FEBS Letters 588 (2014) 3898–3905

journal homepage: www.FEBSLetters.org

Coronin 1 trimerization is essential to protect pathogenic mycobacteria within macrophages from lysosomal delivery Somdeb BoseDasgupta 1, Jean Pieters ⇑ Biozentrum, University of Basel, Switzerland

a r t i c l e

i n f o

Article history: Received 15 July 2014 Revised 23 August 2014 Accepted 28 August 2014 Available online 12 September 2014 Edited by Renee Tsolis Keywords: Coronin 1 Coiled coil Trimerization Pathogenic mycobacteria Macrophages

a b s t r a c t Coronin 1 is a member of the evolutionarily conserved coronin protein family. Coronin proteins are characterized by the presence of a central WD repeat and a C-terminal coiled coil that in coronin 1 is responsible for trimerization. Coronin 1 was identified as a host protein protecting intracellularly residing mycobacteria from degradation by activating the Ca2+/calcineurin pathway but whether or not trimerization is essential for this function remains unknown. We here show that trimerization is essential to promote mycobacterial survival within macrophages and activate calcineurin. Furthermore, macrophage activation that induces serine-phosphorylation on coronin 1 resulted in coronin 1 monomerization. These results suggest that modulation of coronin 1 oligomerization is an effective way to determine the outcome of a mycobacterial infection in macrophages. Ó 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

1. Introduction Coronin proteins are found in all eukaryotic species, and belong to the WD repeat containing protein family. Bioinformatic analysis revealed over 700 different coronin proteins to be encoded in 350 different eukaryotic species [1,2]. In mammals, seven different coronin molecules are expressed. Of these, coronin 1, also known as P57 or TACO (for Tryptophan Aspartate containing Coat protein), is one of the best characterized mammalian coronins and predominantly expressed in leukocytes, where it localizes at the cell cortex [3]. Coronin 1 was identified as a host factor that in resting macrophages protects pathogenic mycobacteria from lysosomal delivery [3,4]. Subsequent work revealed its essential role in T cell homeostasis: in the absence of coronin 1, mice are virtually devoid of naïve T cells [5–7]. This role for coronin 1 in maintaining T cells in the periphery was found to be a result of its role in activating the Ca2+/calcineurin pathway following T cell receptor triggering; interestingly, it turned out that also the function of coronin 1 in sustaining mycobacterial survival within macrophages is a result of the activity of coronin 1 in activating the Ca2+/calcineurin

⇑ Corresponding author at: Biozentrum, University of Basel, Klingelbergstrasse 50-70, CH4056 Basel, Switzerland. Fax: + 41 61 267 21 48. E-mail address: [email protected] (J. Pieters). 1 Present address: School of Biomedical Engineering, IIT (BHU), Varanasi 221005, Uttar Pradesh, India.

pathway [8,9]. More recently, neuronally expressed coronin 1, as well as its homologue in the lower eukaryote Dictyostelium discoideum, coronin A, has been implicated in the activation of the cAMP/ protein kinase A pathway; whether or not such an activity is also involved in pathogen survival in macrophages and/or T cell homeostasis remains to be established [10,11]. Importantly, the role for coronin 1 as well as coronin A in promoting activation of Ca2+ and/or cAMP signaling is independent of a modulatory activity of coronin 1 or coronin A on F-actin rearrangement, that has been suggested to be one of the activities of coronin molecules [10–13]. Structurally, coronin 1 is organized into three domains, an N-terminal, WD repeat-containing b-propeller connected by a linker region to a C-terminal coiled coil domain [3,14]. Biophysical and structural analysis demonstrated that the C-terminal 30–40 residues of coronin 1 fold into a parallel three-stranded, a-helical coiled coil that mediates trimerization of coronin 1 molecules [14,15]. Whereas the role for the C-terminal coiled coil in coronin 1 trimerization is well established, the importance of trimerization for the biological activity of coronin 1 remains unclear. We here show that trimerization is crucial for the role of coronin 1 in activating calcineurin upon mycobacterial infection and protecting intracellularly residing mycobacteria from lysosomal delivery and killing. We furthermore report that in macrophages that have been activated with the inflammatory cytokine interferon-c that induces serine-phosphorylation on coronin 1 [16], coronin 1 rapidly monomerizes as a result of serine phosphorylation, and is

http://dx.doi.org/10.1016/j.febslet.2014.08.036 0014-5793/Ó 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

3899

S. BoseDasgupta, J. Pieters / FEBS Letters 588 (2014) 3898–3905

2.1. DNA constructs

2.2. Cell lines and transfection

The short hairpin (sh) RNA unresponsive coronin 1 construct was generated by site directed mutagenesis of the shRNA responsive region in the pCB6-Cor1-HA clone [17] using the sense primer 50 -CCCCTAGGCAAGACTGGACGTGTGGACAAGAACGTGCCC-30 where the mutated nucleotides are shown in italics and antisense primer 50 -GGGCACGTTCTTGTCCACACGTCCAGTCTTGCCTAGGGG-30 . Similarly, shRNA mutant versions of the alanine (Cor1S4A) and phosphomimetic glutamate (Cor1S4E) mutants of coronin 1 to change the serines 9, 311, 356 and 412 to either alanine or glutamic acid, see also Fig. 3H in [16] were generated using the similar sense and antisense primers and using Cor1S-A-EGFP and Cor1S-E-EGFP constructs as templates respectively. Wild type, coiled coil deleted, alanine mutant and phosphomimetic mutant versions of coronin 1 were PCR amplified from the above constructs using the sense primer 50 -CTAGCTAGCATGAGCCG GCAGGTGGTTCGCTCC-30 for all clones and antisense primers 50 -CGCGGATCCCTAAGGTCCTCCCA GGCTGGCATAG TCAGGCACGTCATAAGGATACTTGGCCTGAACAGTCTCC TC-30 for the full length coronin 1, and full length alanine and

Unless otherwise stated, J774 wild type or coronin 1 knock down (J774-KD) cells as described before [17] were used. Immortalized bone marrow macrophages [16], either untreated or activated with interferon-c were also used for purification of coronin 1. All macrophages were grown in DMEM (Sigma; 4.5 g/l glucose), supplemented with 10% heat inactivated FBS (PAA; low endotoxin) and 2 mM L-glutamine (Sigma). For mycobacterial infections Mycobacterium bovis BCG (Pasteur strain, Trudeau Mycobacterial Culture Collection (TMC) #1011) or M. bovis BCG-GFP (Montreal strain, TMC #1012) [3,18] were used and cultured in 7H9 containing 10% oleatealbumin-dextrose-catalase (OADC) enrichment and including kanamycin 50 lg/ml in case of M. bovis BCG-GFP. For colony forming unit assays mycobacteria were plated on 7H11 agar plates. J774-KD macrophages were transfected with the constructs pIRESpuro3Cor1⁄-HA, pIRESpuro3-Cor1DCC⁄-HA, pIRESpuro3-Cor1S-A⁄-HA and pIRESpuro3-Cor1S-E⁄-HA using the Neon transfection system (Invitrogen) at 1720 mV, 25 ms and 1 pulse. For transmission electron microscopy analysis, the coiled coil domain-deleted coronin 1

Mr(kDa) -70

T*

1-

1W

Sp

+C or Mr(kDa)

-50

anti-HA

-37

-50

J774-KD +Cor1-ΔCC*

-55

anti-actin

anti-actin

-37

percentage of Cor1

S P S

Cor1-HA

-37

** *

-37

anti-Cor1

E 670kDa

*

80

RE

M

J774-KD +Cor1-WT*

anti-Cor1

100

pI

BM

P S P S P

-70

-50

D

+C or

ur o

C ti DR-Co AQ r1-4 5 88

B an

J7

74 J7 KD 74 -K D+ J7 74 Cor 1 -K D+ -WT * Co r1 -Δ CC *

A

ΔC C*

2. Materials and methods

glutamic acid mutant and antisense primer 50 -CTTGGCCTGAAC AGTCTCCTCAGGTCCTCCCAGGCTGGCATAGTCAGGCACGTCA TAAGGATACCTTGACACGGTATCCGAGCT-30 for the coiled coil-deleted clone to be subcloned into the vector pIRES-puro3 in the NheI and NotI sites. The sequences in italics represent the sequence coding for the HA-tag.

unable to activate calcineurin. Together these results suggest that modulation of coronin 1 oligomerization is an efficient strategy for the host immune response to modulate the survival of intracellularly residing mycobacteria.

158kDa

44kDa

14kDa Mr(kDa) -70

** J774-KD +Cor1-WT*

60

-50

-37 40

-70 -50

J774-KD +Cor1-ΔCC*

20

-37

BMM

J774-KD

J774-KD + Cor1-WT*

to ta pe l lle t

to ta pe l lle t

to ta pe l lle t

to ta pe l lle t

0

Fractions 1

2

3

4

5

6

7

8

9

10

11 12 13

14

J774-KD + Cor1-ΔCC*

Fig. 1. Coiled coil-deleted monomeric coronin 1 fails to prevent lysosomal transfer of mycobacteria. (A) Expression of siRNA-resistant coronin 1 in J774-knock down cells. J774-KD macrophages were either untransfected or transfected with the indicated constructs (* denotes siRNA unresponsive construct) followed by lysis and immunoblotting for coronin 1. (B) Immunolocalization of coronin 1 wild type (Cor1-WT⁄) or coronin 1 lacking the coiled coil region (Cor1-DCC⁄) in J774 macrophages that were depleted for coronin 1. (C, D) Bone marrow derived macrophages (BMM) or coronin 1 knocked down J774-KD cells transfected with the indicated constructs were lysed, and fractionated into pellet (P) and supernatant (S). The fractions were separated by SDS–PAGE and immunoblotted using anti-coronin 1 and anti-actin antibodies. Panel D represents densitometric analysis whereby the P + S from bone marrow-derived macrophages (BMM) was taken as 100%. Asterix (*) indicates P < 0.05 while (**) indicates P < 0.01, Student’s t-test. (E) Macrophages (J774) depleted for coronin 1 were transiently transfected with wild type coronin 1 (Cor1-WT⁄) or coronin 1 lacking the coiled coil region (Cor1-DCC⁄), homogenized and cell homogenates were analyzed by size-exclusion chromatography. The presence of the coronin 1 constructs was analyzed using immunoblotting following SDS–PAGE of the fractions indicated.

S. BoseDasgupta, J. Pieters / FEBS Letters 588 (2014) 3898–3905

pI RE S Co pur o3 r1 Co -WT r1 * -Δ CC *

A

Mr(kDa)

B

C J774-KD+Cor1-WT* +BCG-GFP

J774-KD+Cor1-ΔCC* +BCG-GFP % of lysosomal localization

3900

-70 -55

anti-Cor1 -37 -70 -55

anti-actin -37

10000

1000

100

10

Cor1-WT*

1000

100

10

0

0 0hr 24hr 48hr Chase Time

10000

Log (colony forming units)

Empty Vector

Log (colony forming units)

Log (colony forming units)

10000

BCG-GFP; LAMP1-568

****

80

60

40

20

0

BCG-GFP; LAMP1-568

D

100

J774-KD+ J774-KD+ Cor1-WT* Cor1-ΔCC*

Cor1-ΔCC*

1000

100

10

0 0hr 24hr 48hr Chase Time

0hr 24hr 48hr Chase Time

Fig. 2. Essential role for the coronin 1 C-terminal coiled coil in preventing lysosomal transfer and degradation of mycobacteria. (A) Immunoblotting for coronin 1 in macrophages (J774) depleted for coronin 1 alone (lane 1) or expressing wild type coronin 1 (Cor1-WT⁄) (lane 2) or coronin 1 lacking the coiled coil region (Cor1-DCC⁄) (lane 3). (B) Cor1-WT⁄ or Cor1-DCC⁄ expressing coronin 1-depleted macrophages were incubated with M. bovis BCG-GFP for 1 h followed by a chase of 3 h. Thereafter cells were fixed with methanol and incubated with anti-LAMP1 antibodies followed by AlexaFluor568-conjugated secondary antibodies. Bar: 10 lm. (C) Quantitation representing percentages of colocalization of M. bovis BCG-GFP with LAMP1 (n = 20; three independent experiments). Asterix (****) indicates P < 0.0001, Student’s t-test. (D) Survival of M. bovis BCG upon infection in macrophages (J774) depleted for coronin 1 alone (left panel) or expressing wild type coronin 1 (Cor1-WT⁄) (middle panel) or coronin 1 lacking the coiled coil region (Cor1-DCC⁄) (right panel) at the indicated time points (mean values ± S.D. from 3 independent experiments). Student’s t-test revealed that the empty vector and the Cor1-DCC⁄ expressing cells in comparison to Cor1-WT⁄ expressing cells at 0 h time point have no significant difference but at 24 h the significance levels are P < 0.05 and P < 0.01 respectively, while at 48 h time point the significance levels are P < 0.001 for both.

was transfected in HEK293 (grown in DMEM with 10% FCS) using Lipofectamine LTX (Invitrogen/Life Technologies), overexpressed and purified as described below. 2.3. Reagents and antibodies Interferon-c was from R & D, stocks of 100 lg/ml were prepared in sterile PBS and for activation 1000 U/ml was used. Puromycin, Kanamycin and G418 were from Sigma, stocks were prepared at 20 mg/ml, 50 mg/ml and 400 mg/ml in water respectively. Coronin 1 antibodies were either polyclonal rabbit antisera as described before [14] or monoclonal mouse anti-coronin 1 (Abcam). Other antibodies used were: mouse monoclonal anti-actin (Millipore), mouse monoclonal anti-HA (Santa Cruz), rat monoclonal antiLAMP-1 clone 1D4B (IgG2a; developed by T. August and obtained from the Developmental Studies Hybridoma Bank at the University of Iowa). All secondary antibodies (Southern Biotech) for western blotting were horseradish peroxide (HRP)-conjugated goat and donkey anti-rabbit and goat anti-mouse. All secondary antibodies for immunofluorescence (Molecular Probes) were AlexaFluor488 or -568-conjugated anti-rabbit, anti-mouse, anti-rat raised in goat. 2.4. Quantitations For lysosomal transfer quantitations, the number of LAMP1 positive mycobacteria-containing cells were divided by the total

number of cells analyzed and multiplied by 100 to result in the percentage of lysosome-transferred mycobacteria. For colony forming unit analysis the samples were diluted 1:10 and plated onto 7H11 agar plates. Thereafter the colonies formed were counted and multiplied by 10. Shown are mean values (±S.D.) from 3 independent experiments and plotted corresponding to each time point. 2.5. Cell fractionation Cell fractionation was performed essentially as described [16]. Briefly, J774-KD cells alone or expressing the shRNA resistant constructs were resuspended in ice cold homogenization buffer (20 mM HEPES, pH7.9, 10 mM NaCl, 0.5 mM EDTA, 200 mM sucrose, 0.5 mM PMSF and protease and phosphatase inhibitor cocktail (Aprotinin, Bestatin, E-64, Leupeptin, Sodium fluoride, Sodium orthovanadate, Sodium pyrophosphate, b-glycerophosphate, (Thermo Scientific)), incubated on ice for 10 min followed by homogenization using a Dounce homogenizer (2 ml volume with piston B, 10-15 strokes) on ice. The homogenates were centrifuged for 10 min at 4 °C at 400g to remove the nuclear pellet. The post-nuclear supernatant was centrifuged at 18 000g for 15 min at 4 °C. The resulting ‘Pellet’ served as the plasma membrane fraction, while the ‘Supernatant’ includes the non-plasma membrane fraction [19]. The ‘Pellet’ was solubilized with 1% sodium-b-D-maltoside in homogenization buffer on ice and then suspended in the

3901

S. BoseDasgupta, J. Pieters / FEBS Letters 588 (2014) 3898–3905

A

IB: anti-Coronin 1 158kD 44kD

670kD 1

2

3

4

5

6

7

8

9

10

11

B

17kD 12

13

14

Mr(kDa) -70

Mr(kDa) 70-

-50

50-

-37

37-

1

Coronin 1 (Control BMM)

or u Co 1-W ro3 Co r1-S T* r1 4A -S * 4E *

pI RE C Sp

3

4

5

6

7

8

9

-70 -50

50-

-37

37-

670kD 1

Mr(kDa) -100

-50

2

Control 44kD

158kD 3

10

11

17kD 12

13

14

Coronin 1 (IFNγ activated BMM) + Alkaline phosphatase

D

J774-KD

-70

anti-Cor1

2

Coronin 1 (Control BMM) + Alkaline phosphatase 70-

Coronin 1 (IFNγ activated BMM)

C

IB: anti-Coronin 1 158kD 44kD

670kD

4

5 6

7

17kD

8 9 10 11 12 13 14

670kD Mr(kDa) -70-

1

2

+IFNγ 44kD

158kD 3

4

5 6

7

17kD

8 9 10 11 12 13 14

-50-

J774-KD+ Cor1-WT*

-37-70-

-37 -25

J774-KD+ Cor1-S4A*

-50-37-70-

-50

anti-actin

J774-KD+ Cor1-S4E*

-50-

-37-

-37

IB: anti-Coronin 1

IB: anti-Coronin 1

Fig. 3. Macrophage activation converts trimeric coronin 1 to a monomer. (A, B) Coronin 1 purified from non-activated or interferon-c-activated bone marrow-derived macrophages either (A) kept untreated or (B) treated with alkaline phosphatase, were analyzed by size-exclusion chromatography followed by SDS–PAGE and immunoblotting of the eluted fractions using anti-coronin 1 antibody. (C) Immunoblotting for coronin 1 after electrophoresing lysates by SDS–PAGE from macrophages (J774) depleted for coronin 1 and transiently transfected with (lane 1) empty vector, (lane 2) wild type coronin 1 (Cor1-WT⁄), (lane 3) the serine to alanine mutant of coronin 1 (Cor1-S4A⁄) or (lane 4) the serine to glutamic acid mutant of coronin 1 (Cor1-S4E⁄). (D) Macrophages (J774) depleted for coronin 1 and transiently transfected with Cor1-WT⁄ (upper panel), Cor1-S4A⁄ (middle panel) or Cor1-S4E⁄ (lower panel) were either left untreated (left panels) or activated with interferon-c (right panels) followed by lysis and analysis by size-exclusion chromatography. The presence of the coronin 1 proteins was analyzed using immunoblotting following SDS–PAGE of the fractions indicated.

same buffer, kept on ice again for 15 min followed by centrifugation at 20 000g for 10 min at 4 °C. Proteins quantitated from the ‘Pellet’ and the ‘Supernatant’ fractions, were separated by SDS– PAGE (10%) followed by immunoblotting. Results shown are representative data obtained from three independent experiments. 2.6. Subcellular fractionation and size exclusion chromatography Cells were harvested by scraping and homogenized in 10 mM triethanolamine, 10 mM acetic acid, 1 mM EDTA, 250 mM sucrose, pH 7.4 with a syringe and a 22-gauge 1/4 needle [20]. The nuclei were sedimented by centrifugation at 400g for 10 min at 4 °C and the post-nuclear supernatant were centrifuged at 18 000g for 15 min at 4 °C. The supernatant was kept aside and the pellet was solubilized with 1% sodium-b-D-maltoside in homogenization buffer on ice, kept on ice for 15 min followed by centrifugation at 20 000g for 10 min at 4 °C. Both the solubilized pellet and supernatant fraction were supplemented with 2% (wt/vol final concentration) n-octylglucopyranoside (Sigma–Aldrich) followed by an incubation on ice for 30 min. Subsequently the samples were filtered (0.2 lm), the protein concentrations were adjusted to 5 mg/ml, and 100 ll sample was loaded onto a Sephadex S200 10/300 column (GE Healthcare). Twenty eight fractions (1 ml) were collected, pooled per two and precipitated with 1/5 volume of 100% trichloro-acetic acid (TCA) for 1 h at 4 °C, followed by two washes in 100% acetone and air dried for 1 min. Samples were dissolved in water and boiled with Laemmli buffer, followed by loading on 10% SDS–PAGE gel. Results shown are representative data obtained from three independent experiments.

2.7. Protein analysis After standard SDS–PAGE separation of proteins (10% acrylamide), proteins were blotted onto Hybond-C Super nitrocellulose membrane (Amersham Biosciences) by using the semidry transfer cell (Bio-Rad). Detection of coronin 1, actin, hemagglutinin-tag, was performed using anti-coronin 1 antiserum (1:10 000), antiactin mAb (1:10 000, Millipore), anti-HA mAb (1:1000; Santa Cruz), respectively, followed by goat anti-rabbit or goat anti-mouse antisera coupled to horseradish peroxidase (Southern Biotechnology Associates, Birmingham, AL). Blots were exposed to X-ray films (Fujifilm) after enhanced chemiluminescence reaction (ECL; ThermoScientific). Biochemical experiments were performed at least three times, and representative results are shown. Signal intensities were quantified by densitometric analysis using the inverted images of the blots in Fiji [21]. 2.8. Immunofluorescence analysis Macrophages were seeded onto Teflon-coated 10 well slides (BD Falcon) followed by the treatments as indicated. Cells were fixed with 4% paraformaldehyde in phosphate-buffered saline (PBS) and permeabilized using 0.2% saponin. After blocking with 5% FBS/BSA in phosphate buffered saline, cells were stained with the primary antibodies as indicated (diluted in Dulbecco’s PBS (D-PBS) containing 5% FBS) for 1 h at room temperature, followed by incubation with AlexaFluor-conjugated secondary antibodies (diluted in D-PBS containing 5% FBS) for 30 min at room temperature. Slides were embedded using Pro-Long antifade (Molecular

3902

S. BoseDasgupta, J. Pieters / FEBS Letters 588 (2014) 3898–3905

Probes), mounted with coverslips and analyzed using a Zeiss LSM510 Meta confocal laser-scanning microscope. For quantitation, 30 cells were analyzed in three separate experiments and the mean ± S.D. is displayed.

transmission electron microscope, operated at an accelerating voltage of 80 kV and at a nominal magnification of 89 000.

2.9. Mycobacterial infection and survival assays

Calcineurin activity was analyzed essentially as described in [8]. Briefly, interferon-c-activated (20 h) macrophages or macrophages expressing either wild-type or coiled-coil-deficient coronin 1 were either kept untreated or infected with M. bovis BCG at an OD600 nm of 0.01 for 3 h. Thereafter, cells were sedimented at 850g for 5 min at 4 °C and washed three times with ice-cold Tris-buffered saline (150 mM NaCl, 20 mM Tris–HCl at pH 7.2). Subsequently, the cell pellet was lysed in lysis buffer (50 mM Tris–HCl, 1 mM DTT, 100 mM EDTA, 100 mM EGTA, 0.2% NP 40 at pH 7.4) containing protease inhibitors. Cytosolic fractions were isolated by centrifugation at 100 000g for 1 h at 4 °C. The cleared supernatants were passed through a P6 DG desalting column to remove free phosphates/nucleotides from the extract. Okadaic acid-resistant and EGTA sensitive, calcineurin activity was carried out for different samples using equal volumes of the phosphate free extract on 96-well plate using equal volumes of cytosol. The 150 lM RII phosphopeptide was used as the standard. Calcineurin-specific phosphate release was measured in the following buffer: 100 mM NaCl, 50 mM Tris, 6 mM MgCl2, 0.5 mM CaCl2, 0.5 mM DTT 0.025% NP-40 at pH 7.5 including 2.5 lM okadaic acid in a total volume of 50 ll. To determine background, the same buffer excluding the RII phosphopeptide was used. After incubating the plates for 30 min at 30 °C the released free phosphate was detected using malachite green by monitoring the absorption at OD620 nm. Using the phosphate standards generated in parallel during the assay, the values were converted to nanomoles of phosphate released. Results were obtained from three independent experiments.

Infection with mycobacteria was carried out as described previously [3]. Initially clumped mycobacteria were removed by centrifuging the mycobacterial culture in 7H9 at 240g for 5 min. Thereafter mycobacteria were pelleted at 2650g rpm for 5 min at 30 °C in a swinging bucket rotor, followed by 3 washes in DMEM and finally diluting it to an OD600 nm of 0.1 for adding it to the cells. Transfected macrophages as indicated were seeded on 10-well glass slides (10 000 cells for immunofluorescence) or 48 well plates (for colony forming unit enumeration, CFU) and incubated with mycobacteria at OD600 nm of 0.1 for 1 h, treated with amikacin (100 lg/ml) in DMEM, washed with DMEM followed by a chase for indicated time points. 2.10. Purification of coronin 1 Purification of coronin 1 was essentially performed as described before [10,14]. Briefly, HEK293 cells or bone marrow macrophages, either non-activated or activated with interferon-c, were washed twice with ice-cold PBS, lysed for 15 min on ice with 5 ml of T-X100 lysis buffer per dish (50 mM Tris–HCl, pH 7.5, 137 mM NaCl, 2 mM EDTA, 1 mM PMSF, 10% glycerol, 1% Triton X-100, 0.05% digitonin along with HALT protease and phosphatase inhibitor (GE healthcare)). Lysates were pooled and centrifuged at 1800g for 5 min at 4 °C. The lysate was passed through a 0.45 lm filter and loaded onto an anti-coronin 1 column (5 ml) prepared by crosslinking anti-coronin 1 rabbit antiserum to NHScoupled sepharose beads (GE healthcare). The column was washed with 100 mM glycine pH 8 followed by elution of the bound coronin 1 with 100 mM glycine pH 3. Fractions were collected (0.5 ml) and immediately neutralized using 1/10 volume of 1 M Tris–HCl, pH 8. Protein concentration was determined using BCA with bovine plasma gamma globulin (BioRad) as a standard and the coronin 1-containing fractions were concentrated followed by buffer exchange using an Amicon centrifuge column (4 ml, 3 kDa cutoff). 2.11. Alkaline phosphatase treatment Coronin 1 (100 lg), purified from resting or interferon-cactivated macrophages were incubated with 50 units of shrimp alkaline phosphatase (Roche) in the supplied phosphatase buffer (100 mM NaCl, 50 mM Tris–HCl, 10 mM MgCl2, 1 mM dithiothreitol pH 7.9) and incubated at 37 °C for 2 h. Thereafter the samples were concentrated in a 0.5 ml 10 kDa cutoff Centricon (Millipore) to carry out a buffer exchange into Hanks Balanced Salt Solution (HBSS, 0.137 M NaCl, 5.4 mM KCl, 0.25 mM Na2HPO4, 1% glucose, 0.44 mM KH2PO4, 1.3 mM CaCl2, 1.0 mM MgSO4, 4.2 mM NaHCO3) by two centrifugation steps at 20 000g for 30 min each. Next the samples were left on ice for 1 h followed by loading onto a sizeexclusion column. 2.12. Specimen preparation and transmission electron microscopy A 5-ll aliquot of affinity-purified coronin 1 complexes (70 lg/ ml) was applied to a weakly glow-discharged carbon coated 400mesh/inch copper grid. The sample was allowed to adsorb for 30 s, washed twice with distilled water, and negatively stained with 0.75% (wt/vol) uranyl formate, pH 4.25, as described previously [22]. Specimens were examined in a Fei Morgaghni 268D

2.13. Calcineurin activity

3. Results 3.1. Expression, localization and oligomerization of coronin 1 lacking the coiled coil in macrophages Coronin 1 is expressed in macrophages where it functions to prevent the delivery of mycobacteria from phagosomes to lysosomes thereby allowing mycobacterial survival [3,8,17]. Coronin 1 forms trimers, and previous work analyzing coronin 1 expressed in human embryonic kidney (HEK293) cells revealed an essential role for the C-terminal coiled coil in coronin 1 trimerization [14]. To analyze a role for the coiled coil in macrophages, J774 cells in which coronin 1 was down regulated using shRNA against coronin 1 (J774-KD; see [17]) were transfected with a cDNA encoding wild type or coronin 1 lacking the coiled coil domain. Both constructs harbored two silent mutations in the shRNA responsive region to render the corresponding mRNA unresponsive to the shRNA (denoted with coronin 1-WT⁄ and coronin 1-DCC⁄ with the * indicating the mutations in the shRNA responsive region; see the Section 2). Transfection of wild type coronin 1 (Cor1-WT⁄) or coronin 1 lacking the coiled coil domain (Cor1-DCC⁄) into J774-KD macrophages followed by cell lysis and analysis of protein expression by SDS–PAGE and immunoblotting revealed efficient expression of both the shRNA unresponsive Cor1-WT⁄ or Cor1-DCC⁄ in J774-KD cells (Fig. 1A, lanes 2 and 3). Furthermore, analysis of the subcellular localization of coronin 1 or coronin 1 lacking the coiled coil region revealed that both Cor1-WT⁄ as well as Cor1DCC⁄ were localized at the cell cortex in addition to a cytoplasmic distribution, as observed before in HEK293 cells (Fig. 1B), [14]. To address the subcellular distribution of wild type coronin 1 and coronin 1 lacking the coiled coil domain biochemically, J774-KD cells

S. BoseDasgupta, J. Pieters / FEBS Letters 588 (2014) 3898–3905

alone or expressing Cor1-WT⁄ or Cor1-DCC⁄ (Fig. 1C and D) were homogenized and separated into a pellet and supernatant fraction corresponding to membrane and cytosol and analyzed by SDS– PAGE and immunoblotting. As shown in Fig. 1C and D, both wild type as well as Cor1-DCC⁄ were predominantly associated with the pellet fraction. Together the immunolocalization and biochemical fractionation results suggest that the absence of the coiled coil domain of coronin 1 is dispensable for its subcellular localization at the cell cortex in macrophages. Previous studies in HEK293 cells had shown that although the coiled coil-deleted coronin 1 localized to the cell cortex, it lost its ability to trimerize and became a monomer. To analyze the importance of the coiled coil domain for coronin 1 oligomerization in macrophages, the oligomeric state of wild type or coiled coil-less coronin 1 was analyzed using size exclusion chromatography. To that end, J774-KD cells expressing wild type or DCC coronin 1 were homogenized, and total homogenates loaded on an S200 size fractionation column (Fig. 1E). Fractions were collected and analyzed using SDS–PAGE and immunoblotting for the presence of coronin 1. As shown in Fig. 1E, while wild type coronin 1, as expected, eluted at a position corresponding to a molecular mass of 160 kDa, coronin 1-DCC eluted at 50 kDa, suggesting that also in macrophages, the coronin 1 C-terminal coiled coil is important for its trimerization. 3.2. Essential role of the coronin 1 coiled coil domain for protection of mycobacteria from lysosomal transfer and killing within macrophages In macrophages, coronin 1 is required to block lysosomal transfer of intracellularly residing mycobacteria thereby allowing survival within phagosomes [3,8]. To analyze whether trimerization was necessary for the activity of coronin 1 to promote mycobacterial survival, wild type coronin 1 (Cor 1-WT⁄) or coronin 1-DCC (Cor1-DCC⁄) were expressed in J774-KD cells followed by infection with mycobacteria expressing the green fluorescent protein for 1 h, washed, and chased for 3 h. Cells were fixed and the mycobacterial localization was analyzed by staining the cells for the lysosomal marker LAMP1. As shown in Fig. 2A–C, as expected, in J774-KD cells expressing wild type coronin 1 the internalized mycobacteria remained outside lysosomes as judged by their localization outside LAMP1 positive structures. In contrast, in macrophages expressing coronin 1-DCC, virtually all internalized mycobacteria colocalized with LAMP1. To analyze the consequences of deleting the coronin 1 coiled coil domain for intracellular survival of mycobacteria, cells expressing either wild type or coiled coil-deleted coronin 1 were infected with mycobacteria for 1 h, followed by a chase for the times indicated in Fig. 2D. At each time point, cells were lysed, and mycobacterial survival was analyzed by colony forming unit enumeration. As shown in Fig. 2D, mycobacteria were able to proliferate in cells expressing wild type coronin 1. In contrast, expression of coronin1-DCC failed to support mycobacterial growth, similar to J774-KD cells transfected with vector alone. These results suggest that the coiled coil domain of coronin 1 is essential for its activity to block lysosomal delivery and sustain the survival of intracellularly residing mycobacteria. 3.3. Induction of coronin 1 monomerization by cytokine-induced phosphorylation Recent studies showed that activation of macrophages that is known to result in mycobacterial death induces phosphorylation of coronin 1 on serine 9, 311, 356 and 412 [16]. Interestingly, in cytokine-activated macrophages, coronin 1 remained associated with macropinosomes harboring mycobacteria, but was not able to prevent lysosomal transfer of the bacilli [16]. To analyze

3903

whether macrophage activation and/or coronin 1 phosphorylation was modulating the oligomeric state of coronin 1, the protein was purified by affinity chromatography from either resting or interferon-c-activated macrophages and subjected to size exclusion chromatography as described above. Analysis of the eluted fractions by SDS–PAGE and immunoblotting for coronin 1, revealed that coronin 1 eluted at a position of 160 kDa in resting macrophages (Fig. 3A, upper panel), consistent with trimerization. Upon macrophage activation, however, the bulk of coronin 1 was retrieved around the 44 kDa marker, suggesting the predominant presence of coronin 1 monomers (Fig. 3A, lower panel). Removal of the phosphates from coronin 1 that had been purified from interferon-c-activated macrophages by incubation with alkaline phosphatase resulted in trimerization of coronin 1, as judged by the relative mobility following size exclusion chromatography (Fig. 3B). To directly analyze whether the interferon-c-induced coronin 1 phosphorylation was responsible for monomerization, J774-KD macrophages were transfected with plasmids encoding either wild type coronin 1 or a serine to alanine (Cor1-S4A⁄) or serine to phosphomimetic glutamic acid mutant (Cor1-S4E⁄) in which the siRNA responsive region was mutated (Fig. 3C). Transfected macrophages were homogenized and protein complexes separated by size exclusion chromatography. Subsequently, the eluted fractions were analyzed by SDS–PAGE and immunoblotted for the presence of coronin 1. As shown in Fig. 3D, while in both resting as well as interferon-c-activated macrophages the serine to alanine coronin 1 mutant eluted as a trimer, the phosphomimetic serine to glutamic acid mutant eluted as a monomer regardless of the activation state of the macrophages. These data suggest that the transition from trimer to monomer is regulated by serine phosphorylation on coronin 1. 3.4. Analysis of coronin 1 oligomerization in resting and activated macrophages by transmission electron microscopy In order to visualize the oligomeric state of coronin 1, coronin 1 was purified from untreated and interferon-c-activated macrophages as well as from HEK293 cells expressing coronin 1 lacking the coiled coil domain. These proteins were then affinity purified as described in Section 2 and analyzed by transmission electron microscopy (Fig. 4). For wild type coronin 1, the distributed particles exhibited a threefold symmetry corresponding to the three monomeric globular domains joined together to form a trefoil-like flexible structure, as observed before [14], with the globular domains likely corresponding to individual b-propeller domains present in the monomers. Analysis of purified coronin 1 lacking the coiled coil domain (Cor1-DCC) failed to show the trefoil-flexible structure instead revealing the globular domains as singular entities. Similarly, coronin 1 purified from interferon-c-activated macrophages also exhibited predominantly single globular structures corresponding to each monomer of coronin 1. This analysis therefore further confirms the monomerization of coronin 1 upon deletion of the coiled coil domain or upon macrophage activation. 3.5. Lack of calcineurin activation upon mycobacterial infection in cells expressing coronin 1-DCC or activated macrophages Coronin 1 is required for the activation of the phosphatase calcineurin upon mycobacterial infection, thereby blocking lysosomal delivery of the internalized bacilli [8]. Given the inability of macrophages expressing either coronin 1 lacking the coiled coil domain, or interferon-c-activated macrophages (that renders coronin 1 monomeric) to protect intracellularly residing mycobacteria, we analyzed whether coronin 1 trimerization was required for calcineurin activation. To this end, J774-KD cells were transfected with

3904

S. BoseDasgupta, J. Pieters / FEBS Letters 588 (2014) 3898–3905

A

capacity to activate calcineurin in order to prevent mycobacterial traffic to lysosomes followed by their degradation. 4. Discussion Coronin 1-WT

B

Coronin 1-WT+ IFNγ

C

Coronin 1-ΔCC

Fig. 4. Transmission electron microscopy of trimeric and monomeric coronin 1. Coronin 1 purified from bone marrow macrophages either untreated (A) or activated with interferon-c-(B) or from HEK293 cells expressing coiled coil deleted coronin 1 (Cor1-DCC⁄) (C) were processed for electron microscopic analysis at 89 000 magnification. Representative images from three independent experiments are provided.

coronin 1 lacking the coiled coil domain (Cor1-DCC⁄), and infected with mycobacteria followed by the determination of calcineurin activity. Basal calcineurin activity was low both in the uninfected wild type or the coiled coil mutant expressing cells (Fig. 5A). While in wild type macrophages expressing full length coronin 1, mycobacterial infection resulted in a drastic increase of calcineurin activity, this was not the case in cells expressing coronin 1 lacking the coiled coil domain (Fig. 5A). Similarly, macrophage activation by interferon-c prior to mycobacterial infection failed to activate calcineurin (Fig. 5B). Together these data suggest that trimerization of coronin 1 is essential for its

1.4

B

**

1.2 Calcineurin activity (nM of Phosphate released)

1.0

1.0 0.8 0.6 0.4 0.2

***

0.8 0.6 0.4 0.2

) (4

0U

CG rin

cin

Ca l

+I 74

eu

IF Nγ 74

+

FN γ+ B

74 +B CG

J7

J7 J7

74

74

-K 74 J7

J7

J7

CG

74

+B

J7

74 J7

D+ ΔC D+ C ΔC C+ Ca BC lci ne G ur in (4 0U )

0

0

-K

Calcineurin activity (nM of Phosphate released)

A

The virulence of mycobacteria is intimately linked to their ability to survive in macrophages. In contrast to most other microbes, that following phagocytosis are normally routed to lysosomes for rapid and efficient degradation, pathogenic mycobacteria have evolved strategies to evade lysosomal delivery [9,23,24]. One of the host factors that is involved in evasion of lysosomal delivery and mycobacterial death is the protein coronin 1. Coronin 1, also known as P57 or TACO (for Tryptophan Aspartate containing Coat protein), is a member of the highly conserved protein family of coronins, and occurs as a trimer in macrophages where it is localized at the cell cortex [14,15]. Upon mycobacterial entry, coronin 1 is recruited to and retained at the phagosomal membrane and prevents lysosomal delivery and killing of mycobacteria through the activation of the Ca2+/calcineurin pathway [1,3,8]. In this work, we show that trimerization of coronin 1 via the coiled coil domain is essential for its activity to promote mycobacterial survival. We found that in cells expressing a coronin 1 mutant lacking the coiled coil domain, mycobacterial entry failed to induce calcineurin activity and mycobacteria were rapidly delivered to lysosomes and killed. We here also show that upon interferon-c activation, coronin 1 was rendered monomeric explaining the inability of mycobacteria to evade lysosomal delivery and killing in interferon-c-activated macrophages. Although coiled coils function as independent protein domains, the results presented here suggest that posttranslational modifications in other parts of the coiled coil domain-containing proteins may influence their oligomeric state. Indeed, the observed monomerization of coronin 1 following interferon-c activation is due to protein kinase C-mediated phosphorylation of serine residues 9, 311, 356 and 412 [16]. Phosphorylation of coronin 1 on these serine residues might result in an alteration in the overall charge of the protein, which in turn could result in an intersubunit steric repulsion, possibly breaking the salt bridge interaction within the coiled coil domain and exposing hydrophobic residues that would impair trimerization [14,15]. In accordance with such a scenario, while a coronin 1 mutant in which the four serines were mutated to alanine maintained the trimeric organization, changing the serine residues to phosphomimetic glutamic acid abrogated trimerization.

Fig. 5. Calcineurin activity. (A, B) Macrophages, either wild type (J774) or (A) coronin 1-deficient (J774-KD) expressing the shRNA resistant coiled coil deleted coronin 1 (Cor1DCC⁄) or (B) upon activation with interferon-c were either kept non-infected or infected with M. bovis BCG, followed by cell lysis and measurement of calcineurin activity from the cell lysates. Asterix (**) indicates P < 0.01 while (***) indicates P < 0.001 between resting and infected macrophages.

S. BoseDasgupta, J. Pieters / FEBS Letters 588 (2014) 3898–3905

Consistent with a requirement of coronin 1-mediated calcineurin activation for promoting mycobacterial survival within macrophages [8], monomeric coronin 1 that was unable to prevent mycobacterial transfer to lysosomes and death failed to induce calcineurin activity, suggesting that trimerization of coronin 1 is a prerequisite for calcineurin activation. The coronin 1-induced activation of calcineurin could have both global as well as local consequences, whereby globally it could be important in dephosphorylating a number of targets involved in phagosome maturation, and locally it may be required to keep coronin 1 in a non-phosphorylated state thereby retaining coronin 1 in a nonphosphorylated, trimeric form at the phagosomal membrane. The advent of drug resistant mycobacteria has resulted in limited possibilities for therapeutic interventions against these pathogens and hence an alternative and effective method may be to target the host proteins crucial for mycobacterial survival [25,26]. Together the work described here provides evidence for an important role of trimerization of the host protein coronin 1 in allowing mycobacterial survival within macrophage phagosomes. Given the detailed understanding of the requirements of the coronin 1 coiled coil domain for trimerization at the molecular level [15], targeting coronin 1 trimerization may provide an effective strategy to induce intramacrophage killing of pathogenic mycobacteria. Peptidomimetics are emerging as new interventions against various diseases [27,28]. Designing an effective peptidomimetic that would hinder the trimerization of coronin 1 may help to overcome the phagosome maturation block and induce mycobacterial killing. Acknowledgements We thank Michael Stiess for comments on the manuscript and Vesna Olivieri of the Center for Microscopy, University of Basel, for expert help with Transmission Electron Microscopy and Timo Glatter and Alexander Schmidt of the Proteomics division for help with Mass Spectrometry. This work was supported by a long term EMBO Fellowship to Somdeb BoseDasgupta, the Optimus Foundation, the Novartis Foundation for Medical-Biological Research, the Canton of Basel and the Swiss National Science Foundation. References [1] Pieters, J., Muller, P. and Jayachandran, R. (2013) On guard: coronin proteins in innate and adaptive immunity. Nat. Rev. Immunol. 13, 510–518. [2] Eckert, C., Hammesfahr, B. and Kollmar, M. (2011) A holistic phylogeny of the coronin gene family reveals an ancient origin of the tandem-coronin, defines a new subfamily, and predicts protein function. BMC Evol. Biol. 11, 268. [3] Ferrari, G., Langen, H., Naito, M. and Pieters, J. (1999) A coat protein on phagosomes involved in the intracellular survival of mycobacteria. Cell 97, 435–447. [4] Houben, E.N., Nguyen, L. and Pieters, J. (2006) Interaction of pathogenic mycobacteria with the host immune system. Curr. Opin. Microbiol. 9, 76–85. [5] Shiow, L.R., Roadcap, D.W., Paris, K., Watson, S.R., Grigorova, I.L., Lebet, T. and Cyster, J.G. (2008) The actin regulator coronin 1A is mutant in a thymic egressdeficient mouse strain and in a patient with severe combined immunodeficiency. Nat. Immunol. 9, 1307–1315.

3905

[6] Mueller, P., Massner, J., Jayachandran, R., Combaluzier, B., Albrecht, I., Gatfield, J. and Pieters, J. (2008) Regulation of T cell survival through coronin-1mediated generation of inositol-1,4,5-trisphosphate and calcium mobilization after T cell receptor triggering. Nat. Immunol. 9, 424–431. [7] Foger, N., Rangell, L., Danilenko, D.M. and Chan, A.C. (2006) Requirement for coronin 1 in T lymphocyte trafficking and cellular homeostasis. Science 313, 839–842. [8] Jayachandran, R., Sundaramurthy, V., Combaluzier, B., Mueller, P., Korf, H., Huygen, K. and Pieters, J. (2007) Survival of mycobacteria in macrophages is mediated by coronin 1-dependent activation of calcineurin. Cell 130, 37–50. [9] Pieters, J. (2008) Mycobacterium tuberculosis and the macrophage: maintaining a balance. Cell Host Microbe 3, 399–407. [10] Jayachandran, R., Liu, X., Bosedasgupta, S., Muller, P., Zhang, C.L., Moshous, D. and Pieters, J. (2014) Coronin 1 regulates cognition and behavior through modulation of cAMP/protein kinase A signaling. PLoS Biol. 12, e1001820. [11] Vinet, A.F., Fiedler, T., Studer, V., Froquet, R., Dardel, A., Cosson, P. and Pieters, J. (2014) Initiation of multicellular differentiation in Dictyostelium discoideum is regulated by coronin A. Mol. Biol. Cell 25, 688–701. [12] Mueller, P., Liu, X. and Pieters, J. (2011) Migration and homeostasis of naive T cells depends on coronin 1-mediated prosurvival signals and not on coronin 1dependent filamentous actin modulation. J. immunol. 186, 4039–4050. [13] Chan, K.T., Creed, S.J. and Bear, J.E. (2011) Unraveling the enigma: progress towards understanding the coronin family of actin regulators. Trends Cell Biol. 21, 481–488. [14] Gatfield, J., Albrecht, I., Zanolari, B., Steinmetz, M.O. and Pieters, J. (2005) Association of the leukocyte plasma membrane with the actin cytoskeleton through coiled coil-mediated trimeric coronin 1 molecules. Mol. Biol. Cell 16, 2786–2798. [15] Kammerer, R.A., Kostrewa, D., Progias, P., Honnappa, S., Avila, D., Lustig, A. and Steinmetz, M.O. (2005) A conserved trimerization motif controls the topology of short coiled coils. Proc. Natl. Acad. Sci. U.S.A. 102, 13891–13896. [16] BoseDasgupta, S. and Pieters, J. (2014) Inflammatory stimuli reprogram macrophage phagocytosis to macropinocytosis for the rapid elimination of pathogens. PLoS Pathog. 10, e1003879. [17] Jayachandran, R., Gatfield, J., Massner, J., Albrecht, I., Zanolari, B. and Pieters, J. (2008) RNA interference in J774 macrophages reveals a role for coronin 1 in mycobacterial trafficking but not in actin-dependent processes. Mol. Biol. Cell 19, 1241–1251. [18] Dhandayuthapani, S., Via, L.E., Thomas, C.A., Horowitz, P.M., Deretic, D. and Deretic, V. (1995) Green fluorescent protein as a marker for gene expression and cell biology of mycobacterial interactions with macrophages. Mol. Microbiol. 17, 901–912. [19] Steinberg, T.H., Swanson, J.A. and Silverstein, S.C. (1988) A prelysosomal compartment sequesters membrane-impermeant fluorescent dyes from the cytoplasmic matrix of J774 macrophages. J. Cell Biol. 107, 887–896. [20] Tulp, A., Verwoerd, D., Dobberstein, B., Ploegh, H.L. and Pieters, J. (1994) Isolation and characterization of the intracellular MHC class II compartment. Nature 369, 120–126. [21] Schindelin, J., Arganda-Carreras, I., Frise, E., Kaynig, V., Longair, M., Pietzsch, T. and Cardona, A. (2012) Fiji: an open-source platform for biological-image analysis. Nat. Methods 9, 676–682. [22] Steinmetz, M.O., Goldie, K.N. and Aebi, U. (1997) A correlative analysis of actin filament assembly, structure, and dynamics. J. Cell Biol. 138, 559–574. [23] Kaufmann, S.H., Cole, S.T., Mizrahi, V., Rubin, E. and Nathan, C. (2005) Mycobacterium tuberculosis and the host response. J. Exp. Med. 201, 1693– 1697. [24] Cosma, C.L., Sherman, D.R. and Ramakrishnan, L. (2003) The secret lives of the pathogenic mycobacteria. Annu. Rev. Microbiol. 57, 641–676. [25] Zumla, A., Nahid, P. and Cole, S.T. (2013) Advances in the development of new tuberculosis drugs and treatment regimens. Nat. Rev. Drug Discov. 12, 388– 404. [26] Warner, D.F. and Mizrahi, V. (2007) The survival kit of mycobacterium tuberculosis. Nat. Med. 13, 282–284. [27] Gorovoy, A.S., Gozhina, O.V., Svendsen, J.S., Domorad, A.A., Tetz, G.V., Tetz, V.V. and Lejon, T. (2013) Boron-containing peptidomimetics – a novel class of selective anti-tubercular drugs. Chem. Biol. Drug Des. 81, 408–413. [28] Qiu, X. and Liu, Z.P. (2011) Recent developments of peptidomimetic HIV-1 protease inhibitors. Curr. Med. Chem. 18, 4513–4537.