224
Journal of Hepatology, 1992; 16:224-227 © 1992 Elsevier Scientific Publishers Ireland Ltd. All rights reserved. 0168-8278/92/$05.00
H EPAT 01249
Rapid Publication
Comparison of pre-core/core hepatitis B virus region in liver tissue and serum from patients with chronic hepatitis B infection Andrew M. Ackrill, Nikolai V. N a o u m o v , Adrian L.W.F. E d d l e s t o n and Roger Williams Institute of Liver Studies, King's College School of Medicine and Dentistry, London, United Kingdom
We examined the relationship between HBV-DNA isolated from the liver and from the serum in patients with various serological characteristics of chronic hepatitis B infection. Amplification and direct sequencing of the HBV pre-core/ core region was carried out in 9 patients who were seropositive for HBsAg and HBV-DNA-4 HBeAg positive and 5 anti-HBe positive. Complete sequence identity was observed between HBV-DNA isolated from the serum and the liver in individual patients. In addition, shortened forms of the HBV core ORF were detected in patients with chronic active hepatitis, but not in patients with chronic persistent hepatitis.
Key words: Hepatitis B virus; PCR; DNA sequencing; Pre-core/core mutants
Chronic Hepatitis B virus (HBV) infection comprises two distinct serological phases: HBeAg- and anti-HBepositive. HBeAg-positive carriers almost invariably have ongoing virus replication and there is an inverse relationship between the serum level of HBV-DNA and the degree of liver damage, since patients with high levels of viral DNA in serum have minimal liver changes or chronic persistent hepatitis (CPH), while those with histologically more progressive chronic active hepatitis (CAH) have lower serum HBV-DNA (1). In contrast, detection of HBV-DNA in the liver by in situ hybridisation showed that CAH is associated with an accumulation of cytoplasmic HBV-DNA and HBcAg in hepatocytes, while in patients with CPH the cytoplasmic expression of these viral markers is weaker or not detectable (2,3). Recently, a genomic variant of HBV responsible for anti-HBe-positive chronic hepatitis B was identified and it was shown that these patients were infected with precore mutant HBV alone or with a mixture of this virus and wild-type HBV (4,5). Pre-core variants usually emerge during or after seroconversion to anti-HBe and this selection seems to occur even in patients who become asymptomatic carriers (5). Liver damage appears to depend on the degree of virus replication, as well as the type of HBV strains (6). These studies are based on
the characterisation of HBV-DNA extracted from serum rather than from the liver, presumably for reasons of convenience, and it is not known how accurately they reflect the type of HBV strains present in liver tissue in these patients. To our knowledge no attempt has been made to address the question of whether extrapolation of genomic variation analysis of HBV-DNA from serum to liver is valid. The aim of the present study was to examine the relationship between the pre-core/core region of HBV isolated from the liver with that from the serum of patients with various serological characteristics of chronic hepatitis B.
Materials and Methods
Nine chronic HBsAg carriers with histologically proven chronic liver disease were selected as follows: (a) 4 HBeAg +ve - - serum HBeAg and HBV-DNA positive. Two patients with CPH, 2 patients with CAH. (b) 5 anti-HBe + ve - - serum anti-HBe and HBV-DNA positive. Three patients with CAH (one of whom also had cirrhosis) shown to be infected with a pure pre-core mutant HBV in serum previously (6), and 2 patients
Correspondence to: Roger Williams, Institute of Liver Studies, King's College of Medicine and Dentistry, Bessemer Road, London SE5 9PJ, U.K.
225
COMPARISON OF HBV IN SERUM AND LIVER
with CAH (both with cirrhosis) shown to be infected with a mixture of wild-type and pre-core mutant HBV previously (6). Serum and percutaneous liver biopsy from each patient were obtained on the same day, or within 6 months in 3 of the cases. All patients were human immunodeficiency virus and hepatitis C virus seronegative as determined by enzyme-linked immunosorbent assays and were hepatitis delta virus antigen negative in liver. HBsAg and HBeAg/anti-HBe were tested using a commercially available radioimmunoassay (Abbott, Chicago, IL, U.S.A.). Serum HBV-DNA was tested by a commercially available kit (Genostics, Abbott).
Isolation of DNA DNA was extracted from serum and liver samples from each patient studied. One hundred microlitres serum was added to 125 #1 of PK buffer (0.25 mg/ml proteinase K, 0.25% sodium dodecyl sulphate, 5 mM EDTA, 10 mM Tris-HC1, pH 8.0) and incubated at 56 °C for 2 h. The DNA was extracted twice with phenol chloroform isoamyl alcohol (50:50: 1), once with chloroform alone and then precipitated with ethanol. Paraffinembedded tissue sections (10/~m) were processed as described previously (7), but using xylene to remove paraffin and further purifying the DNA by phenol extraction as described for serum DNA. Polymerase chain reaction ( PCR ) amplification and sequencing of HB V-DNA Pre-core/core sequences were amplified from serum or tissue DNA using oligonucleotide primers AA2 (5'GCCTCCAAGCTGTGCCTTGG 3'; nucleotide (nt) position 1868-1887) and AA3 (5'GATAGGGGCATTTGGTGGTCT3'; nt-positions 2317-2297). Amplification was performed using 20 pmol of each primer, 0.2 mM each dNTP, 2.5 U Taq polymerase (Promega) in a solution of l x Taq polymerase buffer (Promega). Reactions were cycled 30 times (serum) or 40 times (tissue) with l min of denaturation at 95°C, l min of annealing at 56 °C and 2 min of extension at 72°C in a DNA thermal cycler (Perkin-Elmer Cetus). Reaction products were fractionated by 3% NuSieve agarose (FMC BioProducts) electrophoresis and the DNA was visualised using ethidium bromide. To prevent contamination, the isolation of DNA and the subsequent assembly of amplification reactions was carried out in a laminar flow cabinet using positive displacement pipettes (Labsystems). Amplified DNA was directly sequenced (both strands) by the dideoxynucleotide chain termination method (fmol sequencing kit, Promega)
using 32p end-labelled primers (AA2 and AA3). Excess primers and nucleotides were removed prior to sequencing using Magic PCR Preps DNA purification columns (Promega). Results
An HBV-DNA product of the expected size (449 bp) was successfully amplified from all liver and serum samples tested by PCR. Direct sequencing of the DNA confirmed that the products were derived from the precore/core region of the virus. Four patients, seropositive for HBeAg (CPH-2 and CAH-2), were infected with the pure wild-type HBV. As expected, among the 5 antiHBe seropositive patients 2 were infected with a mixture of HBV wild-type and pre-core mutant (with a stop codon at position 1896) and 3 patients were infected with the pre-core mutant HBV only. Comparison of the complete sequences of these products, isolated from both serum and liver of patients studied, demonstrated that at nucleotide position 1896 the presence of a wild-type (G), mutant (A) or mixed (G/A) base in the serumderived DNA mirrors the DNA isolated from the liver of the same patient. Furthermore, an absolute correlation in terms of nucleotide sequence was observed between liver and serum for the whole of the 449 bp amplification product (Fig. 1). A marked difference in the amplification products was noted when both tissue and serum samples from patients with chronic persistent hepatitis were compared with those from the patients with chronic active hepatitis. In the CPH samples a single PCR product of 449 bp was observed, whereas samples from patients with CAH gave bands in addition to this full-length product (Fig. 2). These additional products were shorter than 449 bp (by about ~
Journal of Hepatology, 1992; 16:224-227 © 1992 Elsevier Scientific Publishers Ireland Ltd. All rights reserved. 0168-8278/92/$05.00
H EPAT 01249
Rapid Publication
Comparison of pre-core/core hepatitis B virus region in liver tissue and serum from patients with chronic hepatitis B infection Andrew M. Ackrill, Nikolai V. N a o u m o v , Adrian L.W.F. E d d l e s t o n and Roger Williams Institute of Liver Studies, King's College School of Medicine and Dentistry, London, United Kingdom
We examined the relationship between HBV-DNA isolated from the liver and from the serum in patients with various serological characteristics of chronic hepatitis B infection. Amplification and direct sequencing of the HBV pre-core/ core region was carried out in 9 patients who were seropositive for HBsAg and HBV-DNA-4 HBeAg positive and 5 anti-HBe positive. Complete sequence identity was observed between HBV-DNA isolated from the serum and the liver in individual patients. In addition, shortened forms of the HBV core ORF were detected in patients with chronic active hepatitis, but not in patients with chronic persistent hepatitis.
Key words: Hepatitis B virus; PCR; DNA sequencing; Pre-core/core mutants
Chronic Hepatitis B virus (HBV) infection comprises two distinct serological phases: HBeAg- and anti-HBepositive. HBeAg-positive carriers almost invariably have ongoing virus replication and there is an inverse relationship between the serum level of HBV-DNA and the degree of liver damage, since patients with high levels of viral DNA in serum have minimal liver changes or chronic persistent hepatitis (CPH), while those with histologically more progressive chronic active hepatitis (CAH) have lower serum HBV-DNA (1). In contrast, detection of HBV-DNA in the liver by in situ hybridisation showed that CAH is associated with an accumulation of cytoplasmic HBV-DNA and HBcAg in hepatocytes, while in patients with CPH the cytoplasmic expression of these viral markers is weaker or not detectable (2,3). Recently, a genomic variant of HBV responsible for anti-HBe-positive chronic hepatitis B was identified and it was shown that these patients were infected with precore mutant HBV alone or with a mixture of this virus and wild-type HBV (4,5). Pre-core variants usually emerge during or after seroconversion to anti-HBe and this selection seems to occur even in patients who become asymptomatic carriers (5). Liver damage appears to depend on the degree of virus replication, as well as the type of HBV strains (6). These studies are based on
the characterisation of HBV-DNA extracted from serum rather than from the liver, presumably for reasons of convenience, and it is not known how accurately they reflect the type of HBV strains present in liver tissue in these patients. To our knowledge no attempt has been made to address the question of whether extrapolation of genomic variation analysis of HBV-DNA from serum to liver is valid. The aim of the present study was to examine the relationship between the pre-core/core region of HBV isolated from the liver with that from the serum of patients with various serological characteristics of chronic hepatitis B.
Materials and Methods
Nine chronic HBsAg carriers with histologically proven chronic liver disease were selected as follows: (a) 4 HBeAg +ve - - serum HBeAg and HBV-DNA positive. Two patients with CPH, 2 patients with CAH. (b) 5 anti-HBe + ve - - serum anti-HBe and HBV-DNA positive. Three patients with CAH (one of whom also had cirrhosis) shown to be infected with a pure pre-core mutant HBV in serum previously (6), and 2 patients
Correspondence to: Roger Williams, Institute of Liver Studies, King's College of Medicine and Dentistry, Bessemer Road, London SE5 9PJ, U.K.
225
COMPARISON OF HBV IN SERUM AND LIVER
with CAH (both with cirrhosis) shown to be infected with a mixture of wild-type and pre-core mutant HBV previously (6). Serum and percutaneous liver biopsy from each patient were obtained on the same day, or within 6 months in 3 of the cases. All patients were human immunodeficiency virus and hepatitis C virus seronegative as determined by enzyme-linked immunosorbent assays and were hepatitis delta virus antigen negative in liver. HBsAg and HBeAg/anti-HBe were tested using a commercially available radioimmunoassay (Abbott, Chicago, IL, U.S.A.). Serum HBV-DNA was tested by a commercially available kit (Genostics, Abbott).
Isolation of DNA DNA was extracted from serum and liver samples from each patient studied. One hundred microlitres serum was added to 125 #1 of PK buffer (0.25 mg/ml proteinase K, 0.25% sodium dodecyl sulphate, 5 mM EDTA, 10 mM Tris-HC1, pH 8.0) and incubated at 56 °C for 2 h. The DNA was extracted twice with phenol chloroform isoamyl alcohol (50:50: 1), once with chloroform alone and then precipitated with ethanol. Paraffinembedded tissue sections (10/~m) were processed as described previously (7), but using xylene to remove paraffin and further purifying the DNA by phenol extraction as described for serum DNA. Polymerase chain reaction ( PCR ) amplification and sequencing of HB V-DNA Pre-core/core sequences were amplified from serum or tissue DNA using oligonucleotide primers AA2 (5'GCCTCCAAGCTGTGCCTTGG 3'; nucleotide (nt) position 1868-1887) and AA3 (5'GATAGGGGCATTTGGTGGTCT3'; nt-positions 2317-2297). Amplification was performed using 20 pmol of each primer, 0.2 mM each dNTP, 2.5 U Taq polymerase (Promega) in a solution of l x Taq polymerase buffer (Promega). Reactions were cycled 30 times (serum) or 40 times (tissue) with l min of denaturation at 95°C, l min of annealing at 56 °C and 2 min of extension at 72°C in a DNA thermal cycler (Perkin-Elmer Cetus). Reaction products were fractionated by 3% NuSieve agarose (FMC BioProducts) electrophoresis and the DNA was visualised using ethidium bromide. To prevent contamination, the isolation of DNA and the subsequent assembly of amplification reactions was carried out in a laminar flow cabinet using positive displacement pipettes (Labsystems). Amplified DNA was directly sequenced (both strands) by the dideoxynucleotide chain termination method (fmol sequencing kit, Promega)
using 32p end-labelled primers (AA2 and AA3). Excess primers and nucleotides were removed prior to sequencing using Magic PCR Preps DNA purification columns (Promega). Results
An HBV-DNA product of the expected size (449 bp) was successfully amplified from all liver and serum samples tested by PCR. Direct sequencing of the DNA confirmed that the products were derived from the precore/core region of the virus. Four patients, seropositive for HBeAg (CPH-2 and CAH-2), were infected with the pure wild-type HBV. As expected, among the 5 antiHBe seropositive patients 2 were infected with a mixture of HBV wild-type and pre-core mutant (with a stop codon at position 1896) and 3 patients were infected with the pre-core mutant HBV only. Comparison of the complete sequences of these products, isolated from both serum and liver of patients studied, demonstrated that at nucleotide position 1896 the presence of a wild-type (G), mutant (A) or mixed (G/A) base in the serumderived DNA mirrors the DNA isolated from the liver of the same patient. Furthermore, an absolute correlation in terms of nucleotide sequence was observed between liver and serum for the whole of the 449 bp amplification product (Fig. 1). A marked difference in the amplification products was noted when both tissue and serum samples from patients with chronic persistent hepatitis were compared with those from the patients with chronic active hepatitis. In the CPH samples a single PCR product of 449 bp was observed, whereas samples from patients with CAH gave bands in addition to this full-length product (Fig. 2). These additional products were shorter than 449 bp (by about ~
