. Immunohistochemistry can also be used as a prescreening method. Most academic platforms in France are using immunohistochemistry for screening and FISH for validation, although immunohistochemistry may have limitations.34,43 Interestingly, one patient in our cohort was initially considered positive by FISH (along with a KRAS mutation) but was reclassified as negative by next-generation sequencing. This suggests that capture-based, multigene, massively parallel shotgun sequencing may help to eliminate false-positive results, while enhancing detection rates compared with conventional methods, especially in pannegative lung adenocarcinomas from patients with no smoking or a light smoking history.9 Several methods are currently available for ROS1 testing, and the best method remains to be defined. Individual preference depends on availability, financial resources, and experience. Regardless of the method used, rigorous quality control is absolutely mandatory, and testing should only be done in certified laboratories by experienced personnel. Another clinically relevant issue is resistance to ROS1 inhibition. The mechanisms are still only partially understood. This may be because of the acquisition of a new mutation within the ROS1 kinase domain44,45 or the activation of other pathways, such as EGFR22 or REFERENCES 1. Pao W, Girard N: New driver mutations in non-small-cell lung cancer. Lancet Oncol 12:175180, 2011 2. Mok TS, Wu YL, Thongprasert S, et al: Gefitinib or carboplatin-paclitaxel in pulmonary adenocarcinoma. N Engl J Med 361:947-957, 2009 3. Rosell R, Carcereny E, Gervais R, et al: Erlotinib versus standard chemotherapy as firstline treatment for European patients with advanced EGFR mutation-positive non-small-cell lung cancer (EURTAC): A multicentre, open-label, randomised phase 3 trial. Lancet Oncol 13:239246, 2012 998
© 2015 by American Society of Clinical Oncology
KRAS. In our study, in patients with progressive or stable disease, we identified concomitant KRAS mutation, isolated brain progression, late treatment, poor health status, and low dose of crizotinib as potential resistance factors. Further important issues need to be addressed, including the costs of extended testing, the need for a regulatory companion diagnostic assay, the requirements for drug-label extensions, and the approval for therapies that target other rare cancer subtypes.46 We believe that targeted therapies with response rates of more than 50% represent a major breakthrough in lung cancer therapy and should be a priority in drug development.47,48 Patients with ROS1 fusion are rare, and registration trials are lengthy. Thus, patients with a ROS1 fusion and for whom an active targeted therapy exists should have accelerated access to precision medical treatment through collaborative trials, international programs, and national registries. AUTHORS’ DISCLOSURES OF POTENTIAL CONFLICTS OF INTEREST Disclosures provided by the authors are available with this article at www.jco.org.
AUTHOR CONTRIBUTIONS Conception and design: Julien Mazières, Gérard Zalcman, Oliver Gautschi Administrative support: Julie D. Milia Provision of study materials or patients: Gérard Zalcman, Fabrice Barlesi, Anne-Marie C. Dingemans, Hervé Léna, Isabelle Monnet, Sacha I. Rothschild, Federico Cappuzzo, Benjamin Besse, Luc Thiberville, Damien Rouvière, Rafal Dziadziuszko, Egbert F. Smit, Jurgen Wolf, Christian Spirig, Nicolas Pecuchet, Frauke Leenders, Julie D. Milia, Roman K. Thomas, Oliver Gautschi Collection and assembly of data: Julien Mazières, Gérard Zalcman, Lucio Crinò, Pamela Biondani, Fabrice Barlesi, Anne-Marie C. Dingemans, Hervé Léna, Isabelle Monnet, Sacha I. Rothschild, Federico Cappuzzo, Benjamin Besse, Luc Thiberville, Damien Rouviére, Rafal Dziadziuszko, Egbert F. Smit, Jurgen Wolf, Christian Spirig, Nicolas Pecuchet, Frauke Leenders, Johannes M. Heuckmann, Joachim Diebold, Julie D. Milia, Roman K. Thomas, Oliver Gautschi Data analysis and interpretation: Julien Mazières, Gérard Zalcman, Pamela Biondani, Fabrice Barlesi, Thomas Filleron, Anne-Marie C. Dingemans, Federico Cappuzzo, Egbert F. Smit, Christian Spirig, Julie D. Milia, Roman K. Thomas, Oliver Gautschi Manuscript writing: All authors Final approval of manuscript: All authors
4. Sequist LV, Yang JC, Yamamoto N, et al: Phase III study of afatinib or cisplatin plus pemetrexed in patients with metastatic lung adenocarcinoma with EGFR mutations. J Clin Oncol 31:3327-3334, 2013 5. Shaw AT, Kim DW, Nakagawa K, et al: Crizotinib versus chemotherapy in advanced ALK-positive lung cancer. N Engl J Med 368:2385-2394, 2013 6. Jänne PA, Shaw AT, Pereira JR, et al: Selumetinib plus docetaxel for KRAS-mutant advanced non-small-cell lung cancer: A randomised, multicentre, placebo-controlled, phase 2 study. Lancet Oncol 14:38-47, 2013 7. Gandhi L, Bahleda R, Tolaney SM, et al: Phase I study of neratinib in combination with temsirolimus in patients with human epidermal growth factor
receptor 2-dependent and other solid tumors. J Clin Oncol 32:68-75, 2014 8. Planchard D, Mazieres J, Riely GJ, et al: Interim results of phase II study BRF113928 of dabrafenib in BRAF V600E mutation–positive nonsmall cell lung cancer (NSCLC) patients. J Clin Oncol 31, 2013 (suppl; abstr 8009) 9. Drilon A, Wang L, Hasanovic A, et al: Response to cabozantinib in patients with RET fusion-positive lung adenocarcinomas. Cancer Discov 3:630-635, 2013 10. Cappuzzo F, Bemis L, Varella-Garcia M: HER2 mutation and response to trastuzumab therapy in nonsmall-cell lung cancer. N Engl J Med 354:2619-2621, 2006 11. Mazières J, Peters S, Lepage B, et al: Lung cancer that harbors an HER2 mutation: Epidemiologic JOURNAL OF CLINICAL ONCOLOGY
Information downloaded from jco.ascopubs.org and provided by at UNIVERSITY OF SASKATCHEWAN on March 19, 2015 Copyright © 2015 Americanfrom Society of Clinical Oncology. All rights reserved. 128.233.210.97
Crizotinib for ROS1 Lung Cancer
characteristics and therapeutic perspectives. J Clin Oncol 31:1997-2003, 2013 12. Gautschi O, Pauli C, Strobel K, et al: A patient with BRAF V600E lung adenocarcinoma responding to vemurafenib. J Thorac Oncol 7:e23-e24, 2012 13. Gautschi O, Zander T, Keller FA, et al: A patient with lung adenocarcinoma and RET fusion treated with vandetanib. J Thorac Oncol 8:e43-e44, 2013 14. Birchmeier C, O’Neill K, Riggs M, et al: Characterization of ROS1 cDNA from a human glioblastoma cell line. Proc Natl Acad Sci U S A 87:4799-4803, 1990 15. Birchmeier C, Sharma S, Wigler M: Expression and rearrangement of the ROS1 gene in human glioblastoma cells. Proc Natl Acad Sci U S A 84: 9270-9274, 1987 16. Charest A, Lane K, McMahon K, et al: Fusion of FIG to the receptor tyrosine kinase ROS in a glioblastoma with an interstitial del(6)(q21q21). Genes Chromosomes Cancer 37:58-71, 2003 17. Charest A, Wilker EW, McLaughlin ME, et al: ROS fusion tyrosine kinase activates a SH2 domaincontaining phosphatase-2/phosphatidylinositol 3kinase/mammalian target of rapamycin signaling axis to form glioblastoma in mice. Cancer Res 66:7473-7481, 2006 18. Rikova K, Guo A, Zeng Q, et al: Global survey of phosphotyrosine signaling identifies oncogenic kinases in lung cancer. Cell 131:1190-1203, 2007 19. Takeuchi K, Soda M, Togashi Y, et al: RET, ROS1 and ALK fusions in lung cancer. Nat Med 18:378-381, 2012 20. Davies KD, Le AT, Theodoro MF, et al: Identifying and targeting ROS1 gene fusions in non-small cell lung cancer. Clin Cancer Res 18:4570-4579, 2012 21. Bergethon K, Shaw AT, Ou SH, et al: ROS1 rearrangements define a unique molecular class of lung cancers. J Clin Oncol 30:863-870, 2012 22. Davies KD, Doebele RC: Molecular pathways: ROS1 fusion proteins in cancer. Clin Cancer Res 19:4040-4045, 2013 23. Pan Y, Zhang Y, Li Y, et al: ALK, ROS1 and RET fusions in 1139 lung adenocarcinomas: A comprehensive study of common and fusion patternspecific clinicopathologic, histologic and cytologic features. Lung Cancer 84:121-126, 2014 24. Kwak EL, Bang YJ, Camidge DR, et al: Anaplastic lymphoma kinase inhibition in non-small-cell lung cancer. N Engl J Med 363:1693-1703, 2010
25. Mok T, Kim D-W, Wu Y-L, et al: First-line crizotinib versus pemetrexed– cisplatin or pemetrexed– carboplatin in patients (pts) with advanced ALK-positive non-squamous non-small cell lung cancer (NSCLC): Results of a phase III study (PROFILE 1014). J Clin Oncol 32, 2014 (suppl 5s; abstr 8002) 26. Camidge DR, Ou S-HI, Shapiro G, et al: Efficacy and safety of crizotinib in patients with advanced c-MET-amplified non-small cell lung cancer (NSCLC). J Clin Oncol 32, 2014 (suppl 15; abstr 8001) 27. Yasuda H, de Figueiredo-Pontes LL, Kobayashi S, et al: Preclinical rationale for use of the clinically available multitargeted tyrosine kinase inhibitor crizotinib in ROS1-translocated lung cancer. J Thorac Oncol 7:1086-1090, 2012 28. Shaw AT, Ou SH, Bang YJ, et al: Crizotinib in ROS1-rearranged non-small-cell lung cancer. N Engl J Med 371:1963-1971, 2014 29. Bos M, Gardizi M, Schildhaus HU, et al: Complete metabolic response in a patient with repeatedly relapsed non-small cell lung cancer harboring ROS1 gene rearrangement after treatment with crizotinib. Lung Cancer 81:142-143, 2013 30. Dziadziuszko K, Szurowska E, Pienkowska J, et al: Miliary brain metastases in a patient with ROS1-rearranged lung adenocarcinoma: A case report. J Thorac Oncol 9:e34-e36, 2014 31. Travis WD, Brambilla E, Noguchi M, et al: International Association for the Study of Lung Cancer/ American Thoracic Society/European Respiratory Society international multidisciplinary classification of lung adenocarcinoma. J Thorac Oncol 6:244-285, 2011 32. Fernandez-Cuesta L, Plenker D, Osada H, et al: CD74-NRG1 fusions in lung adenocarcinoma. Cancer Discov 4:415-422, 2014 33. Goldstraw P, Crowley J, Chansky K, et al: The IASLC Lung Cancer Staging Project: Proposals for the revision of the TNM stage groupings in the forthcoming (seventh) edition of the TNM classification of malignant tumours. J Thorac Oncol 2:706714, 2007 34. Mescam-Mancini L, LantuéjoulS, Moro-Sibilot D, et al: On the relevance of a testing algorithm for the detection of ROS1-rearranged lung adenocarcinomas. Lung Cancer 83:168-173, 2014 35. Riess JW, Padda SK, Bangs CD, et al: A case series of lengthy progression-free survival with pemetrexed-containing therapy in metastatic non– small-cell lung cancer patients harboring ROS1 gene rearrangements. Clin Lung Cancer 14:592-595, 2013
36. Warth A, Muley T, Dienemann H, et al: ROS1 expression and translocations in non-small-cell lung cancer: Clinicopathological analysis of 1478 cases. Histopathology 65:187-194, 2014 37. Kim MH, Shim HS, Kang DR, et al: Clinical and prognostic implications of ALK and ROS1 rearrangements in never-smokers with surgically resected lung adenocarcinoma. Lung Cancer 83:389-395, 2014 38. Arai Y, Totoki Y, Takahashi H, et al: Mouse model for ROS1-rearranged lung cancer. PLoS One 8:e56010, 2013 39. Joensuu H, Roberts PJ, Sarlomo-Rikala M, et al: Effect of the tyrosine kinase inhibitor STI571 in a patient with a metastatic gastrointestinal stromal tumor. N Engl J Med 344:1052-1056, 2001 40. Demetri GD, von Mehren M, Blanke CD, et al: Efficacy and safety of imatinib mesylate in advanced gastrointestinal stromal tumors. N Engl J Med 347: 472-480, 2002 41. Go H, Kim DW, Kim D, et al: Clinicopathologic analysis of ROS1-rearranged non-small-cell lung cancer and proposal of a diagnostic algorithm. J Thorac Oncol 8:1445-1450, 2013 42. Kim HR, Lim SM, Kim HJ, et al: The frequency and impact of ROS1 rearrangement on clinical outcomes in never smokers with lung adenocarcinoma. Ann Oncol 24:2364-2370, 2013 43. Cha YJ, Lee JS, Kim HR, et al: Screening of ROS1 rearrangements in lung adenocarcinoma by immunohistochemistry and comparison with ALK rearrangements. PLoS One 9:e103333, 2014 44. Gerlinger M, Norton L, Swanton C: Acquired resistance to crizotinib from a mutation in CD74ROS1. N Engl J Med 369:1172-1173, 2013 45. Awad MM, Katayama R, McTigue M, et al: Acquired resistance to crizotinib from a mutation in CD74-ROS1. N Engl J Med 368:2395-2401, 2013 46. Ou SH, Soo RA, Kubo A, et al: Will the requirement by the US FDA to simultaneously co-develop companion diagnostics (CDx) delay the approval of receptor tyrosine kinase inhibitors for RTK-rearranged (ROS1-, RET-, AXL-, PDGFR-␣-, NTRK1-) non-small cell lung cancer globally? Front Oncol 4:58, 2014 47. Mok TS: A target or a demi-target. Clin Lung Cancer 11:147-148, 2010 48. Johnson DH, Schiller JH, Bunn PA Jr: Recent clinical advances in lung cancer management. J Clin Oncol 32:973-982, 2014
Affiliations Julien Mazières, Damien Rouvière, and Julie D. Milia, Hôpital Larrey, Centre Hospitalier Universitaire, Université Paul Sabatier; Thomas Filleron, Institut Universitaire du Cancer, Toulouse; Gérard Zalcman, Centre Hospitalier Universitaire, Université de Caen-Basse Normandie, Caen; Pamela Biondani and Benjamin Besse, Gustave Roussy, Villejuif; Fabrice Barlesi, Aix-Marseille University, Assistance Publique Hôpitaux de Marseille, Marseille; Hervé Léna, Centre Hospitalier Universitaire, Rennes; Isabelle Monnet, Centre Hospitalier Intercommunal de Créteil, Créteil; Luc Thiberville, Centre Hospitalier Universitaire, Rouen; Nicolas Pecuchet, Institut Curie, Paris, France; Lucio Crinò, Medica-Azienda Ospedaliera, Perugia; Federico Cappuzzo, Istituto Toscano Tumori, Ospedale Civile, Livorno, Italy; Anne-Marie C. Dingemans, Maastricht University Medical Center, Maastricht; Egbert F. Smit, VU University Medical Center, Amsterdam, the Netherlands; Sacha I. Rothschild, University Hospital Basel, Medical Oncology, Basel; Christian Spirig, Klinik St Anna; Joachim Diebold and Oliver Gautschi, Cantonal Hospital Luzern, Lucerne, Switzerland; Rafal Dziadziuszko, Gdansk Medical University, Gdansk, Poland; Jurgen Wolf and Roman K. Thomas, Center of Integrated Oncology Köln–Bonn, University Hospital Cologne, University of Cologne; Frauke Leenders and Roman K. Thomas, University of Cologne; Johannes M. Heuckmann, Blackfield AG, Cologne, Germany. ■ ■ ■
www.jco.org
© 2015 by American Society of Clinical Oncology
Information downloaded from jco.ascopubs.org and provided by at UNIVERSITY OF SASKATCHEWAN on March 19, 2015 Copyright © 2015 Americanfrom Society of Clinical Oncology. All rights reserved. 128.233.210.97
999
Mazières et al
AUTHORS’ DISCLOSURES OF POTENTIAL CONFLICTS OF INTEREST
Crizotinib Therapy for Advanced Lung Adenocarcinoma and a ROS1 Rearrangement: Results From the EUROS1 Cohort The following represents disclosure information provided by authors of this manuscript. All relationships are considered compensated. Relationships are self-held unless noted. I ⫽ Immediate Family Member, Inst ⫽ My Institution. Relationships may not relate to the subject matter of this manuscript. For more information about ASCO’s conflict of interest policy, please refer to www.asco.org/rwc or jco.ascopubs.org/site/ifc. Julien Mazières Consulting or Advisory Role: Roche/Genentech, Boehringer Ingelheim, Bristol-Myers Squibb, Pfizer, Puma Research Funding: Roche/Genentech Gérard Zalcman Consulting or Advisory Role: Roche (Inst), Eli Lilly (Inst), Borhinger Ingleheim (Inst), Pfizer (Inst) Research Funding: Roche (Inst), Pfizer (Inst), AstraZeneca (Inst) Travel, Accommodations, Expenses: Roche, Eli Lilly, Pfizer Lucio Crinò Honoraria: Pfizer Consulting or Advisory Role: Pfizer Travel, Accommodations, Expenses: Pfizer Pamela Biondani No relationship to disclose Fabrice Barlesi Honoraria: Lilly Oncology, Pfizer, Novartis, AstraZeneca, Genentech/ Roche, GlaxoSmithKline, Pierre Fabre Medicament Consulting or Advisory Role: Genentech/Roche Research Funding: Bayer (Inst), Genentech/Roche (Inst), Eli Lilly/ImClone (Inst), GlaxoSmithKline (Inst), AstraZeneca/MedImmune (Inst), Boehringer Ingelheim (Inst), Pfizer (Inst), Bristol-Myers Squibb (Inst), Novartis (Inst), Merck (Inst), Esai (Inst), Daiichi Sankyo (Inst) Travel, Accommodations, Expenses: Genentech/Roche, Novartis, Eli Lilly Thomas Filleron No relationship to disclose Anne-Marie C. Dingemans Consulting or Advisory Role: Roche, Pfizer, Novartis, Bristol-Myers Squibb, Lilly, Boehringer Ingelheim Speakers’ Bureau: Roche Hervé Léna Consulting or Advisory Role: Pfizer, Roche, Bristol-Myers Squibb, Merck, Boehringer Ingelheim Research Funding: Roche (Inst) Travel, Accommodations, Expenses: Roche, Bristol-Myers Squibb, Eli Lilly, Amgen, Pfizer Isabelle Monnet Honoraria: Pfizer Sacha I. Rothschild Consulting or Advisory Role: Pfizer Speakers’ Bureau: Pfizer Federico Cappuzzo Consulting or Advisory Role: Roche, Pfizer, AstraZeneca, Clovis Oncology, Bristol-Myers Squibb Speakers’ Bureau: Roche, Bristol-Myers Squibb, AstraZeneca, Pfizer
Damien Rouvière No relationship to disclose Rafal Dziadziuszko Honoraria: Pfizer, Novartis Consulting or Advisory Role: Pfizer Egbert F. Smit No relationship to disclose Jurgen Wolf Honoraria: AstraZeneca, Bristol-Myers Squibb, Boehringer Ingelheim, MSD Oncology, Clovis Oncology, Novartis, Pfizer, Roche Consulting or Advisory Role: AstraZeneca, Bristol-Myers Squibb, Boehringer Ingelheim, Clovis Oncology, Novartis, Pfizer, Roche, MSD Oncology Research Funding: Novartis, Pfizer, Roche, Boehringer Ingelheim Christian Spirig Consulting or Advisory Role: Roche, Bayer Nicolas Pecuchet Honoraria: Roche, Novartis, GlaxoSmithKline Consulting or Advisory Role: Novartis, Roche, GlaxoSmithKline Travel, Accommodations, Expenses: Roche, Sandoz, GlaxoSmithKline Frauke Leenders Honoraria: Blackfield AG Johannes M. Heuckmann Employment: Blackfield AG Stock or Other Ownership: Blackfield AG Joachim Diebold Consulting or Advisory Role: Roche, Pfizer Speakers’ Bureau: Roche, Pfizer Travel, Accommodations, Expenses: Roche Julie D. Milia No relationship to disclose Roman K. Thomas Stock or Other Ownership: Blackfield AG, New Oncology Consulting or Advisory Role: BiPar/sanofi-aventis, Merck, Roche, Boehringer Ingelheim, Clovis Oncology, Novartis, Pfizer, Roche, Puma, Blackfield AG, New Oncology Research Funding: Merck, EOS GmbH, AstraZeneca Patents, Royalties, Other Intellectual Property: Several patent applications related to cancer biomarkers and drug response Travel, Accommodations, Expenses: AstraZeneca, Daiichi Sankyo, Blackfield AG, Pfizer, New Oncology Oliver Gautschi Consulting or Advisory Role: Pfizer
Benjamin Besse Research Funding: Pfizer Luc Thiberville Honoraria: Pfizer Travel, Accommodations, Expenses: Eli Lilly, Boehringer Ingelheim, GlaxoSmithKline © 2015 by American Society of Clinical Oncology
JOURNAL OF CLINICAL ONCOLOGY
Information downloaded from jco.ascopubs.org and provided by at UNIVERSITY OF SASKATCHEWAN on March 19, 2015 Copyright © 2015 Americanfrom Society of Clinical Oncology. All rights reserved. 128.233.210.97
Crizotinib for ROS1 Lung Cancer
Appendix
A
B
C
D
Fig A1. Examples of dramatic responses in patients with ROS1 rearrangements treated with crizotinib. Positron emission tomography scans in patient 1 in (A) December 2013 and (B) January 2014. Computed tomography scans in patient 2 in (C) August 2013 and (D) May 2014.
www.jco.org
© 2015 by American Society of Clinical Oncology
Information downloaded from jco.ascopubs.org and provided by at UNIVERSITY OF SASKATCHEWAN on March 19, 2015 Copyright © 2015 Americanfrom Society of Clinical Oncology. All rights reserved. 128.233.210.97
33
䡠
NUMBER
9
䡠
MARCH
20
2015
JOURNAL OF CLINICAL ONCOLOGY
O R I G I N A L
R E P O R T
Crizotinib Therapy for Advanced Lung Adenocarcinoma and a ROS1 Rearrangement: Results From the EUROS1 Cohort Julien Mazières, Gérard Zalcman, Lucio Crinò, Pamela Biondani, Fabrice Barlesi, Thomas Filleron, Anne-Marie C. Dingemans, Hervé Léna, Isabelle Monnet, Sacha I. Rothschild, Federico Cappuzzo, Benjamin Besse, Luc Thiberville, Damien Rouvière, Rafal Dziadziuszko, Egbert F. Smit, Jurgen Wolf, Christian Spirig, Nicolas Pecuchet, Frauke Leenders, Johannes M. Heuckmann, Joachim Diebold, Julie D. Milia, Roman K. Thomas, and Oliver Gautschi See accompanying editorial on page 972 Author affiliations appear at the end of this article. Published online ahead of print at www.jco.org on February 9, 2015. Supported in part by the Cancer Pharmacology of Toulouse–Oncopole and Region (CAPTOR) academic project (Grant No. ANR-11-PHUC-0001). Presented in part at the 50th Annual Meeting of the American Society of Clinical Oncology, May 29-June 2, 2014, Chicago, IL. Authors’ disclosures of potential conflicts of interest are found in the article online at www.jco.org. Author contributions are found at the end of this article. Corresponding author: Julien Mazières, MD, PhD, Thoracic Oncology Unit, Respiratory Disease Department, Hôpital Larrey, Centre Hospitalier Universitaire Toulouse, Chemin de Pouvourville, 31059 Toulouse Cedex, France; e-mail: [email protected]. © 2015 by American Society of Clinical Oncology 0732-183X/15/3309w-992w/$20.00 DOI: 10.1200/JCO.2014.58.3302
A
B
S
T
R
A
C
T
Purpose Approximately 1% of lung adenocarcinomas are driven by oncogenic ROS1 rearrangement. Crizotinib is a potent inhibitor of both ROS1 and ALK kinase domains. Patients and Methods In the absence of a prospective clinical trial in Europe, we conducted a retrospective study in centers that tested for ROS1 rearrangement. Eligible patients had stage IV lung adenocarcinoma, had ROS1 rearrangement according to fluorescent in situ hybridization, and had received crizotinib therapy through an individual off-label use. Best response was assessed locally using RECIST (version 1.1). All other data were analyzed centrally. Results We identified 32 eligible patients. One patient was excluded because next-generation sequencing was negative for ROS1 fusion. Median age was 50.5 years, 64.5% of patients were women, and 67.7% were never-smokers. Thirty patients were evaluable for progressionfree survival (PFS), and 29 patients were evaluable for best response. We observed four patients with disease progression, two patients with stable disease, and objective response in 24 patients, including five complete responses (overall response rate, 80%; disease control rate, 86.7%). Median PFS was 9.1 months, and the PFS rate at 12 months was 44%. No unexpected adverse effects were observed. Twenty-six patients received pemetrexed (either alone or in combination with platinum and either before or after crizotinib) and had a response rate of 57.7% and a median PFS of 7.2 months. Conclusion Crizotinib was highly active at treating lung cancer in patients with a ROS1 rearrangement, suggesting that patients with lung adenocarcinomas should be tested for ROS1. Prospective clinical trials with crizotinib and other ROS1 inhibitors are ongoing or planned. J Clin Oncol 33:992-999. © 2015 by American Society of Clinical Oncology
INTRODUCTION
In the last decade, scientists have characterized key molecular alterations that drive lung carcinogenesis.1 On the basis of these seminal findings, large phase III trials have been conducted, leading to the approval of epidermal growth factor receptor (EGFR) –targeting and anaplastic lymphoma kinase (ALK) –targeting therapies in molecularly defined populations.2-5 Targeted therapies for patients with other molecular aberrations are also in development. Promising early results have been reported 992
from clinical trials on selumetinib to target KRAS exon 2 mutations,6 neratinib for HER2 insertion 20,7 dabrafenib for BRAF V600E,8 and cabozantinib for RET fusion.9 Moreover, individual reports suggest trastuzumab may be useful in patients with HER2 insertion 20,10,11 vemurafenib for BRAF V600E,12 and vandetanib for RET fusion-positive lung cancer.13 The c-ros oncogene 1 (ROS1) is also a new target for lung cancer. It encodes a tyrosine kinase receptor from the insulin receptor family. Chromosomal rearrangements involving the ROS1 gene
© 2015 by American Society of Clinical Oncology
Information downloaded from jco.ascopubs.org and provided by at UNIVERSITY OF SASKATCHEWAN on March 19, 2015 Copyright © 2015 Americanfrom Society of Clinical Oncology. All rights reserved. 128.233.210.97
Crizotinib for ROS1 Lung Cancer
were originally described in glioblastomas, where ROS1 (chromosome 6q22) was fused to the FIG gene; results showed transformation in transgenic mice.14-17 In non–small-cell lung cancer (NSCLC) cell lines and primary tumors, ROS1 fusion has been identified as a driver mutation.18 ROS1 fusion partners include SLC34A2, CD74, TPM3, SDC4, EZR, LRIG3, KDELR2, and CCDC6.19 ROS1 rearrangement occurs in 1% to 2% of NSCLCs.19-21 The kinase domain is always fully retained on the ROS1 fusion protein, and the junction point at the mRNA level always occurs at the 5= end of exons 32 to 36.22 Interestingly, the ROS1 kinase domain has significant homology with the ALK kinase domain. ROS1-positive patients share similar characteristics with ALK-positive patients, such as adenocarcinoma histology, histomorphology, young age, and a high prevalence of nonsmoker status.23 Crizotinib is an oral tyrosine kinase inhibitor with an affinity for ALK, MET, and ROS1 kinase domains.24 Crizotinib is currently approved for patients with advanced lung cancer and ALK rearrangement and also has clinical activity in lung cancers that have high levels of MET amplification.5,24-26 Preclinical experiments have revealed that cell lines harboring ROS1 rearrangement were sensitive to ROS1 kinase inhibition,18,27 which led to the expansion of the initial crizotinib phase I trial. This demonstrated impressive clinical activity of crizotinib against ROS1-positive lung cancer.21,28 In turn, this prompted many centers to start ROS1 testing in routine clinical practice, with striking results reported in individual patients.29,30 The current cohort study, European Study of ROS1 Patients (EUROS1), was conducted in the absence of a prospective clinical trial in Europe to characterize the outcomes of ROS1-positive patients who had undergone documented crizotinib therapy.
with crizotinib in European centers that test for ROS1. Clinical and biologic data were collected from each patient by pathologists and treating physicians. The data were anonymized at the local center and then analyzed in Toulouse, France. Histology was assessed locally by a specialist lung cancer pathologist using WHO criteria, and the adenocarcinoma was described according to the new International Association for the Study of Lung Cancer classification.31 TTF1 and other immunostains were used in every patient to validate the diagnosis of NSCLC and to exclude other malignancies. All reports were reviewed centrally. Some patients were also analyzed using a comprehensive, multigene, hybrid, capture-based, parallel-sequencing assay, termed CAGE (Blackfield, Cologne, Germany). 32 Clinicopathologic stage was assigned according to the seventh edition TNM staging system.33 We retrospectively collected clinical data (age at diagnosis, date of diagnosis, tobacco consumption, and tumor stage), outcome variables (recurrence and survival events), and lines of systemic therapies. For all patients, we collected information on the type of chemotherapy or targeted therapy, the date of initiation and end of treatment, best response, and the occurrence of grade 4 or 5 toxicities. Eligible patients needed to have undergone adequate follow-up visits that included thoracic and abdominal computed tomography scans at baseline and after 6 to 8 weeks of crizotinib therapy. Responses were defined as the best response from the start of treatment until disease progression, according to RECIST (version 1.1). Tumor assessment was not centrally analyzed, but the coordinating investigators reviewed the radiologic reports and obtained original images for central assessment if the report and the local assessment were discordant. Treatments All patients enrolled onto this study were treated with crizotinib (250 mg two times per day) for a minimum duration of 2 weeks. Health insurances supported treatment for patients based on individual applications for off-label use. Because this was a retrospective study, we were not able to prospectively monitor safety. We asked every investigator to retrospectively declare all grade 4 and 5 adverse effects their patients reported while receiving crizotinib.
PATIENTS AND METHODS Patients This study was conducted in six European countries (France, Switzerland, Italy, Germany, Poland, and the Netherlands) and represents a consecutive series of identified patients carrying a ROS1 rearrangement and treated
False positive (NGS)
ROS1+ patients treated with crizotinib
(n = 32)
ROS1+ patients treated with crizotinib
(n = 31)
(n = 1)
PFS for pemetrexed- (n = 26) treated patients (Fig 2)
www.jco.org
Ethical Considerations Individual consent from patients, to collect anonymized clinical and biologic data, were obtained by the physicians according to the local regulations for observational studies in each European country. Institutional review board approval was granted by the University Hospital of
Death before 2-week treatment
(n = 1)
Not evaluable for tumor response
(n = 1)
Fig 1. CONSORT diagram. NGS, nextgeneration sequencing; PFS, progressionfree survival. Crizotinib-treated patients PFS (Fig 4)
(n = 30)
% of best response (RECIST; Fig 3)
(n = 29)
© 2015 by American Society of Clinical Oncology
Information downloaded from jco.ascopubs.org and provided by at UNIVERSITY OF SASKATCHEWAN on March 19, 2015 Copyright © 2015 Americanfrom Society of Clinical Oncology. All rights reserved. 128.233.210.97
993
Mazières et al
1.0
A
B
C
D Fig 2. Diagnosis of ROS1 rearrangement in lung cancer tissues. Immunohistochemistry analyses with positivity for (A) TTF1 and (B) ROS1 antibodies (magnification, ⫻20). (C and D) Examples of positive fluorescent in situ hybridization for ROS1 performed on unstained 3- to 4-m formalin-fixed, paraffin-embedded tumor tissue sections with the use of a ROS1 break-apart probe set (courtesy S. Lecot-Cotigny, E. LechaptZalcman, Caen, France). (E) Next-generation sequencing panel provided by Frauke Leenders and Roman Thomas (Department of Genetics, University Hospital Cologne, Cologne, Germany).
E
ROS1
ATG
chr6: 117646625
ex34
CD74
ex33
chr5: 149783239
ex7
ATG
ex6
ATG ex34
Genomic structure of the fusion point
ex6
…tctctgtcccaaagtgataggaggttaacac…
CD74-ROS1 ex6 ex34
Potential fusion protein
………ACT GAC GCT CCA CCG AAA GAT GAT TTT TGG ATA CCA …….
T D A P P K E D F W I P
Toulouse (France) for central data analyses. The patients’ data were anonymized by the treating physicians and forwarded to the central statistical office in an electronic format. ROS1 Diagnostics Fluorescence in situ hybridization (FISH) was performed on cytology or tissue samples, using commercially available ROS1 probes, such as the Zytoli994
© 2015 by American Society of Clinical Oncology
ght SPEC ROS1 dual-color break-apart rearrangement probe (ZytoVision, Bremerhaven, Germany), and other commercial products. FISH scoring was performed by experienced technicians in certified laboratories, and the results were reviewed by expert pathologists. The scoring system established for ALK FISH was applied. A tumor was defined as positive for a ROS1 rearrangement if a split signal (single red and single green signal, with a signal-separation distance of at least two signal diameters) was present in at least 15% of the JOURNAL OF CLINICAL ONCOLOGY
Information downloaded from jco.ascopubs.org and provided by at UNIVERSITY OF SASKATCHEWAN on March 19, 2015 Copyright © 2015 Americanfrom Society of Clinical Oncology. All rights reserved. 128.233.210.97
Crizotinib for ROS1 Lung Cancer
tumor cells analyzed. At least 50 tumor cells were counted in each sample. Inflammatory and stromal cells served as internal controls and showed two fused or adjacent red and green signals, with a signal-separation distance of less than two signal diameters. In France, according to recommendations of a national expert pathologist panel, patients were first screened using ROS1 immunohistochemistry.34 The percentages of positively stained cells were evaluated, and staining scores were assessed as follows: 0, no staining; 1⫹, faint cytoplasmic staining; 2⫹, moderate cytoplasmic staining; and 3⫹, intense granular cytoplasmic staining. Samples with a positive ROS1 immunohistochemistry (1⫹ to 3⫹) were further assessed by FISH. Samples from individual patients who were refractory to crizotinib or displayed other activating mutations were validated by hybrid capture based on a targeted genomic sequencing assay (CAGE). This sequenced a genomic partition that covered exonic and intronic regions of ROS1 between exons 31 and 34, as well as other known driver mutations.32 Further local test results collected in this study included EGFR exons 18 to 21, KRAS exon 2, HER2 exon 20, BRAF exon 600, EML4-ALK (FISH), and KIF5B-RET (FISH; Fig 1). Statistics Data were summarized according to frequency and percentage for categorical variables and by medians and ranges for continuous variables. Progression-free survival (PFS) was measured as the time from the beginning of treatment to progression or death. Patients alive without progression at the time of analysis were censored at their last follow-up assessment. Survival rates were estimated using the Kaplan-Meier method. Statistical analyses were performed using STATA 12.0 software (StataCorp, College Station, TX).
RESULTS
Genetic Characteristics of Patients With a ROS1 Translocation We identified 32 patients with ROS1 FISH–positive lung cancer treated with crizotinib in 16 centers from six European countries. ROS1 rearrangement was diagnosed in every patient by FISH testing using a standard break-apart procedure (Fig 2). All patients were previously tested for EGFR, ALK, and KRAS mutations, and most were tested for BRAF, PI3KCA, HER2, and RET. Most ROS1 translocations were exclusive drivers, except in two patients, who had a tumor that harbored a concomitant KRAS exon 2 mutation. The tumors with concomitant KRAS mutations and ROS1 fusion (by FISH) were reassessed using next-generation sequencing. One patient was positive for KRAS and negative for breakpoint detection in ROS1 exons 31 to 34 and was thus excluded from the analyses. The other patient was undoubtedly positive for both KRAS and ROS1 and was included. Clinicopathologic Characteristics of Patients With a ROS1 Translocation Clinical and diagnostic features of the 31 patients who harbored a ROS1 translocation were analyzed (Table 1). Patients were diagnosed at a median age of 50.5 years (range, 34 to 78 years). There was a higher proportion of women (20 women v 11 men; 64.5% v 35.5%, respectively) and of never-smokers (22 neversmokers v six former smokers and three current smokers; 71% v 19.3% and 9.7%, respectively). All patients had stage IV disease at the time of crizotinib treatment. All tumors were adenocarcinomas, including five with a lepidic component and one tumor with a composite adenosquamous histology. www.jco.org
Table 1. Clinical and Biologic Characteristics of Patients With Lung Cancer and a ROS1 Rearrangement Characteristics Age at diagnosis, years Mean Standard deviation Median Sex F M Tobacco use Never Former Current Unknown Tumor stage (at the time of initial diagnosis) I II III IV Metastasis sites for stage IV disease Lung Brain Bone Multiple organs Lymph node Pleural Other or unknown ROS1 detection methods IHC and FISH (France) FISH alone FISH and NGS
No. of Patients (N ⫽ 31)
%
53.4 11.9 50.5 20 11
64.5 35.5
22 6 3 0
71 19.3 9.7
1 1 4 25 31 5 1 2 8 5 3 7
3.2 3.2 12.9 80.7 16.2 3.2 6.5 25.8 16.2 9.7 22.6
12 15 4
38.7 48.4 12.9
Abbreviations: FISH, fluorescent in situ hybridization; IHC, immunohistochemistry; NGS, next-generation sequencing.
Treatment Response to Chemotherapy in Patients With NSCLC Who Harbored a ROS1 Translocation Patients received zero (n ⫽ 1), one (n ⫽ 9), two (n ⫽ 5), three (n ⫽ 3), or more than three (n ⫽ 13) lines of chemotherapy before crizotinib. Because ALK-positive tumors are known to be sensitive to pemetrexed and because preliminary reports suggest the same in ROS1 patients,35 we also analyzed the outcomes of patients who received pemetrexed chemotherapy given either alone or in combination with platinum at any time in the past. Indeed, most patients (n ⫽ 26, 84%) had received pemetrexed-based chemotherapy. The treatment was given more frequently at the beginning of the disease (first- or second-line treatment, n ⫽ 22, 85%; and later lines in four patients). Partial responses were observed in 15 patients (57.7%). The median PFS time with pemetrexed-based chemotherapy was 7.2 months (95% CI, 4.8 to 9.6 months), with the survival curve presented in Figure 3. Treatment Response to Crizotinib in Patients With NSCLC Who Harbored a ROS1 Translocation All patients received crizotinib at 250 mg twice per day. Because of the retrospective nature of our study, we were only able to collect information on grade 4 and 5 toxicities. In our series, no patients experienced a grade 4 or 5 adverse effect. One patient experienced a © 2015 by American Society of Clinical Oncology
Information downloaded from jco.ascopubs.org and provided by at UNIVERSITY OF SASKATCHEWAN on March 19, 2015 Copyright © 2015 Americanfrom Society of Clinical Oncology. All rights reserved. 128.233.210.97
995
Mazières et al
1.0
Progression-Free Survival (proportion)
Progression-Free Survival (proportion)
1.0
0.8
0.6
0.4
0.2
0
26
52
78
104
130 156
182
208
0.8
0.6
0.4
0.2
0
234
6 12 18 24 30 36 42 48 54 60 66 72 78 84
Time (weeks)
Time (weeks)
Fig 5. Progression-free survival on crizotinib in patients with lung cancer and an ROS1 rearrangement.
Fig 3. Progression-free survival on pemetrexed-based chemotherapy in patients with lung cancer and an ROS1 rearrangement.
grade 3 liver toxicity, leading to temporary withdrawal of crizotinib and dose reduction, but no patient definitely discontinued crizotinib as a result of an adverse effect. Thirty patients were evaluated for PFS analyses and 29 patients were evaluated for best response according to RECIST criteria, because one patient died after 1 week of treatment (and was not included in the PFS analysis) and another patient died after 2 weeks but before tumor assessment (and was not included in the best response analysis). Patients received crizotinib as a first- or second-line treatment (n ⫽ 10, 32%) or, more frequently, after two or more lines of chemo-
therapy (n ⫽ 21, 68%). All patients had progressive disease at the time of crizotinib initiation (except the chemotherapy-naive patient). On crizotinib, four patients had progressive disease, two had stable disease, and 24 achieved objective responses, which included five complete responses (overall response rate, 80%; disease control rate, 86.6%). A waterfall plot of patients evaluable for best response (n ⫽ 29) is shown in Figure 4. Median PFS time was 9.1 months, and the PFS rate at 12 months was 44% (Fig 5). At the time of analysis, 18 patients were still receiving treatment (Fig 6). Examples of tumor
120 100 100
93
80 60
Change (%)
40
28
20 0
0
0 -20 -30 -30
-40
-40 -40 -40 -40 -60
-44 -45
-50 -52 -55
-59
-80
-65 -66 -69 -70
-75
-80 -90
-100
-100 -100 -100 -100 -100 -120 No. of previous lines of chemotherapy before crizotinib
5
3
4
4
5
1
1
1
1
4
6
3
4
1
1
5
4
3
9
2
1
4
2
5
0
1
1
2
2
Fig 4. Waterfall plot of the best response to crizotinib in patients with lung cancer and an ROS1 rearrangement. 996
© 2015 by American Society of Clinical Oncology
JOURNAL OF CLINICAL ONCOLOGY
Information downloaded from jco.ascopubs.org and provided by at UNIVERSITY OF SASKATCHEWAN on March 19, 2015 Copyright © 2015 Americanfrom Society of Clinical Oncology. All rights reserved. 128.233.210.97
Crizotinib for ROS1 Lung Cancer
32 22 17 7 12 5 3† 28 10 23 4 1 24 18 21 8 16 15 25
Fig 6. Duration of crizotinib treatment in patients with lung cancer and an ROS1 rearrangement.
19† 26† 2 29 13† 27 11† 6 20† 30 32† 14†
Relapse Ongoing crizotinib treatment
†
0
20
40
60
80
Death
100
120
Time (weeks)
response are shown in Appendix Figure A1 (online only). Interestingly, crizotinib primary resistance was associated with KRAS concomitant mutation, isolated brain progression, poor health status, or reduction of crizotinib dosing as a result of liver toxicity. DISCUSSION
Precision medicine for patients with lung cancer is a rapidly developing field. One of the most recently identified therapeutic targets is ROS1, which was described for the first time in a series of lung cancer patients in 2012.21 Since then, only a handful of retrospective series have improved characterization of this subset population with a ROS1 rearrangement. The incidence of the ROS1 rearrangement is low (0.6% to 2% of unselected adenocarcinomas) and has been associated with adenocarcinoma with extracellular mucin,23 lepidic patterns, and coexpression of TTF1.36 A high prevalence of solid cribriform and acinar adenocarcinoma, with signet ring cells, has been also reported.34 Of interest, we observed ROS1 translocation in five adenocarcinomas with lepidic features, which suggests that adenocarcinomas with a lepidic pattern should be screened for ROS1. The patient characteristics from our series were consistent with those reported earlier, with a predominance of women and of being never-smokers or light smokers.21,34,37 Interestingly, brain metastases seem to be less frequent than in patients with ALK translocation. However, there was no exact correlation, suggesting that the patient characteristics should not necessarily guide decisions on testing for ROS1. The discovery of ROS1 as an oncogenic driver in lung cancer is paralleled to the discovery of crizotinib as a targeted therapy.38 Early clinical data support the potency of crizotinib in patients with www.jco.org
a ROS1 rearrangement.29,30 We report here a high response rate (80%). Because our study is retrospective, it is possible there is an overestimation in our results that might be a result of the small sample size, patient selection, investigator-based response assessment, or population-based pharmacologic differences. We did not perform a central review of tumor assessment but made a special effort to review all of the computed tomography scan reports and original images if needed. Moreover, all of the authors are experienced in clinical research and RECIST evaluation. Our study mirrors the recently published phase I study that showed an overall response rate of 72%.28 It is noteworthy that, in our study, the patients were pretreated with chemotherapy (except one patient who received first-line crizotinib) and were unselected for health status or comorbidities. Thus, we have shown that the findings reported in highly selected patients in a phase I trial can be translated to the routine use of a drug. The size of our cohort was larger than expected, indicating that many European centers implemented ROS1 testing in clinical practice shortly after the first phase I report in 2012.21 The timeline of this process is remarkable, as already observed with imatinib in gastrointestinal stromal tumor.39,40 Consistent with ALK-positive patients and with a preliminary report, pemetrexed in our cohort was also associated with encouraging activity in ROS1-positive patients.35 We observed an overall response rate of 57.7% and a median PFS time of 7.2 months. However, our cohort included patients who received pemetrexed alone or in combination with a platinum-based therapy. These results are only preliminary, and no clinical decisions should be made at present for ROS1-positive patients with regard to the choice of optimal chemotherapy. © 2015 by American Society of Clinical Oncology
Information downloaded from jco.ascopubs.org and provided by at UNIVERSITY OF SASKATCHEWAN on March 19, 2015 Copyright © 2015 Americanfrom Society of Clinical Oncology. All rights reserved. 128.233.210.97
997
Mazières et al
Crizotinib seems to be the current treatment of choice for ROS1positive patients. In 2014, the prospective phase II trials European Trial on Crizotinib in ROS1 Translocated Lung Cancer (EUCROSS; Germany, Switzerland, and Spain), METROS (Italy), and Accès Sécurisé aux Médicaments Innovants (AcSé) Crizotinib (France) were initiated to confirm the activity of crizotinib to treat ROS1-positive lung cancer in Europe. Other trials with PF-06463922 (NCT01970865), ceritinib (NCT01964157), and RXDX-101 (NCT02097810) are also ongoing or are planned. Other compounds have shown potent in vitro activity against ROS1-mutated tumors in animal and ex vivo cultures (foretinib and cabozantinib). To identify patients for these trials or for crizotinib off-label use, ROS1 testing is indispensable. Nevertheless, because of the rarity of ROS1 rearrangement, systematic high-throughput testing is challenging. Because ROS1 rearrangement occurs almost exclusively with other genomic aberrations, it should be preferentially analyzed in triple-negative (EGFR, ALK, and KRAS) patients even though we, and others, have identified some comutated tumors with KRAS and EGFR mutations.41 This strategy has allowed some centers to increase their rate of identification of ROS1 rearrangement by 5% to 7%.34,42 In line with these data, the National Comprehensive Cancer Network 2014 guidelines recommend that all patients with advanced triple-negative lung adenocarcinoma should be tested for additional molecular markers, including ROS1. Immunohistochemistry can also be used as a prescreening method. Most academic platforms in France are using immunohistochemistry for screening and FISH for validation, although immunohistochemistry may have limitations.34,43 Interestingly, one patient in our cohort was initially considered positive by FISH (along with a KRAS mutation) but was reclassified as negative by next-generation sequencing. This suggests that capture-based, multigene, massively parallel shotgun sequencing may help to eliminate false-positive results, while enhancing detection rates compared with conventional methods, especially in pannegative lung adenocarcinomas from patients with no smoking or a light smoking history.9 Several methods are currently available for ROS1 testing, and the best method remains to be defined. Individual preference depends on availability, financial resources, and experience. Regardless of the method used, rigorous quality control is absolutely mandatory, and testing should only be done in certified laboratories by experienced personnel. Another clinically relevant issue is resistance to ROS1 inhibition. The mechanisms are still only partially understood. This may be because of the acquisition of a new mutation within the ROS1 kinase domain44,45 or the activation of other pathways, such as EGFR22 or REFERENCES 1. Pao W, Girard N: New driver mutations in non-small-cell lung cancer. Lancet Oncol 12:175180, 2011 2. Mok TS, Wu YL, Thongprasert S, et al: Gefitinib or carboplatin-paclitaxel in pulmonary adenocarcinoma. N Engl J Med 361:947-957, 2009 3. Rosell R, Carcereny E, Gervais R, et al: Erlotinib versus standard chemotherapy as firstline treatment for European patients with advanced EGFR mutation-positive non-small-cell lung cancer (EURTAC): A multicentre, open-label, randomised phase 3 trial. Lancet Oncol 13:239246, 2012 998
© 2015 by American Society of Clinical Oncology
KRAS. In our study, in patients with progressive or stable disease, we identified concomitant KRAS mutation, isolated brain progression, late treatment, poor health status, and low dose of crizotinib as potential resistance factors. Further important issues need to be addressed, including the costs of extended testing, the need for a regulatory companion diagnostic assay, the requirements for drug-label extensions, and the approval for therapies that target other rare cancer subtypes.46 We believe that targeted therapies with response rates of more than 50% represent a major breakthrough in lung cancer therapy and should be a priority in drug development.47,48 Patients with ROS1 fusion are rare, and registration trials are lengthy. Thus, patients with a ROS1 fusion and for whom an active targeted therapy exists should have accelerated access to precision medical treatment through collaborative trials, international programs, and national registries. AUTHORS’ DISCLOSURES OF POTENTIAL CONFLICTS OF INTEREST Disclosures provided by the authors are available with this article at www.jco.org.
AUTHOR CONTRIBUTIONS Conception and design: Julien Mazières, Gérard Zalcman, Oliver Gautschi Administrative support: Julie D. Milia Provision of study materials or patients: Gérard Zalcman, Fabrice Barlesi, Anne-Marie C. Dingemans, Hervé Léna, Isabelle Monnet, Sacha I. Rothschild, Federico Cappuzzo, Benjamin Besse, Luc Thiberville, Damien Rouvière, Rafal Dziadziuszko, Egbert F. Smit, Jurgen Wolf, Christian Spirig, Nicolas Pecuchet, Frauke Leenders, Julie D. Milia, Roman K. Thomas, Oliver Gautschi Collection and assembly of data: Julien Mazières, Gérard Zalcman, Lucio Crinò, Pamela Biondani, Fabrice Barlesi, Anne-Marie C. Dingemans, Hervé Léna, Isabelle Monnet, Sacha I. Rothschild, Federico Cappuzzo, Benjamin Besse, Luc Thiberville, Damien Rouviére, Rafal Dziadziuszko, Egbert F. Smit, Jurgen Wolf, Christian Spirig, Nicolas Pecuchet, Frauke Leenders, Johannes M. Heuckmann, Joachim Diebold, Julie D. Milia, Roman K. Thomas, Oliver Gautschi Data analysis and interpretation: Julien Mazières, Gérard Zalcman, Pamela Biondani, Fabrice Barlesi, Thomas Filleron, Anne-Marie C. Dingemans, Federico Cappuzzo, Egbert F. Smit, Christian Spirig, Julie D. Milia, Roman K. Thomas, Oliver Gautschi Manuscript writing: All authors Final approval of manuscript: All authors
4. Sequist LV, Yang JC, Yamamoto N, et al: Phase III study of afatinib or cisplatin plus pemetrexed in patients with metastatic lung adenocarcinoma with EGFR mutations. J Clin Oncol 31:3327-3334, 2013 5. Shaw AT, Kim DW, Nakagawa K, et al: Crizotinib versus chemotherapy in advanced ALK-positive lung cancer. N Engl J Med 368:2385-2394, 2013 6. Jänne PA, Shaw AT, Pereira JR, et al: Selumetinib plus docetaxel for KRAS-mutant advanced non-small-cell lung cancer: A randomised, multicentre, placebo-controlled, phase 2 study. Lancet Oncol 14:38-47, 2013 7. Gandhi L, Bahleda R, Tolaney SM, et al: Phase I study of neratinib in combination with temsirolimus in patients with human epidermal growth factor
receptor 2-dependent and other solid tumors. J Clin Oncol 32:68-75, 2014 8. Planchard D, Mazieres J, Riely GJ, et al: Interim results of phase II study BRF113928 of dabrafenib in BRAF V600E mutation–positive nonsmall cell lung cancer (NSCLC) patients. J Clin Oncol 31, 2013 (suppl; abstr 8009) 9. Drilon A, Wang L, Hasanovic A, et al: Response to cabozantinib in patients with RET fusion-positive lung adenocarcinomas. Cancer Discov 3:630-635, 2013 10. Cappuzzo F, Bemis L, Varella-Garcia M: HER2 mutation and response to trastuzumab therapy in nonsmall-cell lung cancer. N Engl J Med 354:2619-2621, 2006 11. Mazières J, Peters S, Lepage B, et al: Lung cancer that harbors an HER2 mutation: Epidemiologic JOURNAL OF CLINICAL ONCOLOGY
Information downloaded from jco.ascopubs.org and provided by at UNIVERSITY OF SASKATCHEWAN on March 19, 2015 Copyright © 2015 Americanfrom Society of Clinical Oncology. All rights reserved. 128.233.210.97
Crizotinib for ROS1 Lung Cancer
characteristics and therapeutic perspectives. J Clin Oncol 31:1997-2003, 2013 12. Gautschi O, Pauli C, Strobel K, et al: A patient with BRAF V600E lung adenocarcinoma responding to vemurafenib. J Thorac Oncol 7:e23-e24, 2012 13. Gautschi O, Zander T, Keller FA, et al: A patient with lung adenocarcinoma and RET fusion treated with vandetanib. J Thorac Oncol 8:e43-e44, 2013 14. Birchmeier C, O’Neill K, Riggs M, et al: Characterization of ROS1 cDNA from a human glioblastoma cell line. Proc Natl Acad Sci U S A 87:4799-4803, 1990 15. Birchmeier C, Sharma S, Wigler M: Expression and rearrangement of the ROS1 gene in human glioblastoma cells. Proc Natl Acad Sci U S A 84: 9270-9274, 1987 16. Charest A, Lane K, McMahon K, et al: Fusion of FIG to the receptor tyrosine kinase ROS in a glioblastoma with an interstitial del(6)(q21q21). Genes Chromosomes Cancer 37:58-71, 2003 17. Charest A, Wilker EW, McLaughlin ME, et al: ROS fusion tyrosine kinase activates a SH2 domaincontaining phosphatase-2/phosphatidylinositol 3kinase/mammalian target of rapamycin signaling axis to form glioblastoma in mice. Cancer Res 66:7473-7481, 2006 18. Rikova K, Guo A, Zeng Q, et al: Global survey of phosphotyrosine signaling identifies oncogenic kinases in lung cancer. Cell 131:1190-1203, 2007 19. Takeuchi K, Soda M, Togashi Y, et al: RET, ROS1 and ALK fusions in lung cancer. Nat Med 18:378-381, 2012 20. Davies KD, Le AT, Theodoro MF, et al: Identifying and targeting ROS1 gene fusions in non-small cell lung cancer. Clin Cancer Res 18:4570-4579, 2012 21. Bergethon K, Shaw AT, Ou SH, et al: ROS1 rearrangements define a unique molecular class of lung cancers. J Clin Oncol 30:863-870, 2012 22. Davies KD, Doebele RC: Molecular pathways: ROS1 fusion proteins in cancer. Clin Cancer Res 19:4040-4045, 2013 23. Pan Y, Zhang Y, Li Y, et al: ALK, ROS1 and RET fusions in 1139 lung adenocarcinomas: A comprehensive study of common and fusion patternspecific clinicopathologic, histologic and cytologic features. Lung Cancer 84:121-126, 2014 24. Kwak EL, Bang YJ, Camidge DR, et al: Anaplastic lymphoma kinase inhibition in non-small-cell lung cancer. N Engl J Med 363:1693-1703, 2010
25. Mok T, Kim D-W, Wu Y-L, et al: First-line crizotinib versus pemetrexed– cisplatin or pemetrexed– carboplatin in patients (pts) with advanced ALK-positive non-squamous non-small cell lung cancer (NSCLC): Results of a phase III study (PROFILE 1014). J Clin Oncol 32, 2014 (suppl 5s; abstr 8002) 26. Camidge DR, Ou S-HI, Shapiro G, et al: Efficacy and safety of crizotinib in patients with advanced c-MET-amplified non-small cell lung cancer (NSCLC). J Clin Oncol 32, 2014 (suppl 15; abstr 8001) 27. Yasuda H, de Figueiredo-Pontes LL, Kobayashi S, et al: Preclinical rationale for use of the clinically available multitargeted tyrosine kinase inhibitor crizotinib in ROS1-translocated lung cancer. J Thorac Oncol 7:1086-1090, 2012 28. Shaw AT, Ou SH, Bang YJ, et al: Crizotinib in ROS1-rearranged non-small-cell lung cancer. N Engl J Med 371:1963-1971, 2014 29. Bos M, Gardizi M, Schildhaus HU, et al: Complete metabolic response in a patient with repeatedly relapsed non-small cell lung cancer harboring ROS1 gene rearrangement after treatment with crizotinib. Lung Cancer 81:142-143, 2013 30. Dziadziuszko K, Szurowska E, Pienkowska J, et al: Miliary brain metastases in a patient with ROS1-rearranged lung adenocarcinoma: A case report. J Thorac Oncol 9:e34-e36, 2014 31. Travis WD, Brambilla E, Noguchi M, et al: International Association for the Study of Lung Cancer/ American Thoracic Society/European Respiratory Society international multidisciplinary classification of lung adenocarcinoma. J Thorac Oncol 6:244-285, 2011 32. Fernandez-Cuesta L, Plenker D, Osada H, et al: CD74-NRG1 fusions in lung adenocarcinoma. Cancer Discov 4:415-422, 2014 33. Goldstraw P, Crowley J, Chansky K, et al: The IASLC Lung Cancer Staging Project: Proposals for the revision of the TNM stage groupings in the forthcoming (seventh) edition of the TNM classification of malignant tumours. J Thorac Oncol 2:706714, 2007 34. Mescam-Mancini L, LantuéjoulS, Moro-Sibilot D, et al: On the relevance of a testing algorithm for the detection of ROS1-rearranged lung adenocarcinomas. Lung Cancer 83:168-173, 2014 35. Riess JW, Padda SK, Bangs CD, et al: A case series of lengthy progression-free survival with pemetrexed-containing therapy in metastatic non– small-cell lung cancer patients harboring ROS1 gene rearrangements. Clin Lung Cancer 14:592-595, 2013
36. Warth A, Muley T, Dienemann H, et al: ROS1 expression and translocations in non-small-cell lung cancer: Clinicopathological analysis of 1478 cases. Histopathology 65:187-194, 2014 37. Kim MH, Shim HS, Kang DR, et al: Clinical and prognostic implications of ALK and ROS1 rearrangements in never-smokers with surgically resected lung adenocarcinoma. Lung Cancer 83:389-395, 2014 38. Arai Y, Totoki Y, Takahashi H, et al: Mouse model for ROS1-rearranged lung cancer. PLoS One 8:e56010, 2013 39. Joensuu H, Roberts PJ, Sarlomo-Rikala M, et al: Effect of the tyrosine kinase inhibitor STI571 in a patient with a metastatic gastrointestinal stromal tumor. N Engl J Med 344:1052-1056, 2001 40. Demetri GD, von Mehren M, Blanke CD, et al: Efficacy and safety of imatinib mesylate in advanced gastrointestinal stromal tumors. N Engl J Med 347: 472-480, 2002 41. Go H, Kim DW, Kim D, et al: Clinicopathologic analysis of ROS1-rearranged non-small-cell lung cancer and proposal of a diagnostic algorithm. J Thorac Oncol 8:1445-1450, 2013 42. Kim HR, Lim SM, Kim HJ, et al: The frequency and impact of ROS1 rearrangement on clinical outcomes in never smokers with lung adenocarcinoma. Ann Oncol 24:2364-2370, 2013 43. Cha YJ, Lee JS, Kim HR, et al: Screening of ROS1 rearrangements in lung adenocarcinoma by immunohistochemistry and comparison with ALK rearrangements. PLoS One 9:e103333, 2014 44. Gerlinger M, Norton L, Swanton C: Acquired resistance to crizotinib from a mutation in CD74ROS1. N Engl J Med 369:1172-1173, 2013 45. Awad MM, Katayama R, McTigue M, et al: Acquired resistance to crizotinib from a mutation in CD74-ROS1. N Engl J Med 368:2395-2401, 2013 46. Ou SH, Soo RA, Kubo A, et al: Will the requirement by the US FDA to simultaneously co-develop companion diagnostics (CDx) delay the approval of receptor tyrosine kinase inhibitors for RTK-rearranged (ROS1-, RET-, AXL-, PDGFR-␣-, NTRK1-) non-small cell lung cancer globally? Front Oncol 4:58, 2014 47. Mok TS: A target or a demi-target. Clin Lung Cancer 11:147-148, 2010 48. Johnson DH, Schiller JH, Bunn PA Jr: Recent clinical advances in lung cancer management. J Clin Oncol 32:973-982, 2014
Affiliations Julien Mazières, Damien Rouvière, and Julie D. Milia, Hôpital Larrey, Centre Hospitalier Universitaire, Université Paul Sabatier; Thomas Filleron, Institut Universitaire du Cancer, Toulouse; Gérard Zalcman, Centre Hospitalier Universitaire, Université de Caen-Basse Normandie, Caen; Pamela Biondani and Benjamin Besse, Gustave Roussy, Villejuif; Fabrice Barlesi, Aix-Marseille University, Assistance Publique Hôpitaux de Marseille, Marseille; Hervé Léna, Centre Hospitalier Universitaire, Rennes; Isabelle Monnet, Centre Hospitalier Intercommunal de Créteil, Créteil; Luc Thiberville, Centre Hospitalier Universitaire, Rouen; Nicolas Pecuchet, Institut Curie, Paris, France; Lucio Crinò, Medica-Azienda Ospedaliera, Perugia; Federico Cappuzzo, Istituto Toscano Tumori, Ospedale Civile, Livorno, Italy; Anne-Marie C. Dingemans, Maastricht University Medical Center, Maastricht; Egbert F. Smit, VU University Medical Center, Amsterdam, the Netherlands; Sacha I. Rothschild, University Hospital Basel, Medical Oncology, Basel; Christian Spirig, Klinik St Anna; Joachim Diebold and Oliver Gautschi, Cantonal Hospital Luzern, Lucerne, Switzerland; Rafal Dziadziuszko, Gdansk Medical University, Gdansk, Poland; Jurgen Wolf and Roman K. Thomas, Center of Integrated Oncology Köln–Bonn, University Hospital Cologne, University of Cologne; Frauke Leenders and Roman K. Thomas, University of Cologne; Johannes M. Heuckmann, Blackfield AG, Cologne, Germany. ■ ■ ■
www.jco.org
© 2015 by American Society of Clinical Oncology
Information downloaded from jco.ascopubs.org and provided by at UNIVERSITY OF SASKATCHEWAN on March 19, 2015 Copyright © 2015 Americanfrom Society of Clinical Oncology. All rights reserved. 128.233.210.97
999
Mazières et al
AUTHORS’ DISCLOSURES OF POTENTIAL CONFLICTS OF INTEREST
Crizotinib Therapy for Advanced Lung Adenocarcinoma and a ROS1 Rearrangement: Results From the EUROS1 Cohort The following represents disclosure information provided by authors of this manuscript. All relationships are considered compensated. Relationships are self-held unless noted. I ⫽ Immediate Family Member, Inst ⫽ My Institution. Relationships may not relate to the subject matter of this manuscript. For more information about ASCO’s conflict of interest policy, please refer to www.asco.org/rwc or jco.ascopubs.org/site/ifc. Julien Mazières Consulting or Advisory Role: Roche/Genentech, Boehringer Ingelheim, Bristol-Myers Squibb, Pfizer, Puma Research Funding: Roche/Genentech Gérard Zalcman Consulting or Advisory Role: Roche (Inst), Eli Lilly (Inst), Borhinger Ingleheim (Inst), Pfizer (Inst) Research Funding: Roche (Inst), Pfizer (Inst), AstraZeneca (Inst) Travel, Accommodations, Expenses: Roche, Eli Lilly, Pfizer Lucio Crinò Honoraria: Pfizer Consulting or Advisory Role: Pfizer Travel, Accommodations, Expenses: Pfizer Pamela Biondani No relationship to disclose Fabrice Barlesi Honoraria: Lilly Oncology, Pfizer, Novartis, AstraZeneca, Genentech/ Roche, GlaxoSmithKline, Pierre Fabre Medicament Consulting or Advisory Role: Genentech/Roche Research Funding: Bayer (Inst), Genentech/Roche (Inst), Eli Lilly/ImClone (Inst), GlaxoSmithKline (Inst), AstraZeneca/MedImmune (Inst), Boehringer Ingelheim (Inst), Pfizer (Inst), Bristol-Myers Squibb (Inst), Novartis (Inst), Merck (Inst), Esai (Inst), Daiichi Sankyo (Inst) Travel, Accommodations, Expenses: Genentech/Roche, Novartis, Eli Lilly Thomas Filleron No relationship to disclose Anne-Marie C. Dingemans Consulting or Advisory Role: Roche, Pfizer, Novartis, Bristol-Myers Squibb, Lilly, Boehringer Ingelheim Speakers’ Bureau: Roche Hervé Léna Consulting or Advisory Role: Pfizer, Roche, Bristol-Myers Squibb, Merck, Boehringer Ingelheim Research Funding: Roche (Inst) Travel, Accommodations, Expenses: Roche, Bristol-Myers Squibb, Eli Lilly, Amgen, Pfizer Isabelle Monnet Honoraria: Pfizer Sacha I. Rothschild Consulting or Advisory Role: Pfizer Speakers’ Bureau: Pfizer Federico Cappuzzo Consulting or Advisory Role: Roche, Pfizer, AstraZeneca, Clovis Oncology, Bristol-Myers Squibb Speakers’ Bureau: Roche, Bristol-Myers Squibb, AstraZeneca, Pfizer
Damien Rouvière No relationship to disclose Rafal Dziadziuszko Honoraria: Pfizer, Novartis Consulting or Advisory Role: Pfizer Egbert F. Smit No relationship to disclose Jurgen Wolf Honoraria: AstraZeneca, Bristol-Myers Squibb, Boehringer Ingelheim, MSD Oncology, Clovis Oncology, Novartis, Pfizer, Roche Consulting or Advisory Role: AstraZeneca, Bristol-Myers Squibb, Boehringer Ingelheim, Clovis Oncology, Novartis, Pfizer, Roche, MSD Oncology Research Funding: Novartis, Pfizer, Roche, Boehringer Ingelheim Christian Spirig Consulting or Advisory Role: Roche, Bayer Nicolas Pecuchet Honoraria: Roche, Novartis, GlaxoSmithKline Consulting or Advisory Role: Novartis, Roche, GlaxoSmithKline Travel, Accommodations, Expenses: Roche, Sandoz, GlaxoSmithKline Frauke Leenders Honoraria: Blackfield AG Johannes M. Heuckmann Employment: Blackfield AG Stock or Other Ownership: Blackfield AG Joachim Diebold Consulting or Advisory Role: Roche, Pfizer Speakers’ Bureau: Roche, Pfizer Travel, Accommodations, Expenses: Roche Julie D. Milia No relationship to disclose Roman K. Thomas Stock or Other Ownership: Blackfield AG, New Oncology Consulting or Advisory Role: BiPar/sanofi-aventis, Merck, Roche, Boehringer Ingelheim, Clovis Oncology, Novartis, Pfizer, Roche, Puma, Blackfield AG, New Oncology Research Funding: Merck, EOS GmbH, AstraZeneca Patents, Royalties, Other Intellectual Property: Several patent applications related to cancer biomarkers and drug response Travel, Accommodations, Expenses: AstraZeneca, Daiichi Sankyo, Blackfield AG, Pfizer, New Oncology Oliver Gautschi Consulting or Advisory Role: Pfizer
Benjamin Besse Research Funding: Pfizer Luc Thiberville Honoraria: Pfizer Travel, Accommodations, Expenses: Eli Lilly, Boehringer Ingelheim, GlaxoSmithKline © 2015 by American Society of Clinical Oncology
JOURNAL OF CLINICAL ONCOLOGY
Information downloaded from jco.ascopubs.org and provided by at UNIVERSITY OF SASKATCHEWAN on March 19, 2015 Copyright © 2015 Americanfrom Society of Clinical Oncology. All rights reserved. 128.233.210.97
Crizotinib for ROS1 Lung Cancer
Appendix
A
B
C
D
Fig A1. Examples of dramatic responses in patients with ROS1 rearrangements treated with crizotinib. Positron emission tomography scans in patient 1 in (A) December 2013 and (B) January 2014. Computed tomography scans in patient 2 in (C) August 2013 and (D) May 2014.
www.jco.org
© 2015 by American Society of Clinical Oncology
Information downloaded from jco.ascopubs.org and provided by at UNIVERSITY OF SASKATCHEWAN on March 19, 2015 Copyright © 2015 Americanfrom Society of Clinical Oncology. All rights reserved. 128.233.210.97
