Lung Cancer 87 (2015) 265–271
Contents lists available at ScienceDirect
Lung Cancer journal homepage: www.elsevier.com/locate/lungcan
CpG hypermethylation contributes to decreased expression of PTEN during acquired resistance to gefitinib in human lung cancer cell lines Masashi Maeda a , Yuichi Murakami a,b , Kosuke Watari a , Michihiko Kuwano c , Hiroto Izumi d , Mayumi Ono a,∗ a
Department of Pharmaceutical Oncology, Graduate School of Pharmaceutical Sciences, Kyushu University, Fukuoka 812-8582, Japan St Mary’s Institute of Health Sciences, St Mary’s Hospital, Kurume 830-8543, Japan c Laboratory of Molecular Cancer Biology, Graduate School of Pharmaceutical Sciences, Kyushu University, Fukuoka 812-8582, Japan d Department of Occupational Pneumology, Institute of Industrial Ecological Sciences, University of Occupational and Environmental Health, Kitakyushu 807-8555, Japan b
a r t i c l e
i n f o
Article history: Received 14 August 2014 Received in revised form 29 December 2014 Accepted 13 January 2015 Keywords: Gefitinib-resistance PTEN DNA methylation Lung cancer EGR-1 EGFR-tyrosine kinase inhibitor
a b s t r a c t Objectives: We have previously reported that decreased expression of PTEN in lung cancer PC9 cells harboring an EGFR-activating mutation (del E746–A750) results in acquisition of resistance to EGFR-TKIs, gefitinib and erlotinib, accompanied by enhanced phosphorylation of Akt and decreased nuclear translocation of a transcription factor EGR-1 [8]. In the present study, PTEN promoter methylation accounted for the decreased expression of PTEN in our gefitinib-resistant mutant. Material and methods: DNA methylation status of the PTEN promoter in PC9 and gefitinib-resistant cells were examined using methylation-specific PCR. The effect of DNA methylation on PTEN expression was evaluated by treatment of lung cancer cell lines with 5-aza-2 -deoxycytidine (5AZA-CdR). Results: We observed the characteristics of two gefitinib-resistant sublines, GEF1-1 and GEF2-1, derived from PC9 as follows. (1) PTEN overexpression suppressed AKT phosphorylation and restored the sensitivity to gefitinib and erlotinib in GEF1-1 cells. (2) EGR-1 siRNA mediated knockdown suppressed the expression of cyclin D1 and ICAM-1 genes but not of PTEN gene in PC9 cells. (3) Transfection of EGR-1 cDNA into a drug-resistant subline induced the expression of cyclin D1 and ICAM-1 but not of PTEN. (4) Treatment with 5AZA-CdR induced the expression of PTEN in resistant sublines but not in the parental line PC9. (5) A CpG site near the translational start point of the 5 -regulatory region was methylated in GEF1-1 and GEF2-1 but not in PC9. Conclusion: Our results strongly suggest that CpG hypermethylation of the PTEN gene contributes to the decreased expression of PTEN during acquired resistance to gefitinib or erlotinib. © 2015 Elsevier Ireland Ltd. All rights reserved.
1. Introduction Lung cancer is the leading cause of cancer death worldwide. Representative inhibitors of EGFR-tyrosine kinase (EGFR-TKIs), gefitinib and erlotinib, have been approved as therapeutics for progressive non-small cell lung cancer (NSCLC) harboring activating mutation of EGFR, such as an in-frame deletion in exon 19 (del E746–A750) or a point mutation [1,2]. However, a serious problem that occurs during therapeutic treatment with EGFR-TKIs is the appearance of drug-resistant tumors. Secondary mutations of
∗ Corresponding author at: Department of Pharmaceutical Oncology, Graduate School of Pharmaceutical Science, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582, Japan. Tel.: +81 92 642 6296; fax: +81 92 642 6296. E-mail address: [email protected] (M. Ono). http://dx.doi.org/10.1016/j.lungcan.2015.01.009 0169-5002/© 2015 Elsevier Ireland Ltd. All rights reserved.
T790M in the EGFR gene and c-Met amplification are two wellknown mechanisms for acquired drug resistance to EGFR-TKIs in lung cancer [3–5]. Other mechanisms are expected to be involved in EGFR-TKI resistance. Elucidation of novel mechanisms is important to circumvent drug resistance and for developing personalized therapeutics to treat patients with NSCLC [6,7]. In our laboratory, we established EGFR-TKI-resistant sublines after stepwise exposure to increasing doses of drugs in culture using lung cancer cells harboring EGFR-activating mutations, which were highly sensitive to the therapeutic effects of EGFR-TKIs [8–10]. We previously demonstrated that the acquisition of EGFR-TKI resistance was mediated through the partial or complete loss of the mutant EGFR-activating gene copy [9], or through activating integrin 1/Src/Akt bypass signaling pathway [10] in lung cancer cells. Furthermore, we previously reported that gefitinib-resistant sublines from PC9 cells exhibited decreased PTEN expression
266
M. Maeda et al. / Lung Cancer 87 (2015) 265–271
Table 1 Primer sequences used for MSP analysis. Primer
Methylated PTEN (a) Unmethylated PTEN (a) Methylated PTEN (b) Unmethylated PTEN (b) Methylated PTEN (c) Unmethylated PTEN (c)
Primer Sequences (5 –3 ) Sense
Antisense
TTCGTTCGTCGTCGTCGTATTT GTGTGGTGGAGGTAGTTGTTT GGCGGCGGTCGCGGTTC GAGAGATGGTGGTGGTTGT GTTTGGGGATTTTTTTTTCGC TATTAGTTTGGGGATTTTTTTTTTGT
GCCGCTTAACTCTAAACCGCAACCG ACCACTTAACTCTAAACCACAACCA GACTCCCCGAAAACGCTAC AACTCCCCAAAAACACTACC AACCCTTCCTACGCCGCG CCCAACCCTTCCTACACCACA
accompanied by constitutive activation of PI3K/AKT pathway and also by reduced translocation of a transcription factor EGR-1 to the nucleus [8,11,12]. In our previous study, the low expression of PTEN in our established EGFR-TKI-resistant sublines was explained by the decreased nuclear translocation of EGR-1 [8]. EGR-1 is one of the key transcriptional factors involved in the expression of PTEN, cyclin D1, and ICAM-1 genes [13–15]. PTEN is a tumor suppressor gene that is inactivated in several types of human tumor. Mutation, homozygous deletion, promoter methylation and translational modification are reported to be the most common mechanisms of decreased expression of PTEN. In the present study, we examined whether the lower nuclear translocation of EGR-1 or alternative mechanisms such as promoter methylation may be specifically responsible for the decreased expression of PTEN in gefitinib-resistant sublines. 2. Materials and methods
37 ◦ C. Absorbance was measured at 450 nm with a 96-well plate reader. Triplicate wells were tested at each drug concentration. The IC50 value, defined as the concentration giving a 50% reduction in absorbance, was calculated from the survival curves. 2.4. Western blot analysis Cells were rinsed with ice-cold PBS and lysed in Triton X-100 buffer (50 mmol/L HEPES, 150 mmol/L NaCl, 50 mmol/L NaF, 1% Triton X-100, and 10% glycerol containing 5 mmol/L EDTA, 1 mmol/L phenylmethylsulfonyl fluoride, 10 g/mL aprotinin, 10 g/mL leupeptin, and 1 mmol/L sodium orthovanadate). Cell lysates were separated by SDS-PAGE and transferred to Immobilon membranes (Millipore Corp.) [8]. After transfer, membranes were incubated in blocking solution, probed with antibodies, washed, and visualized using horseradish peroxidase (HRP)–conjugated secondary antibodies (GE Healthcare) and enhanced chemiluminescence reagents (Amersham).
2.1. Cell culture and reagents PC9, its gefitinib-resistant sublines, (GEF1-1 and GEF2-1), and drug sensitive revertant subline (Rev1) were established as described previously [8]. They were cultured in RPMI 1640 supplemented with 10% fetal bovine serum in an atmosphere of 5% CO2 [8]. Gefitinib was provided by AstraZeneca, Inc. Anti-ERK1/2, antiphospho-ERK1/2 (pERK1/2), anti-AKT, anti-phospho-AKT (pAKT), anti-EGR-1 (15F7), anti-PTEN, anti-CREB, and anti-cyclin D1 antibodies were purchased from Cell Signaling Technology. Anti-EGR-1 (588), anti-HSP-90 and anti-ICAM-1 antibodies were from Santa Cruz Biotechnology and anti-HA antibody was from Roche. Anti-actin antibody was from Abcam. 5-aza 2 -deoxycitidine (5AZA-CdR) was from Sigma-Aldrich. E-cadherin antibody was from BD Biosciences. The small interfering RNAs (siRNA) corresponding to EGR-1 were purchased from Invitrogen. Cells were transfected with siRNA using Lipofectamine RNAiMAX and Opti-MEM (Invitrogen) according to the manufacturer’s recommendations. 2.2. Plasmid construction pcDNA3-EGR-1 vector was prepared as described previously [8]. pEB-HygA vector was obtained by digestion of pEB-Multi-Neo (Wako Pure Chemical Industries, Ltd.) and pcDNA3.1/Hygro (+) (Invitrogen) with BglII and Acc65I, and ligation. pEB-HygA-PTEN vector was constructed from pIRES-PTEN vector and pEB-HygA vector. 2.3. Cell proliferation assay Exponentially growing cell suspensions (1–8 × 103 cells) were seeded into 96-well microtiter plates. The following day, various concentrations of gefitinib were added. After incubation for 72 h at 37 ◦ C, 15–20 L of Cell Count Reagent SF (Nacalai Tesque) were added to each well and the plates were incubated for 1–3 h at
2.5. Quantitative real-time PCR Total RNA was isolated from cell culture using ISOGEN reagent (Nippon Gene Co. Ltd., Tokyo, Japan) according to the manufacture’s instructions, as described previously [16]. The thermal cycle conditions included maintaining the reactions at 48 ◦ C for 15 min and at 95 ◦ C for 10 min, and then alternating for 40 cycles between 95 ◦ C for 15 s and 60 ◦ C for 1 min. The relative gene expression for each sample was determined using the formula 2(–delta Ct) = 2(Ct(GAPDH)–Ct(target)) , which reflected the target gene expression normalized to GAPDH levels. 2.6. Bisulfite treatment Bisulfite modification of genomic DNA was performed using Methyl EasyTM Xceed Rapid DNA Bisulphite Modification Kit (TAKARA BIO, Inc.) according to the manufacture’s instructions. Briefly, DNA (5 g) in a volume of 22 L was denatured by NaOH (final concentration 0.3 mM) for 15 min at 37 ◦ C. The samples were then treated with 240 L sodium bisulfite solution and were incubated at 80 ◦ C for 45 min. Bisulfite-modified DNA was purified followed by its protocol, and samples were heated at 95 ◦ C for 20 min. 2.7. Methylation-specific PCR (MSP) To examine whether the PTEN promoter is methylated in PC9, PC9/GEF and PC9/Rev1 cells, we used methylation-specific primers that had previously been used to demonstrate methylation of the PTEN promoter [17–19]. The methylation-specific primers were listed in Table 1. MSP reactions were performed using an EpiscopeTM MSP Kit (TAKARA BIO, Inc.). PCR products were analyzed on 3% agarose gels and stained with ethidium bromide.
M. Maeda et al. / Lung Cancer 87 (2015) 265–271 Table 2 IC50 values of gefitinib in PC9, GEF1-1, GEF2-1 and Rev1 cells. Cell lines
IC50 (mol/L)
PC9 GEF1-1 GEF2-1 Rev1
0.032 (1.0) 13.5 (421) 16.0 (500) 0.72 (22.5)
The relative resistance, defined as the IC50 value divided by the IC50 value of the parental PC9 cells, is shown in parentheses.
3. Results 3.1. PTEN overexpression suppresses AKT phosphorylation and overcomes gefitinib-resistance in lung cancer cells We have previously established gefitinib-resistant sublines, GEF1-1 and GEF2-1, from PC9, and the drug-sensitive revertant Rev1 from GEF1-1 cells after culture for 7 months in the absence of the drug [8]. Consistent with our previous results [8], GEF1-1 and GEF2-1 cells showed 400–500-fold resistance to gefitinib than PC9 cells. By contrast, the sensitivity to gefitinib in Rev1 was partially restored compared with gefitinib-resistant cells, GEF1-1 and GEF2-1 (Fig. 1A and Table 2). Furthermore, both GEF1-1 and GEF21 cells exhibited markedly decreased expression of PTEN protein with activated AKT compared with PC9 or Rev1 cells (Fig. 1B). To confirm whether PTEN expression was coupled with AKT phosphorylation in a drug-resistant subline, we transiently expressed
267
PTEN by transfecting GEF1-1 cells with pIRES-PTEN. As shown in Fig. 1C, PTEN overexpression suppressed AKT phosphorylation in GEF1-1 cells at 24 h after PTEN cDNA transfection (Fig. 1C). We constructed a PTEN expression vector (pEB–HygA–PTEN), which had an episomal replication system, to express the PTEN gene in a stable manner. Transfection of this PTEN expression vector resulted in the stable expression of PTEN in GEF1-1, which was accompanied by p-AKT suppression (Fig. 1D). PTEN overexpression in GEF1-1 restored 10-fold sensitivity to both gefitinib and erlotinib (Fig. 1E and F). The phosphorylation of EGFR and ERK was suppressed by gefitinib, whereas phosphorylation of AKT was not suppressed in GEF1-1/mock. In contrast, phosphorylation of AKT was reduced by gefitinib in GEF1-1/PTEN (Fig. 1G). 3.2. EGR-1 knockdown or overexpression alters expression of cyclin D1 and ICAM-1 but not of PTEN PTEN expression is known to be enhanced by the transcription factor EGR-1 in various cancer cell lines [13]. Our previous study demonstrated that the nuclear expression of EGR-1 was decreased in GEF1-1 and GEF2-1 cells, suggesting that the decreased expression of PTEN is contributed to the defective nuclear translocation of EGR-1 [8]. We further confirmed whether the decreased expression of PTEN in these drug-resistant sublines was mediated through lower nuclear translocation of EGR-1. We first compared the expression levels of EGR-1 in the nuclear and cytoplasmic fractions from PC9 and its resistant sublines by western blot
Fig. 1. Effects of PTEN overexpression on AKT phosphorylation and the sensitivity to gefitinib and erlotinib in PC9 and gefitinib-resistant cells. (A) The sensitivity to gefitinib of PC9, GEF1-1, GEF2-1, and Rev1 is assessed by cell proliferation assays. Each value is average of triplicate samples ±SD. (B) Expression of PTEN, AKT, p-AKT, ERK, p-ERK, and -actin according to western blot analysis. (C) Comparison of the expression levels of PTEN, AKT, p-AKT, ERK, p-ERK, and -actin after transient transfection with a PTEN expression vector for 24 h, according to western blot analyses. (D) Comparison of the expression levels of PTEN, AKT, p-AKT, ERK, p-ERK, and -actin in PTEN stably transfected cells, according to western blot analyses. The stably transfected cells were selected with hygromycin for 1 week after transfection and lysed. (E and F) The sensitivity to gefitinib (E) and erlotinib (F) of GEF1-1/mock and GEF1-1/PTEN. Each value is average of triplicate samples ±SD. (G) Effects of gefitinib on the expression levels of p-EGFR, p-AKT, and p-ERK in PTEN stably transfected cells, according to western blot analysis. GEF 1-1/mock and GEF 1-1/PTEN cells were treated with or without gefitinib for 5 h.
268
M. Maeda et al. / Lung Cancer 87 (2015) 265–271
Fig. 2. Effects of EGR-1 on PTEN, cyclinD1 and ICAM-1 in PC9 and GEF1-1. (A) Western blot analysis showing the expression levels of EGR-1 in the nuclear and cytosol fractions of resistant cell lines. CREB and HSP-90 were used as loading controls for the nuclear and cytosol fractions, respectively. (B) Western blot analysis showing the expression levels of EGR-1 and PTEN when EGR-1 is silenced by three EGR-1 siRNAs (#1–#3). Two different anti-EGR-1 antibodies, 15F7 and 588, were used to detect the band corresponding to EGR-1. (C) Comparison of the expression levels of PTEN, cyclin D1, and ICAM-1 after transient treatment with EGR-1 siRNA in PC9 cells. (D) Comparison of the expression levels of PTEN, cyclin D1, and ICAM-1 after transient treatment with EGR-1 expression vector. (E) Expression of PTEN, cyclin D1, and ICAM-1 mRNA in PC9 and GEF1-1 cells transfected with or without EGR-1 expression vector.
analysis (Fig. 2A). GEF1-1 and GEF2-1 showed decreased expression levels of EGR-1 in the nuclear fraction compared with PC9. Direct DNA sequence analysis revealed that there were no mutations in the EGR-1 gene or in the PTEN promoter up to 1000 bases (data not shown), suggesting that the altered expression levels of PTEN and nuclear EGR-1 are not due to mutation in PTEN promoter and EGR-1 gene. Subsequently, we examined whether EGR-1 knockdown induced the suppressed expression of PTEN in the parental PC9 cells. Our previous study showed that treatment with 100 nM EGR1 siRNA partially reduced EGR-1 expression, together with slightly decreased expression of PTEN [8]. We further confirmed the effect of EGR-1 knockdown on PTEN expression by western blotting with three EGR-1 siRNAs (siEGR-1#1, #2 and #3). In our previous study [8], EGR-1 knockdown was induced only by EGR-1 siRNA#3, and the band corresponding to EGR-1 was detected only by using anti-EGR-1 antibody (588). In this study, Treatment of PC9 cells with 100 nM of siEGR-1#3 resulted in only a slight reduction of EGR-1 expression detected by anti-EGR-1 antibody (588) (Fig. 2B), consistent with our previous study [8]. In contrast, treatment with all these three EGR-1 siRNAs at 5 nM markedly silenced EGR-1 expression when EGR-1 band was recognized by another antiEGR-1 antibody (15F7) (Fig. 2B). Together, the antibody against EGR-1 (15F7) which we used in this study specifically recognize EGR-1 protein than anti-EGR-1 (588) which we used previously. Therefore, we used the anti-EGR-1 antibody (15F7) in the present study. As EGR-1 is a key transcriptional factor of not only PTEN, but also cyclin D1 and ICAM-1 [13–15], we also investigated the effect of EGR-1 knockdown on the expression of PTEN, cyclin D1 and ICAM-1. EGR-1 knockdown with 5 nM EGR-1 siRNA#1 suppressed expression of cyclin D1 and ICAM-1, but not at all PTEN expression
in PC9 cells (Fig. 2C). We also examined whether EGR-1 overexpression could increase PTEN expression in drug-resistant sublines by transfecting with EGR-1 cDNA. Transfection with EGR-1 cDNA increased the expression of EGR-1 (Fig. 2D). There were marked increases in the expression levels of EGR-1 in both the cytoplasm and nucleus of PC9 and GEF1-1 cells after transfection with EGR-1 cDNA (data not shown). In GEF1-1 cells, EGR-1 overexpression resulted in higher expression of cyclin D1 and ICAM-1 but not of PTEN (Fig. 2D). The cellular mRNA levels of both cyclin D1 and ICAM-1 also increased by approximately 3–5-fold in GEF1-1 cells with EGR-1 overexpression (Fig. 2E). In contrast, there was no enhancement in PTEN mRNA expression with EGR-1 overexpression in the resistant subline (Fig. 2E). The expression levels of PTEN, cyclin D1, and ICAM-1 were all downregulated in the gefitinibresistant subline compared with PC9 (Fig. 2D and E). Therefore EGR-1 is not responsible for PTEN expression in GEF1-1 cells. 3.3. Altered CpG methylation status in the promoter region of the PTEN gene in gefitinib-resistant cells Expression of PTEN gene is also controlled through CpG methylation/demethylation at its promoter region [17–19]. Then, we compared the DNA methylation status of the PTEN promoter region in PC9 and resistant cells. The time kinetics for 5 M 5AZA-CdR treatment showed that there was an approximately 3-fold higher expression level of PTEN mRNA when GEF1-1 and GEF2-1 cells were treated for 48 h and 72 h but not when PC9 cells were treated (Fig. 3A). Treatment with 5AZA-CdR at 5 M for 72 h significantly induced the expression of PTEN mRNA in GEF1-1 and GEF2-1 cells but there were no changes in PC9 and Rev1 (Fig. 3B). Western blot analysis also detected the increased expression of PTEN
M. Maeda et al. / Lung Cancer 87 (2015) 265–271
269
Fig. 3. Effects of 5AZA-CdR on PTEN expression. (A) Time course of the induction of PTEN mRNA expression by 5AZA-CdR in PC9, GEF1-1 and GEF2-1. Lysates prepared from PC9 and gefitinib-resistant cell lines were treated with or without 5 M 5AZA-CdR. Columns, mean of three independent experiments; bars, standard deviation (SD); *, p < 0.05, versus without 5AZA-CdR (B) Concentration-dependent effect of 5AZA-CdR on PTEN mRNA expression in PC9, GEF1-1, GEF2-1 and Rev1. The lysates were prepared from PC9, GEF1-1, GEF2-1 and Rev1, which were treated with or without 5AZA-CdR for 72 h. Columns, mean of three independent experiments; bars, SD; *, p < 0.05, versus without 5AZA-CdR. (C) Comparison of the expression levels of E-cadherin and PTEN after treatment with 5AZA-CdR. Lysates prepared from PC9, GEF1-1 and GEF2-1 were treated with or without 5AZA-CdR for 72 h. The PTEN bands of gefitinib-resistant sublines (*) are shown after long-term exposure.
protein in GEF1-1 and GEF2-1 cells in a dose-dependent manner but not in PC9 cells, after treatment with 5AZA-CdR (Fig. 3C). As E-cadherin expression is regulated epigenetically via methylation of the promoter [20], we investigated the effect of demethylation by 5-AZA-CdR on E-cadherin expression in PC9, GEF1-1 and GEF21. Increased expression of E-cadherin was observed in PC9, GEF1-1 and GEF2-1 in a dose-dependent manner (Fig. 3C). These results suggest that PTEN is regulated by methylation of its promoter region in gefitinib-resistant cell lines, but not in their parental counterpart PC9 cells. 3.4. CpG methylation status of PTEN promoter region by MSP analysis To determine the CpG methylation status of the PTEN promoter region in PC9, GEF1-1, GEF2-1 and Rev1, we used a Methyl EasyTM Xceed Rapid DNA Bisulphite Modification Kit for bisulfite treatment. In this assay, the hypermethylation status was monitored based on the presence or absence of the amplified band using methylation-specific primers for PTEN (Table 1). We used three CpG sites on the PTEN promoter, i.e., sequences (a), (b), and (c), which are known to be essential for PTEN gene expression [17–19,21] (Fig. 4A). Sequence (a) was specifically methylated in GEF1-1 and GEF-2-1. In contrast, the methylation level of sequence (a) was much lower in
both PC9 and Rev1 than gefitinib-resistant sublines (Fig. 4B). There was no apparent methylation at sequences (b) and (c) in all four cell lines. The methylated band of sequence (a) was attenuated in GEF1-1 and GEF2-1 cells after 5AZA-CdR treatment (Fig. 4C). 4. Discussion In our previous study [8], gefitinib-resistant sublines derived from PC9 harboring EGFR-activating mutations exhibited marked decreased expression levels of PTEN, which was accompanied by the loss of nuclear EGR-1 translocation. Also cyclin D1 and ICAM1 gene expression were simultaneously downregulated in these resistant cells. Furthermore, we previously demonstrated that the expression of PTEN, cyclin D1, and ICAM-1 were all recovered in the drug-sensitive revertant Rev1, where the levels were similar to those in PC9. EGR-1 is known to be a transcription factor of PTEN [13,22,23] as well as cyclin D1 and ICAM-1 genes [13–15]. In our previous study, we concluded that the decreased expression of PTEN may be attributable to the low nuclear translocation of EGR-1 [8]. In the present study, we first characterized more in detail whether the decreased expression of PTEN occurred in association with the decreased nuclear translocation of EGR-1 in gefitinib-resistant cells. The results obtained indicated the following novel findings. (1) PTEN overexpression suppressed AKT
270
M. Maeda et al. / Lung Cancer 87 (2015) 265–271
Fig. 4. DNA methylation status of the PTEN promoter in PC9, GEF1-1, GEF2-1, and Rev1. (A) Schematic representation of the potential CpG sites and PCR amplification regions used for methylation-specific PCR (MSP) analysis in the PTEN promoter. (a)–(c) represent the regions amplified using PTEN primers. (B) Amplification of bisulfite-treated DNA in PC9, GEF1-1, GEF2-1 and Rev1. The MSP assay used primer sets that specifically amplified unmethylated (U) or methylated (M) alleles. M*: the DNA was treated with methylase for 4 h and amplified by PCR using primers to detect methylated DNA. (C) Effect of 5AZA-CdR on the methylation status of the PTEN promoter. Cells were treated with or without 5AZA-CdR (5 M) for 72 h. (D) Our hypothetic model how PTEN expression was downregulated in our gefitinib-resistant cells. In gefitinib-resistant cell lines, PTEN expression was downregulated due to CpG hypermethylation in the PTEN promoter resulting in constitutive activation of PI3K/AKT pathway. Impaired EGR-1 translocation into the nucleus was not responsible to PTEN expression.
phosphorylation and restored the drug sensitivity to gefitinib and erlotinib in GEF1-1 cells. (2) EGR-1 knockdown by siRNA did not suppress PTEN expression, but it suppressed the expression of cyclin D1 and ICAM-1 in the parental PC9 cells. (3) Overexpression of EGR-1 also restored both the protein and mRNA expression levels of cyclin D1 and ICAM-1 but not of PTEN in GEF1-1. In the previous study [8], even treatment with 100 nM EGR-1 siRNA only slightly reduced EGR-1 expression detected by anti-EGR-1 (588) antibody, together with slightly reduced expression of PTEN [8], and we hypothesized that lower nuclear translocation of EGR-1 was a cause for the decreased expression of PTEN in gefitinib-resistant cells. However, our present study apparently demonstrated that treatment with all three EGR-1 siRNAs at 5 nM markedly reduced expression of the band detected by anti-EGR-1 (15F7) antibody, but not by anti-EGR-1 (588) antibody. The antibody against EGR-1 (588) that was used in our previous study [8] was low selectivity to recognize EGR-1. Our present study strongly demonstrated that the decreased expression of PTEN induced during the selection of drug-resistant cells was not attributed to reduced EGR-1 expression and translocation to the nucleus, and also suggested that the reduced expression levels of cyclin D1 and ICAM-1 were due to the decreased nuclear expression of EGR-1 (Fig. 2C–E). Furthermore promoter methylation is one of the mechanisms of altered expression levels of PTEN. DNA methylation is associated with transcriptional silencing of many genes in normal and malignant cells [24–26], indicating that DNA methylation is a key regulator of gene expression. The degree of methylation at CpG sites on 5 -regulatory regions plays crucial roles in the transcriptional activation of various genes in human cancers [27,28]. PTEN gene expression is also known to be under the control of CpG site methylation at its promoter region [17–19,21]. In the present study, we
showed that (1) Treatment with 5AZA-CdR restored PTEN mRNA expression in gefitinib-resistant cell lines but not in PC9 and Rev1 (Fig. 3A and B), while PTEN protein expression was also restored by 5AZA-CdR (Fig. 3C). (2) The region located 329 to 124 nucleotide upstream from the translation initiation site of the PTEN promoter region was specifically hypermethylated in resistant cell lines but not in PC9 and Rev1 according to the MSP analysis (Fig. 4B). Overall, our results strongly suggest that a CpG site in the PTEN gene promoter is hypermethylated in gefitinib-resistant cells, which downregulates PTEN gene expression in resistant cells (Fig. 4D). 5. Conclusion As an underlying mechanism of the decreased expression of PTEN in our gefitinib-resistant lung cancer cells, we presented that the decreased PTEN expression induced during the acquisition of gefitinib-resistance was explained by hypermethylation of a CpG site in the PTEN gene promoter. On the other hand, we consistently observed lower EGR-1 translocation into the nucleus in gefitinib-resistant sublines and the decreased nuclear translocation of EGR-1 affected only expression of targeted gene such as cyclin D1 and ICAM-1. Decreased PTEN expression through altered methylation status thus mediates acquirement of gefitinib-resistance, and drug resistance to gefitinib and erlotinib could be overcome by combination treatment with epigenetic modulators and EGFR-TKIs. Conflict of interest statement None declared.
M. Maeda et al. / Lung Cancer 87 (2015) 265–271
Acknowledgments This work was supported by the 3rd Term Comprehensive Control Research for Cancer from the Ministry of Health, Labor, and Welfare in Japan and also by a Grant-in-Aid for challenging Exploratory Research from the Japan Society for the Promotion of Science (JSPS) (M.K.) and supported by Life Science Foundation (M.O). References [1] Fukuoka M, Yano S, Giaccone G, Tamura T, Nakagawa K, Douillard JY, et al. Multi-institutional randomized phase II trial of gefitinib for previously treated patients with advanced non-small-cell lung cancer. J Clin Oncol 2003;21:2237–46. [2] Tsao MS, Sakurada A, Lorimer I, Cutz JC, Kamel-Reid S, Squire J, et al. Molecular analysis of the epidermal growth factor receptor (EGFR) gene and protein expression in patients treated with erlotinib in National Cancer Institute of Canada Clinical Trials Group (NCIC CTG) trial BR.21. J Clin Oncol 2005;23:7007. [3] Kobayashi S, Boggon TJ, Dayaram T, Jänne PA, Kocher O, Meyerson M, et al. EGFR mutation and resistance of non-small-cell lung cancer to gefitinib. N Engl J Med 2005;352:786–92. [4] Pao W, Miller VA, Politi KA, Riely GJ, Somwar R, Zakowski MF, et al. Acquired resistance of lung adenocarcinomas to gefitinib or erlotinib is associated with a second mutation in the EGFR kinase domain. PLoS Med 2005;2: e73. [5] Engelman JA, Zejnullahu K, Mitsudomi T, Song Y, Hyland C, Park JO, et al. MET amplification leads to gefitinib resistance in lung cancer by activating ERBB3 signaling. Science 2007;316:1039–43. [6] Ellis LM, Hicklin DJ. Resistance to targeted therapies: refining anticancer therapy in the era of molecular oncology. Clin Cancer Res 2009;15:7471–8. [7] Garraway LA, Jänne PA. Circumventing cancer drug resistance in the era of personalized medicine. Cancer Discov 2012;2:214–26. [8] Yamamoto C, Basaki Y, Kawahara A, Nakashima K, Kage M, Izumi H, et al. Loss of PTEN expression by blocking nuclear translocation of EGR1 in gefitinib-resistant lung cancer cells harboring epidermal growth factor receptor-activating mutations. Cancer Res 2010;70:8715–25. [9] Tabara K, Kanda R, Sonoda K, Kubo T, Murakami Y, Kawahara A, et al. Loss of activating EGFR mutant gene contributes to acquired resistance to EGFR tyrosine kinase inhibitors in lung cancer cells. PLoS One 2012;7:e41017. [10] Kanda R, Kawahara A, Watari K, Murakami Y, Sonoda K, Maeda M, et al. Erlotinib resistance in lung cancer cells mediated by integrin 1/Src/Akt-driven bypass signaling. Cancer Res 2013;73:6243–53. [11] Garofalo M, Romano G, Di Leva G, Nuovo G, Jeon YJ, Ngankeu A, et al. EGFR and MET receptor tyrosine kinase- altered microRNA expression induces tumorigenesis and gefitinib resistance in lung cancers. Nat Med 2011;18:74–82.
271
[12] Okamoto K, Okamoto I, Hatashita E, Kuwata K, Yamaguchi H, Kita A, et al. Overcoming erlotinib resistance in EGFR mutation-positive non-small cell lung cancer cells by targeting survivin. Mol Cancer Ther 2012;11:204–13. [13] Virolle T, Adamson ED, Baron V, Birle D, Mercola D, Mustelin T, et al. The Egr-1 transcription factor directly activates PTEN during irradiation-induced signaling. Nat Cell Biol 2001;3:1124–8. [14] La P, Fernando AP, Wang Z, Salahudeen A, Yang G, Lin Q, et al. Zinc protoporphyrin regulates cyclin D1 expression independent of heme oxygenase inhibition. J Biol Chem 2009;284:36302–11. [15] Maltzman JS, Carmen JA, Monroe JG. Transcriptional regulation of the Icam-1 gene in antigen receptor- and phorbol ester-stimulated B lymphocytes: role for transcription factor EGR1. J Exp Med 1996;183:1747–59. [16] Sakuma Y, Maruyama K, Osakabe Y, Qin F, Seki M, Shinozaki K, et al. Functional analysis of an Arabidopsis transcription factor, DREB2A, involved in droughtresponsive gene expression. Plant Cell 2006;18:1292–309. [17] Salvesen HB, MacDonald N, Ryan A, Jacobs IJ, Lynch ED, Akslen LA, et al. PTEN methylation is associated with advanced stage and microsatellite instability in endometrial carcinoma. Int J Cancer 2001;91:22–6. ˜ C, Garcia V, Rodríguez R, Cruz MA, et al. Promoter meth[18] García JM, Silva J, Pena ylation of the PTEN gene is a common molecular change in breast cancer. Genes Chromosomes Cancer 2004;41:117–24. [19] Soria JC, Lee HY, Lee JI, Wang L, Issa JP, Kemp BL, et al. Lack of PTEN expression in non-small cell lung cancer could be related to promoter methylation. Clin Cancer Res 2002;8:1178–84. [20] Graff JR, Herman JG, Myöhänen S, Baylin SB, Vertino PM. Mapping patterns of CpG island methylation in normal and neoplastic cells implicates both upstream and downstream regions in de novo methylation. J Biol Chem 1997;272:22322–9. [21] Wiencke JK, Zheng S, Jelluma N, Tihan T, Vandenberg S, Tamgüney T, et al. Methylation of the PTEN promoter defines low-grade gliomas and secondary glioblastoma. Neuro Oncol 2007;9:271–9. [22] Okamura H, Yoshida K, Morimoto H, Haneji TPTEN. expression elicited by EGR1 transcription factor in calyculin A-induced apoptotic cells. J Cell Biochem 2005;94:117–25. [23] Fantini D, Vascotto C, Deganuto M, Bivi N, Gustincich S, Marcon G, et al. APE1/Ref-1 regulates PTEN expression mediated by Egr-1. Free Radic Res 2008;42:20–9. [24] Antequera F, Boyes J, Bird A. High levels of De Novo methylation and altered chromatin structure at CpG islands in cell lines. Cell 1990;62:503–14. [25] Boyes J, Bird A. DNA methylation inhibits transcription indirectly via a methylCpG binding protein. Cell 1991;64:1123–34. [26] Laird PW, Jaenisch R. DNA Methylation and Cancer Hum Mol Genet 1994;3:1487–95. [27] Nakayama M, Wada M, Harada T, Nagayama J, Kusaba H, Ohshima K, et al. Hypomethylation status of CpG sites at the promoter region and overexpression of the human MDR1 gene in acute myeloid leukemias. Blood 1998;92:4296–307. [28] Toyota M, Ahuja N, Suzuki H, Itoh F, Ohe-Toyota M, Imai K, et al. Aberrant methylation in gastric cancer associated with the CpG island methylator phenotype. Cancer Res 1999;59:5438–42.
Contents lists available at ScienceDirect
Lung Cancer journal homepage: www.elsevier.com/locate/lungcan
CpG hypermethylation contributes to decreased expression of PTEN during acquired resistance to gefitinib in human lung cancer cell lines Masashi Maeda a , Yuichi Murakami a,b , Kosuke Watari a , Michihiko Kuwano c , Hiroto Izumi d , Mayumi Ono a,∗ a
Department of Pharmaceutical Oncology, Graduate School of Pharmaceutical Sciences, Kyushu University, Fukuoka 812-8582, Japan St Mary’s Institute of Health Sciences, St Mary’s Hospital, Kurume 830-8543, Japan c Laboratory of Molecular Cancer Biology, Graduate School of Pharmaceutical Sciences, Kyushu University, Fukuoka 812-8582, Japan d Department of Occupational Pneumology, Institute of Industrial Ecological Sciences, University of Occupational and Environmental Health, Kitakyushu 807-8555, Japan b
a r t i c l e
i n f o
Article history: Received 14 August 2014 Received in revised form 29 December 2014 Accepted 13 January 2015 Keywords: Gefitinib-resistance PTEN DNA methylation Lung cancer EGR-1 EGFR-tyrosine kinase inhibitor
a b s t r a c t Objectives: We have previously reported that decreased expression of PTEN in lung cancer PC9 cells harboring an EGFR-activating mutation (del E746–A750) results in acquisition of resistance to EGFR-TKIs, gefitinib and erlotinib, accompanied by enhanced phosphorylation of Akt and decreased nuclear translocation of a transcription factor EGR-1 [8]. In the present study, PTEN promoter methylation accounted for the decreased expression of PTEN in our gefitinib-resistant mutant. Material and methods: DNA methylation status of the PTEN promoter in PC9 and gefitinib-resistant cells were examined using methylation-specific PCR. The effect of DNA methylation on PTEN expression was evaluated by treatment of lung cancer cell lines with 5-aza-2 -deoxycytidine (5AZA-CdR). Results: We observed the characteristics of two gefitinib-resistant sublines, GEF1-1 and GEF2-1, derived from PC9 as follows. (1) PTEN overexpression suppressed AKT phosphorylation and restored the sensitivity to gefitinib and erlotinib in GEF1-1 cells. (2) EGR-1 siRNA mediated knockdown suppressed the expression of cyclin D1 and ICAM-1 genes but not of PTEN gene in PC9 cells. (3) Transfection of EGR-1 cDNA into a drug-resistant subline induced the expression of cyclin D1 and ICAM-1 but not of PTEN. (4) Treatment with 5AZA-CdR induced the expression of PTEN in resistant sublines but not in the parental line PC9. (5) A CpG site near the translational start point of the 5 -regulatory region was methylated in GEF1-1 and GEF2-1 but not in PC9. Conclusion: Our results strongly suggest that CpG hypermethylation of the PTEN gene contributes to the decreased expression of PTEN during acquired resistance to gefitinib or erlotinib. © 2015 Elsevier Ireland Ltd. All rights reserved.
1. Introduction Lung cancer is the leading cause of cancer death worldwide. Representative inhibitors of EGFR-tyrosine kinase (EGFR-TKIs), gefitinib and erlotinib, have been approved as therapeutics for progressive non-small cell lung cancer (NSCLC) harboring activating mutation of EGFR, such as an in-frame deletion in exon 19 (del E746–A750) or a point mutation [1,2]. However, a serious problem that occurs during therapeutic treatment with EGFR-TKIs is the appearance of drug-resistant tumors. Secondary mutations of
∗ Corresponding author at: Department of Pharmaceutical Oncology, Graduate School of Pharmaceutical Science, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582, Japan. Tel.: +81 92 642 6296; fax: +81 92 642 6296. E-mail address: [email protected] (M. Ono). http://dx.doi.org/10.1016/j.lungcan.2015.01.009 0169-5002/© 2015 Elsevier Ireland Ltd. All rights reserved.
T790M in the EGFR gene and c-Met amplification are two wellknown mechanisms for acquired drug resistance to EGFR-TKIs in lung cancer [3–5]. Other mechanisms are expected to be involved in EGFR-TKI resistance. Elucidation of novel mechanisms is important to circumvent drug resistance and for developing personalized therapeutics to treat patients with NSCLC [6,7]. In our laboratory, we established EGFR-TKI-resistant sublines after stepwise exposure to increasing doses of drugs in culture using lung cancer cells harboring EGFR-activating mutations, which were highly sensitive to the therapeutic effects of EGFR-TKIs [8–10]. We previously demonstrated that the acquisition of EGFR-TKI resistance was mediated through the partial or complete loss of the mutant EGFR-activating gene copy [9], or through activating integrin 1/Src/Akt bypass signaling pathway [10] in lung cancer cells. Furthermore, we previously reported that gefitinib-resistant sublines from PC9 cells exhibited decreased PTEN expression
266
M. Maeda et al. / Lung Cancer 87 (2015) 265–271
Table 1 Primer sequences used for MSP analysis. Primer
Methylated PTEN (a) Unmethylated PTEN (a) Methylated PTEN (b) Unmethylated PTEN (b) Methylated PTEN (c) Unmethylated PTEN (c)
Primer Sequences (5 –3 ) Sense
Antisense
TTCGTTCGTCGTCGTCGTATTT GTGTGGTGGAGGTAGTTGTTT GGCGGCGGTCGCGGTTC GAGAGATGGTGGTGGTTGT GTTTGGGGATTTTTTTTTCGC TATTAGTTTGGGGATTTTTTTTTTGT
GCCGCTTAACTCTAAACCGCAACCG ACCACTTAACTCTAAACCACAACCA GACTCCCCGAAAACGCTAC AACTCCCCAAAAACACTACC AACCCTTCCTACGCCGCG CCCAACCCTTCCTACACCACA
accompanied by constitutive activation of PI3K/AKT pathway and also by reduced translocation of a transcription factor EGR-1 to the nucleus [8,11,12]. In our previous study, the low expression of PTEN in our established EGFR-TKI-resistant sublines was explained by the decreased nuclear translocation of EGR-1 [8]. EGR-1 is one of the key transcriptional factors involved in the expression of PTEN, cyclin D1, and ICAM-1 genes [13–15]. PTEN is a tumor suppressor gene that is inactivated in several types of human tumor. Mutation, homozygous deletion, promoter methylation and translational modification are reported to be the most common mechanisms of decreased expression of PTEN. In the present study, we examined whether the lower nuclear translocation of EGR-1 or alternative mechanisms such as promoter methylation may be specifically responsible for the decreased expression of PTEN in gefitinib-resistant sublines. 2. Materials and methods
37 ◦ C. Absorbance was measured at 450 nm with a 96-well plate reader. Triplicate wells were tested at each drug concentration. The IC50 value, defined as the concentration giving a 50% reduction in absorbance, was calculated from the survival curves. 2.4. Western blot analysis Cells were rinsed with ice-cold PBS and lysed in Triton X-100 buffer (50 mmol/L HEPES, 150 mmol/L NaCl, 50 mmol/L NaF, 1% Triton X-100, and 10% glycerol containing 5 mmol/L EDTA, 1 mmol/L phenylmethylsulfonyl fluoride, 10 g/mL aprotinin, 10 g/mL leupeptin, and 1 mmol/L sodium orthovanadate). Cell lysates were separated by SDS-PAGE and transferred to Immobilon membranes (Millipore Corp.) [8]. After transfer, membranes were incubated in blocking solution, probed with antibodies, washed, and visualized using horseradish peroxidase (HRP)–conjugated secondary antibodies (GE Healthcare) and enhanced chemiluminescence reagents (Amersham).
2.1. Cell culture and reagents PC9, its gefitinib-resistant sublines, (GEF1-1 and GEF2-1), and drug sensitive revertant subline (Rev1) were established as described previously [8]. They were cultured in RPMI 1640 supplemented with 10% fetal bovine serum in an atmosphere of 5% CO2 [8]. Gefitinib was provided by AstraZeneca, Inc. Anti-ERK1/2, antiphospho-ERK1/2 (pERK1/2), anti-AKT, anti-phospho-AKT (pAKT), anti-EGR-1 (15F7), anti-PTEN, anti-CREB, and anti-cyclin D1 antibodies were purchased from Cell Signaling Technology. Anti-EGR-1 (588), anti-HSP-90 and anti-ICAM-1 antibodies were from Santa Cruz Biotechnology and anti-HA antibody was from Roche. Anti-actin antibody was from Abcam. 5-aza 2 -deoxycitidine (5AZA-CdR) was from Sigma-Aldrich. E-cadherin antibody was from BD Biosciences. The small interfering RNAs (siRNA) corresponding to EGR-1 were purchased from Invitrogen. Cells were transfected with siRNA using Lipofectamine RNAiMAX and Opti-MEM (Invitrogen) according to the manufacturer’s recommendations. 2.2. Plasmid construction pcDNA3-EGR-1 vector was prepared as described previously [8]. pEB-HygA vector was obtained by digestion of pEB-Multi-Neo (Wako Pure Chemical Industries, Ltd.) and pcDNA3.1/Hygro (+) (Invitrogen) with BglII and Acc65I, and ligation. pEB-HygA-PTEN vector was constructed from pIRES-PTEN vector and pEB-HygA vector. 2.3. Cell proliferation assay Exponentially growing cell suspensions (1–8 × 103 cells) were seeded into 96-well microtiter plates. The following day, various concentrations of gefitinib were added. After incubation for 72 h at 37 ◦ C, 15–20 L of Cell Count Reagent SF (Nacalai Tesque) were added to each well and the plates were incubated for 1–3 h at
2.5. Quantitative real-time PCR Total RNA was isolated from cell culture using ISOGEN reagent (Nippon Gene Co. Ltd., Tokyo, Japan) according to the manufacture’s instructions, as described previously [16]. The thermal cycle conditions included maintaining the reactions at 48 ◦ C for 15 min and at 95 ◦ C for 10 min, and then alternating for 40 cycles between 95 ◦ C for 15 s and 60 ◦ C for 1 min. The relative gene expression for each sample was determined using the formula 2(–delta Ct) = 2(Ct(GAPDH)–Ct(target)) , which reflected the target gene expression normalized to GAPDH levels. 2.6. Bisulfite treatment Bisulfite modification of genomic DNA was performed using Methyl EasyTM Xceed Rapid DNA Bisulphite Modification Kit (TAKARA BIO, Inc.) according to the manufacture’s instructions. Briefly, DNA (5 g) in a volume of 22 L was denatured by NaOH (final concentration 0.3 mM) for 15 min at 37 ◦ C. The samples were then treated with 240 L sodium bisulfite solution and were incubated at 80 ◦ C for 45 min. Bisulfite-modified DNA was purified followed by its protocol, and samples were heated at 95 ◦ C for 20 min. 2.7. Methylation-specific PCR (MSP) To examine whether the PTEN promoter is methylated in PC9, PC9/GEF and PC9/Rev1 cells, we used methylation-specific primers that had previously been used to demonstrate methylation of the PTEN promoter [17–19]. The methylation-specific primers were listed in Table 1. MSP reactions were performed using an EpiscopeTM MSP Kit (TAKARA BIO, Inc.). PCR products were analyzed on 3% agarose gels and stained with ethidium bromide.
M. Maeda et al. / Lung Cancer 87 (2015) 265–271 Table 2 IC50 values of gefitinib in PC9, GEF1-1, GEF2-1 and Rev1 cells. Cell lines
IC50 (mol/L)
PC9 GEF1-1 GEF2-1 Rev1
0.032 (1.0) 13.5 (421) 16.0 (500) 0.72 (22.5)
The relative resistance, defined as the IC50 value divided by the IC50 value of the parental PC9 cells, is shown in parentheses.
3. Results 3.1. PTEN overexpression suppresses AKT phosphorylation and overcomes gefitinib-resistance in lung cancer cells We have previously established gefitinib-resistant sublines, GEF1-1 and GEF2-1, from PC9, and the drug-sensitive revertant Rev1 from GEF1-1 cells after culture for 7 months in the absence of the drug [8]. Consistent with our previous results [8], GEF1-1 and GEF2-1 cells showed 400–500-fold resistance to gefitinib than PC9 cells. By contrast, the sensitivity to gefitinib in Rev1 was partially restored compared with gefitinib-resistant cells, GEF1-1 and GEF2-1 (Fig. 1A and Table 2). Furthermore, both GEF1-1 and GEF21 cells exhibited markedly decreased expression of PTEN protein with activated AKT compared with PC9 or Rev1 cells (Fig. 1B). To confirm whether PTEN expression was coupled with AKT phosphorylation in a drug-resistant subline, we transiently expressed
267
PTEN by transfecting GEF1-1 cells with pIRES-PTEN. As shown in Fig. 1C, PTEN overexpression suppressed AKT phosphorylation in GEF1-1 cells at 24 h after PTEN cDNA transfection (Fig. 1C). We constructed a PTEN expression vector (pEB–HygA–PTEN), which had an episomal replication system, to express the PTEN gene in a stable manner. Transfection of this PTEN expression vector resulted in the stable expression of PTEN in GEF1-1, which was accompanied by p-AKT suppression (Fig. 1D). PTEN overexpression in GEF1-1 restored 10-fold sensitivity to both gefitinib and erlotinib (Fig. 1E and F). The phosphorylation of EGFR and ERK was suppressed by gefitinib, whereas phosphorylation of AKT was not suppressed in GEF1-1/mock. In contrast, phosphorylation of AKT was reduced by gefitinib in GEF1-1/PTEN (Fig. 1G). 3.2. EGR-1 knockdown or overexpression alters expression of cyclin D1 and ICAM-1 but not of PTEN PTEN expression is known to be enhanced by the transcription factor EGR-1 in various cancer cell lines [13]. Our previous study demonstrated that the nuclear expression of EGR-1 was decreased in GEF1-1 and GEF2-1 cells, suggesting that the decreased expression of PTEN is contributed to the defective nuclear translocation of EGR-1 [8]. We further confirmed whether the decreased expression of PTEN in these drug-resistant sublines was mediated through lower nuclear translocation of EGR-1. We first compared the expression levels of EGR-1 in the nuclear and cytoplasmic fractions from PC9 and its resistant sublines by western blot
Fig. 1. Effects of PTEN overexpression on AKT phosphorylation and the sensitivity to gefitinib and erlotinib in PC9 and gefitinib-resistant cells. (A) The sensitivity to gefitinib of PC9, GEF1-1, GEF2-1, and Rev1 is assessed by cell proliferation assays. Each value is average of triplicate samples ±SD. (B) Expression of PTEN, AKT, p-AKT, ERK, p-ERK, and -actin according to western blot analysis. (C) Comparison of the expression levels of PTEN, AKT, p-AKT, ERK, p-ERK, and -actin after transient transfection with a PTEN expression vector for 24 h, according to western blot analyses. (D) Comparison of the expression levels of PTEN, AKT, p-AKT, ERK, p-ERK, and -actin in PTEN stably transfected cells, according to western blot analyses. The stably transfected cells were selected with hygromycin for 1 week after transfection and lysed. (E and F) The sensitivity to gefitinib (E) and erlotinib (F) of GEF1-1/mock and GEF1-1/PTEN. Each value is average of triplicate samples ±SD. (G) Effects of gefitinib on the expression levels of p-EGFR, p-AKT, and p-ERK in PTEN stably transfected cells, according to western blot analysis. GEF 1-1/mock and GEF 1-1/PTEN cells were treated with or without gefitinib for 5 h.
268
M. Maeda et al. / Lung Cancer 87 (2015) 265–271
Fig. 2. Effects of EGR-1 on PTEN, cyclinD1 and ICAM-1 in PC9 and GEF1-1. (A) Western blot analysis showing the expression levels of EGR-1 in the nuclear and cytosol fractions of resistant cell lines. CREB and HSP-90 were used as loading controls for the nuclear and cytosol fractions, respectively. (B) Western blot analysis showing the expression levels of EGR-1 and PTEN when EGR-1 is silenced by three EGR-1 siRNAs (#1–#3). Two different anti-EGR-1 antibodies, 15F7 and 588, were used to detect the band corresponding to EGR-1. (C) Comparison of the expression levels of PTEN, cyclin D1, and ICAM-1 after transient treatment with EGR-1 siRNA in PC9 cells. (D) Comparison of the expression levels of PTEN, cyclin D1, and ICAM-1 after transient treatment with EGR-1 expression vector. (E) Expression of PTEN, cyclin D1, and ICAM-1 mRNA in PC9 and GEF1-1 cells transfected with or without EGR-1 expression vector.
analysis (Fig. 2A). GEF1-1 and GEF2-1 showed decreased expression levels of EGR-1 in the nuclear fraction compared with PC9. Direct DNA sequence analysis revealed that there were no mutations in the EGR-1 gene or in the PTEN promoter up to 1000 bases (data not shown), suggesting that the altered expression levels of PTEN and nuclear EGR-1 are not due to mutation in PTEN promoter and EGR-1 gene. Subsequently, we examined whether EGR-1 knockdown induced the suppressed expression of PTEN in the parental PC9 cells. Our previous study showed that treatment with 100 nM EGR1 siRNA partially reduced EGR-1 expression, together with slightly decreased expression of PTEN [8]. We further confirmed the effect of EGR-1 knockdown on PTEN expression by western blotting with three EGR-1 siRNAs (siEGR-1#1, #2 and #3). In our previous study [8], EGR-1 knockdown was induced only by EGR-1 siRNA#3, and the band corresponding to EGR-1 was detected only by using anti-EGR-1 antibody (588). In this study, Treatment of PC9 cells with 100 nM of siEGR-1#3 resulted in only a slight reduction of EGR-1 expression detected by anti-EGR-1 antibody (588) (Fig. 2B), consistent with our previous study [8]. In contrast, treatment with all these three EGR-1 siRNAs at 5 nM markedly silenced EGR-1 expression when EGR-1 band was recognized by another antiEGR-1 antibody (15F7) (Fig. 2B). Together, the antibody against EGR-1 (15F7) which we used in this study specifically recognize EGR-1 protein than anti-EGR-1 (588) which we used previously. Therefore, we used the anti-EGR-1 antibody (15F7) in the present study. As EGR-1 is a key transcriptional factor of not only PTEN, but also cyclin D1 and ICAM-1 [13–15], we also investigated the effect of EGR-1 knockdown on the expression of PTEN, cyclin D1 and ICAM-1. EGR-1 knockdown with 5 nM EGR-1 siRNA#1 suppressed expression of cyclin D1 and ICAM-1, but not at all PTEN expression
in PC9 cells (Fig. 2C). We also examined whether EGR-1 overexpression could increase PTEN expression in drug-resistant sublines by transfecting with EGR-1 cDNA. Transfection with EGR-1 cDNA increased the expression of EGR-1 (Fig. 2D). There were marked increases in the expression levels of EGR-1 in both the cytoplasm and nucleus of PC9 and GEF1-1 cells after transfection with EGR-1 cDNA (data not shown). In GEF1-1 cells, EGR-1 overexpression resulted in higher expression of cyclin D1 and ICAM-1 but not of PTEN (Fig. 2D). The cellular mRNA levels of both cyclin D1 and ICAM-1 also increased by approximately 3–5-fold in GEF1-1 cells with EGR-1 overexpression (Fig. 2E). In contrast, there was no enhancement in PTEN mRNA expression with EGR-1 overexpression in the resistant subline (Fig. 2E). The expression levels of PTEN, cyclin D1, and ICAM-1 were all downregulated in the gefitinibresistant subline compared with PC9 (Fig. 2D and E). Therefore EGR-1 is not responsible for PTEN expression in GEF1-1 cells. 3.3. Altered CpG methylation status in the promoter region of the PTEN gene in gefitinib-resistant cells Expression of PTEN gene is also controlled through CpG methylation/demethylation at its promoter region [17–19]. Then, we compared the DNA methylation status of the PTEN promoter region in PC9 and resistant cells. The time kinetics for 5 M 5AZA-CdR treatment showed that there was an approximately 3-fold higher expression level of PTEN mRNA when GEF1-1 and GEF2-1 cells were treated for 48 h and 72 h but not when PC9 cells were treated (Fig. 3A). Treatment with 5AZA-CdR at 5 M for 72 h significantly induced the expression of PTEN mRNA in GEF1-1 and GEF2-1 cells but there were no changes in PC9 and Rev1 (Fig. 3B). Western blot analysis also detected the increased expression of PTEN
M. Maeda et al. / Lung Cancer 87 (2015) 265–271
269
Fig. 3. Effects of 5AZA-CdR on PTEN expression. (A) Time course of the induction of PTEN mRNA expression by 5AZA-CdR in PC9, GEF1-1 and GEF2-1. Lysates prepared from PC9 and gefitinib-resistant cell lines were treated with or without 5 M 5AZA-CdR. Columns, mean of three independent experiments; bars, standard deviation (SD); *, p < 0.05, versus without 5AZA-CdR (B) Concentration-dependent effect of 5AZA-CdR on PTEN mRNA expression in PC9, GEF1-1, GEF2-1 and Rev1. The lysates were prepared from PC9, GEF1-1, GEF2-1 and Rev1, which were treated with or without 5AZA-CdR for 72 h. Columns, mean of three independent experiments; bars, SD; *, p < 0.05, versus without 5AZA-CdR. (C) Comparison of the expression levels of E-cadherin and PTEN after treatment with 5AZA-CdR. Lysates prepared from PC9, GEF1-1 and GEF2-1 were treated with or without 5AZA-CdR for 72 h. The PTEN bands of gefitinib-resistant sublines (*) are shown after long-term exposure.
protein in GEF1-1 and GEF2-1 cells in a dose-dependent manner but not in PC9 cells, after treatment with 5AZA-CdR (Fig. 3C). As E-cadherin expression is regulated epigenetically via methylation of the promoter [20], we investigated the effect of demethylation by 5-AZA-CdR on E-cadherin expression in PC9, GEF1-1 and GEF21. Increased expression of E-cadherin was observed in PC9, GEF1-1 and GEF2-1 in a dose-dependent manner (Fig. 3C). These results suggest that PTEN is regulated by methylation of its promoter region in gefitinib-resistant cell lines, but not in their parental counterpart PC9 cells. 3.4. CpG methylation status of PTEN promoter region by MSP analysis To determine the CpG methylation status of the PTEN promoter region in PC9, GEF1-1, GEF2-1 and Rev1, we used a Methyl EasyTM Xceed Rapid DNA Bisulphite Modification Kit for bisulfite treatment. In this assay, the hypermethylation status was monitored based on the presence or absence of the amplified band using methylation-specific primers for PTEN (Table 1). We used three CpG sites on the PTEN promoter, i.e., sequences (a), (b), and (c), which are known to be essential for PTEN gene expression [17–19,21] (Fig. 4A). Sequence (a) was specifically methylated in GEF1-1 and GEF-2-1. In contrast, the methylation level of sequence (a) was much lower in
both PC9 and Rev1 than gefitinib-resistant sublines (Fig. 4B). There was no apparent methylation at sequences (b) and (c) in all four cell lines. The methylated band of sequence (a) was attenuated in GEF1-1 and GEF2-1 cells after 5AZA-CdR treatment (Fig. 4C). 4. Discussion In our previous study [8], gefitinib-resistant sublines derived from PC9 harboring EGFR-activating mutations exhibited marked decreased expression levels of PTEN, which was accompanied by the loss of nuclear EGR-1 translocation. Also cyclin D1 and ICAM1 gene expression were simultaneously downregulated in these resistant cells. Furthermore, we previously demonstrated that the expression of PTEN, cyclin D1, and ICAM-1 were all recovered in the drug-sensitive revertant Rev1, where the levels were similar to those in PC9. EGR-1 is known to be a transcription factor of PTEN [13,22,23] as well as cyclin D1 and ICAM-1 genes [13–15]. In our previous study, we concluded that the decreased expression of PTEN may be attributable to the low nuclear translocation of EGR-1 [8]. In the present study, we first characterized more in detail whether the decreased expression of PTEN occurred in association with the decreased nuclear translocation of EGR-1 in gefitinib-resistant cells. The results obtained indicated the following novel findings. (1) PTEN overexpression suppressed AKT
270
M. Maeda et al. / Lung Cancer 87 (2015) 265–271
Fig. 4. DNA methylation status of the PTEN promoter in PC9, GEF1-1, GEF2-1, and Rev1. (A) Schematic representation of the potential CpG sites and PCR amplification regions used for methylation-specific PCR (MSP) analysis in the PTEN promoter. (a)–(c) represent the regions amplified using PTEN primers. (B) Amplification of bisulfite-treated DNA in PC9, GEF1-1, GEF2-1 and Rev1. The MSP assay used primer sets that specifically amplified unmethylated (U) or methylated (M) alleles. M*: the DNA was treated with methylase for 4 h and amplified by PCR using primers to detect methylated DNA. (C) Effect of 5AZA-CdR on the methylation status of the PTEN promoter. Cells were treated with or without 5AZA-CdR (5 M) for 72 h. (D) Our hypothetic model how PTEN expression was downregulated in our gefitinib-resistant cells. In gefitinib-resistant cell lines, PTEN expression was downregulated due to CpG hypermethylation in the PTEN promoter resulting in constitutive activation of PI3K/AKT pathway. Impaired EGR-1 translocation into the nucleus was not responsible to PTEN expression.
phosphorylation and restored the drug sensitivity to gefitinib and erlotinib in GEF1-1 cells. (2) EGR-1 knockdown by siRNA did not suppress PTEN expression, but it suppressed the expression of cyclin D1 and ICAM-1 in the parental PC9 cells. (3) Overexpression of EGR-1 also restored both the protein and mRNA expression levels of cyclin D1 and ICAM-1 but not of PTEN in GEF1-1. In the previous study [8], even treatment with 100 nM EGR-1 siRNA only slightly reduced EGR-1 expression detected by anti-EGR-1 (588) antibody, together with slightly reduced expression of PTEN [8], and we hypothesized that lower nuclear translocation of EGR-1 was a cause for the decreased expression of PTEN in gefitinib-resistant cells. However, our present study apparently demonstrated that treatment with all three EGR-1 siRNAs at 5 nM markedly reduced expression of the band detected by anti-EGR-1 (15F7) antibody, but not by anti-EGR-1 (588) antibody. The antibody against EGR-1 (588) that was used in our previous study [8] was low selectivity to recognize EGR-1. Our present study strongly demonstrated that the decreased expression of PTEN induced during the selection of drug-resistant cells was not attributed to reduced EGR-1 expression and translocation to the nucleus, and also suggested that the reduced expression levels of cyclin D1 and ICAM-1 were due to the decreased nuclear expression of EGR-1 (Fig. 2C–E). Furthermore promoter methylation is one of the mechanisms of altered expression levels of PTEN. DNA methylation is associated with transcriptional silencing of many genes in normal and malignant cells [24–26], indicating that DNA methylation is a key regulator of gene expression. The degree of methylation at CpG sites on 5 -regulatory regions plays crucial roles in the transcriptional activation of various genes in human cancers [27,28]. PTEN gene expression is also known to be under the control of CpG site methylation at its promoter region [17–19,21]. In the present study, we
showed that (1) Treatment with 5AZA-CdR restored PTEN mRNA expression in gefitinib-resistant cell lines but not in PC9 and Rev1 (Fig. 3A and B), while PTEN protein expression was also restored by 5AZA-CdR (Fig. 3C). (2) The region located 329 to 124 nucleotide upstream from the translation initiation site of the PTEN promoter region was specifically hypermethylated in resistant cell lines but not in PC9 and Rev1 according to the MSP analysis (Fig. 4B). Overall, our results strongly suggest that a CpG site in the PTEN gene promoter is hypermethylated in gefitinib-resistant cells, which downregulates PTEN gene expression in resistant cells (Fig. 4D). 5. Conclusion As an underlying mechanism of the decreased expression of PTEN in our gefitinib-resistant lung cancer cells, we presented that the decreased PTEN expression induced during the acquisition of gefitinib-resistance was explained by hypermethylation of a CpG site in the PTEN gene promoter. On the other hand, we consistently observed lower EGR-1 translocation into the nucleus in gefitinib-resistant sublines and the decreased nuclear translocation of EGR-1 affected only expression of targeted gene such as cyclin D1 and ICAM-1. Decreased PTEN expression through altered methylation status thus mediates acquirement of gefitinib-resistance, and drug resistance to gefitinib and erlotinib could be overcome by combination treatment with epigenetic modulators and EGFR-TKIs. Conflict of interest statement None declared.
M. Maeda et al. / Lung Cancer 87 (2015) 265–271
Acknowledgments This work was supported by the 3rd Term Comprehensive Control Research for Cancer from the Ministry of Health, Labor, and Welfare in Japan and also by a Grant-in-Aid for challenging Exploratory Research from the Japan Society for the Promotion of Science (JSPS) (M.K.) and supported by Life Science Foundation (M.O). References [1] Fukuoka M, Yano S, Giaccone G, Tamura T, Nakagawa K, Douillard JY, et al. Multi-institutional randomized phase II trial of gefitinib for previously treated patients with advanced non-small-cell lung cancer. J Clin Oncol 2003;21:2237–46. [2] Tsao MS, Sakurada A, Lorimer I, Cutz JC, Kamel-Reid S, Squire J, et al. Molecular analysis of the epidermal growth factor receptor (EGFR) gene and protein expression in patients treated with erlotinib in National Cancer Institute of Canada Clinical Trials Group (NCIC CTG) trial BR.21. J Clin Oncol 2005;23:7007. [3] Kobayashi S, Boggon TJ, Dayaram T, Jänne PA, Kocher O, Meyerson M, et al. EGFR mutation and resistance of non-small-cell lung cancer to gefitinib. N Engl J Med 2005;352:786–92. [4] Pao W, Miller VA, Politi KA, Riely GJ, Somwar R, Zakowski MF, et al. Acquired resistance of lung adenocarcinomas to gefitinib or erlotinib is associated with a second mutation in the EGFR kinase domain. PLoS Med 2005;2: e73. [5] Engelman JA, Zejnullahu K, Mitsudomi T, Song Y, Hyland C, Park JO, et al. MET amplification leads to gefitinib resistance in lung cancer by activating ERBB3 signaling. Science 2007;316:1039–43. [6] Ellis LM, Hicklin DJ. Resistance to targeted therapies: refining anticancer therapy in the era of molecular oncology. Clin Cancer Res 2009;15:7471–8. [7] Garraway LA, Jänne PA. Circumventing cancer drug resistance in the era of personalized medicine. Cancer Discov 2012;2:214–26. [8] Yamamoto C, Basaki Y, Kawahara A, Nakashima K, Kage M, Izumi H, et al. Loss of PTEN expression by blocking nuclear translocation of EGR1 in gefitinib-resistant lung cancer cells harboring epidermal growth factor receptor-activating mutations. Cancer Res 2010;70:8715–25. [9] Tabara K, Kanda R, Sonoda K, Kubo T, Murakami Y, Kawahara A, et al. Loss of activating EGFR mutant gene contributes to acquired resistance to EGFR tyrosine kinase inhibitors in lung cancer cells. PLoS One 2012;7:e41017. [10] Kanda R, Kawahara A, Watari K, Murakami Y, Sonoda K, Maeda M, et al. Erlotinib resistance in lung cancer cells mediated by integrin 1/Src/Akt-driven bypass signaling. Cancer Res 2013;73:6243–53. [11] Garofalo M, Romano G, Di Leva G, Nuovo G, Jeon YJ, Ngankeu A, et al. EGFR and MET receptor tyrosine kinase- altered microRNA expression induces tumorigenesis and gefitinib resistance in lung cancers. Nat Med 2011;18:74–82.
271
[12] Okamoto K, Okamoto I, Hatashita E, Kuwata K, Yamaguchi H, Kita A, et al. Overcoming erlotinib resistance in EGFR mutation-positive non-small cell lung cancer cells by targeting survivin. Mol Cancer Ther 2012;11:204–13. [13] Virolle T, Adamson ED, Baron V, Birle D, Mercola D, Mustelin T, et al. The Egr-1 transcription factor directly activates PTEN during irradiation-induced signaling. Nat Cell Biol 2001;3:1124–8. [14] La P, Fernando AP, Wang Z, Salahudeen A, Yang G, Lin Q, et al. Zinc protoporphyrin regulates cyclin D1 expression independent of heme oxygenase inhibition. J Biol Chem 2009;284:36302–11. [15] Maltzman JS, Carmen JA, Monroe JG. Transcriptional regulation of the Icam-1 gene in antigen receptor- and phorbol ester-stimulated B lymphocytes: role for transcription factor EGR1. J Exp Med 1996;183:1747–59. [16] Sakuma Y, Maruyama K, Osakabe Y, Qin F, Seki M, Shinozaki K, et al. Functional analysis of an Arabidopsis transcription factor, DREB2A, involved in droughtresponsive gene expression. Plant Cell 2006;18:1292–309. [17] Salvesen HB, MacDonald N, Ryan A, Jacobs IJ, Lynch ED, Akslen LA, et al. PTEN methylation is associated with advanced stage and microsatellite instability in endometrial carcinoma. Int J Cancer 2001;91:22–6. ˜ C, Garcia V, Rodríguez R, Cruz MA, et al. Promoter meth[18] García JM, Silva J, Pena ylation of the PTEN gene is a common molecular change in breast cancer. Genes Chromosomes Cancer 2004;41:117–24. [19] Soria JC, Lee HY, Lee JI, Wang L, Issa JP, Kemp BL, et al. Lack of PTEN expression in non-small cell lung cancer could be related to promoter methylation. Clin Cancer Res 2002;8:1178–84. [20] Graff JR, Herman JG, Myöhänen S, Baylin SB, Vertino PM. Mapping patterns of CpG island methylation in normal and neoplastic cells implicates both upstream and downstream regions in de novo methylation. J Biol Chem 1997;272:22322–9. [21] Wiencke JK, Zheng S, Jelluma N, Tihan T, Vandenberg S, Tamgüney T, et al. Methylation of the PTEN promoter defines low-grade gliomas and secondary glioblastoma. Neuro Oncol 2007;9:271–9. [22] Okamura H, Yoshida K, Morimoto H, Haneji TPTEN. expression elicited by EGR1 transcription factor in calyculin A-induced apoptotic cells. J Cell Biochem 2005;94:117–25. [23] Fantini D, Vascotto C, Deganuto M, Bivi N, Gustincich S, Marcon G, et al. APE1/Ref-1 regulates PTEN expression mediated by Egr-1. Free Radic Res 2008;42:20–9. [24] Antequera F, Boyes J, Bird A. High levels of De Novo methylation and altered chromatin structure at CpG islands in cell lines. Cell 1990;62:503–14. [25] Boyes J, Bird A. DNA methylation inhibits transcription indirectly via a methylCpG binding protein. Cell 1991;64:1123–34. [26] Laird PW, Jaenisch R. DNA Methylation and Cancer Hum Mol Genet 1994;3:1487–95. [27] Nakayama M, Wada M, Harada T, Nagayama J, Kusaba H, Ohshima K, et al. Hypomethylation status of CpG sites at the promoter region and overexpression of the human MDR1 gene in acute myeloid leukemias. Blood 1998;92:4296–307. [28] Toyota M, Ahuja N, Suzuki H, Itoh F, Ohe-Toyota M, Imai K, et al. Aberrant methylation in gastric cancer associated with the CpG island methylator phenotype. Cancer Res 1999;59:5438–42.
