JOURNAL OF CELLULAR PHYSIOLOGY 1483174-189 (1991)

Coordination of Protein-DNA Interactions in the Promoters of Human H4, H3, and H1 Histone Genes During the Cell Cycle, Tumorigenesis, and Development ANDRE J. VAN WIJNEN,THOMAS A. OWEN, JOOST HOLTHUIS, JANE B. MAN, JANET 1. STEIN, AND GARY S. STEIN Department of Cell Biology, University of Massachusetts Medical Center, Worcester, Massachusetts 0 I655 Coordinate transcriptional control of replication-dependent human H4, H3, and H I histone genes was studied by comparing levels of H3 and H1 histone promoter binding activities with those of H 4 histone promoter factor HiNF-D during the cell cycle of both normal diploid and tumor-derived cells, as well as in fetal and adult mammalian tissues. Both H3 and H1 histone promoters interact with binding activities that, as with HiNF-D, are maximal during S-phase but at low levels in the G1-phase of normal diploid cells. However, these analogous DNA binding activities are constitutively maintained at high levels throughout the cell cycle in four different transformed and tumor-derived cells. Downregulation of the H3 and H1 histone promoter factors in conjunction with HiNF-D is observed in vivo at the onset of quiescence and differentiation during hepatic development. Hence, our results indicate a tight temporal coupling of three separate protein-DNA interactions in different histone promoters during the cell cycle, development, and tumorigenesis. This suggests that a key oscillatory, cell-growth-control mechanism modulates three analogous histone gene promoter protein-DNA interactions in concert. The derangement of this mechanism in four distinct tumor cells implies that concerted deregulation of these histone promoter factors is a common event resulting from heterogeneous aberrations in normal cell growth mechanisms during tumorigenesis. We postulate that this mechanism may be involved in the coordinate regulation of the human H4, H3, and H1 histone multigene families.

Proliferating human cells progressing through Sphase of the cell cycle synthesize high amounts of a set of five distinct histone proteins (H4, H3, H2A, H2B, and Hl). The five human replication-dependent histone protein subtypes are each encoded by multiple copies of related enes (Lichtler, 1982) resent in irregularly arrange clusters (Heintz et a[, 1981; Sierra et al., 1982; Carozzi et al., 19841, located on multiple chromosomes (Green et al., 1984; Triputti et al., 1986). The coordinate synthesis of histone proteins (re-evaluated by Marashi et al., 1982) is temporally and functionally coupled to histone mRNA levels, the extent of DNA synthesis and the packaging of newly replicated DNA into chromatin. The tight coupling between these parameters depends on transcriptional and posttranscriptional mechanisms that influence histone gene expression, with transcription rates of these genes increasing at the GUS-phase boundary (reviewed in Stein et al., 1984a,b;Schumperli, 1986;Marzluff and Pandey, 1988; Stein et al., 1989a). Human histone ene transcription is downregulated at the shutdown o roliferation and the onset of both differentiation (Col art et al., 1988; Stein et al., 1989b; Shalhoub et al., 1989; Larson et al., 1989; Owen et al., 1990a)and quiescence (Wright et al., 1990a). The mechanism by which dividing cells strin-

f

Bp

D 1991WILEY-LISS, INC.

gently control the coordinate expression of these histone multigene families during progress through and exit from the cell cycle is fundamental to normal cell growth regulation and development. Histone gene romoters contain transcriptional elements that me late the selectivity and efficiency of histone gene expression (Sierra et al., 1983; Hanly et al., 1985;Artishevsky et al., 1987;Helms et al., 1987; Kroeger et al., 1987; Dalton and Wells, 1988a; LaBella et al., 1988; Hwang and Chae, 1989; Wright et al., 1990b), and some of these elements function as in vivo protein-DNA interaction sites (Pauli et al., 1987,1989). Several DNA binding proteins interacting with histone promoter elements in vitro have been characterized. Some of these activities are either related or identical to general transcription factors (for reviews see Mitchell and Tjian, 1989; Wingender, 1990), such as AP-1 (Sharma et al., 1989), Spl (van Wijnen et al., 1989; Lee et al., 1991), CPliCP2 (van Wijnen et al., 1988a,b; Gallinari et al., 19891, OTF (Fletcher et al., 19871, and ATF (Wright et al., 1990b). Additionally, apparent histone specific factors have been described, such as

b!

Received November 29, 1990; accepted April 1, 1991.

175

INTERACTIONS IN HISTONE GENE PROMOTERS

Hl-SF (Dalton and Wells, 1988b), H4-TF2 (Dailey et al., 19881, and HiNF-D (van Wijnen et al., 1989). Together, these studies suggest that the regulation conferred by each histone gene promoter involves a complex interplay of both ubiquitous transcription factors and factors binding to histone promoter-specific elements. Despite insight into the transcriptional regulation of individual histone genes of various mammalian species, it remains unresolved at which level coordinate transcri tional regulation of five different histone multigene amilies is mediated. Studies on the cell cycle regulation of H4 (Dailey et al., 1988; van Wijnen et al., 19891, H3 (Artishevsky et al., 19871, H2B (LaBella, 19891, and H1 (Dalton and Wells, 198813; Gallinari et al., 1989) histone gene transcription have led to the hypothesis that each histone gene subtype is regulated by distinct, corres onding subtype s ecific transcription factors, and t ese factors are sul!ject to different modes of re ulation (see Discussion). This hypothesis implies a igh degree of complexity in the temporal regulation of histone promoter factors in order to coordinate transcription rates during progression through and exit from the cell cycle. The H4 histone promoter factor HiNF-D is involved in the regulation of histone gene transcription (van Wijnen et al., 1989). The binding site of HiNF-D in the H4-F0108 histone gene has been established at single nucleotide resolution by several techniques, including methylation interference, competition, and deletion analysis, and is an element of a multipartite protein/ DNA interaction domain (van Wijnen et al., 1991b). The HiNF-D binding site coincides with in vivo protein/ DNA interaction domain H4-Site I1 located in the proximal promoter of this H4 histone gene (Pauli et al., 1987).The in vivo occupancy of H4-Site I1 and presence of HiNF-D in nuclear extracts correlate with H4 histone gene transcription during the shutdown of proliferation and onset of differentiation (Stein et al., 198913; van Wijnen et al., 1989). Interestingly, we also observed that H3-Site 11, the analogous region in the H3 histone gene promoter (Pauli et al., 1989), interacts with a proliferation-specific factor (HiNF-D3) that is downregulated in conjunction with HiNF-D during this process (Stein et al., 198913). This suggests that the HiNF-D:H4-Site I1 interaction is a component of a coordinate transcriptional control mechanism. Site-directed mutagenesis studies have been performed with constructs containing specific deletions or point mutations in the H4 histone proximal H4-Site 11. This approach included a parallel analysis, both in vitro and in vivo, of several different transcription and DNA binding assays (Kroeger et al., 1987; Pauli et al., 1987; Stein et al., 1989b; van Wijnen et al., 1989, 1991a,b; Wright et al., 1991b; A. L. Ramsey-Ewing, AJvW, GS, JS, unpublished data.) The combined results of these studies strongly suggest that the HiNFD:H4-Site I1 roteidDNA interaction is an integral constituent o the mechanism mediating cell cycle regulation of H4 histone gene transcription. However, in our current transcriptional model of the H4-F0108 histone gene, this interaction occurs within the context of at least four other auxiliary proteiniDNA interactions in the proximal promoter (van Wijnen et al., 1991;

P

i

a

f

Wright et al., 1991b; A. L. Ramsey-Ewing, AJvW, GS,

JS, unpublished data).

HiNF-D DNA bindin activity is modulated during the cell cycle in norma diploid cells (Holthuis et al., 1990), whereas this activity is constitutive in tumor derived and transformed cells (van Wijnen et al., 1989; Holthuis et al., 1990). Alterations in HiNF-D binding activity have also been observed at the onset of quiescence (Wright et al., 1990a) and differentiation in cell culture models (Owen et al., 1990a; Stein et al., 1990b). Recently, we have shown that HiNF-D is also downregulated in vivo during hepatic development in transgenic mice coinciding with the downregulation of H4 histone gene transcription (as measured by reporter gene expression) (van Wijnen et al., 1991a).Thus these studies have established a number of experimental systems in which we have correlated several biochemical parameters, including histone mRNA levels, transcription, and proteiniDNA interactions, during several distinct biological processes where histone gene expression appears to be regulated. Based on these experimental systems and the multiple sequence-specific proteiniDNA interactions involved in transcriptional regulation of the H4-F0108 histone gene, we focus in this work on analogous proteiniDNA interactions in H3 and H1 histone promoters. We assess binding activities of H3 and H1 histone promoter factors during the cell cycle of both normal diploid cells and tumor derived and transformed cells, as well as during hepatic development, reflecting the onset of quiescence and differentiation in the intact animal. The results show that parallel modulations occur in protein-DNA interactions, directly at the level of DNA binding activity, in three distinct H4, H3, and H1 histone genes during the cell cycle, development, and tumorigenesis. This suggests that these proteiniDNA interactions are subject to a key cell growth control mechanism that coordinately regulates protein/DNA interactions of the H4, H3, and H1 histone multigene families. Our results also indicate that two analogous and cell cycle regulated proteiniDNA interactions of H4 and H3 histone enes involve a similar DNA binding activity. This actor may be an important component of a shared cell cycle control mechanism.

Y

f

MATERIALS AND METHODS DNA fragments and synthetic oligonucleotides The nucleotide numbers of each DNA fragment are measured from the ATG translational start codon of the corresponding gene, conforming to the numbering of published histone ene promoter sequences (Wells, 1986; Wells and cBride, 1989). The radiolabelled DNA fragment used as a reference for HiNF-D activity in cell cycle experiments encompasses the proximal promoter region of the H4 (F0108) histone ene (spanning nt -130 to -38; cap-site at nt -30) an is derived from pFP-1 (van Wijnen et al., 1989). The remaining experiments using the H4 histone gene promoter were performed with the EcoRIiHindIII fragment of pFP201 (spanning nt -97 to -38). Plasmid FP201 was constructed by deletion of the 0.15 kB NaeI/SmaI fragment in pFP-1 followed by self-ligation of the remainder of

If

!

176

VAN WIJNEN ET AL

the plasmid in the presence of a BamHI linker (5'dCCGGATCCGG). The H3 (ST519) histone promoter probe was derived from pTP-1 by HindIIIiBstNI cleavage (nt - 142 to - 13; cap-site at nt -36). Plasmid TP-1 was constructed from pSPH3 (Zambetti et al., 1987) and consists of the HpaIiHindIII fragment of pST519 (nt -200 t o - 13) and the HindIIIiSmaI vector fragment of pUC8. The probe spanning the H1 (FNC16) histone gene promoter (nt -223 to -78; cap-site at nt -58) was prepared by HindIIIiRsaI digestion of pox001 (van Wijnen et al., 1988a). Oligonucleotides used for competition assays span portions of in vivo protein-DNA interaction domains in the H4 and H3 histone promoters (Pauli et al., 1987, 1989). Oligonucleotide H4-11 (HiNF-D oligonucleotide; nt -91 to -64) and DD-1 (HiNF-M oligonucleotide; duplication of nt - 93 to - 80) span sequences of H4-Site I1 and coincide, respectively, with the binding sites of human H4 histone gene promoter factors HiNF-D and HiNF-M (van Wijnen et al., 1991b). Oligonucleotide H3-I1 (nt -138 to -112) spans the distal CCAAT-box sequence present in H3-Site 11,which is very similar to the binding site of H1 CCAAT-box binding protein HiNF-B (van Wijnen et al., 1988a). Oligonucleotide H4-I encompasses an ATF-like binding site in the H4 histone promoter and is used as a nonspecific control in some experiments. The sequences of these synthetic DNA fragments are as follows: H4-1I:S'dCTRGCTTTCGGTTTTCRRTCTGGTCCGATACT 3' dGAAAGCCAAARGTTAGACCAGGCTATGAGATC D D - 1 :S'dGRTCCGCTTTCGGTTTTCGCGCTTTCGGTTTTCT 3' GCGARAGCC~AAAGCGCGAAAGCCARAAGACTAG.

H3-II:S'dGATCTGCACAGAGATGGACCAATCCAAGARGAAGGG 3'

ACGTGTCTCTACCTGGTTAGGTTCTTCTTCCCCTAG

H4-I : S ' d G A T C C G G A R A A G A A A T G ~ C G A A A T G T C G A G A 3' GCCTTTTCTTTACTGCTTTACAGCTCTCTAG

Nuclear protein preparations Cell cycle sta e specific nuclear extracts (Holthuis et al., 1990)usec fin el retardation assays were derived from human HeLa 83, HL60, and WI-38 cells, and rat osteoblast and osteosarcoma cells, that were synchronized by multiple procedures. Nuclear extracts and chromatogra hy fractions from ex onentially growing HeLa S3 cel s were prepared as escribed previously (van Wijnen et al., 1989,1991b).Protein concentrations were quantitated by Bradford analysis (Biorad) and were corrected for the distinct nonlinearity in dye responsiveness of nuclear proteins. Protein samples were maintained in the presence of a protease inhibitor cocktail (see below) to prevent proteolytic cleavage. Quantitation of protein concentrations and the overall integrity of protein preparations was examined by SDSiPAGE. The preparation of nuclear extracts from mouse tissues involved mechanical homogenization in solution A (10 ml; 0.32 M sucrose [= 11%wivl, 0.01% Triton X-100,5 mM Hepes, pH 7.5). Tissue homogenates were diluted by adding 20 ml solution A and carefully layered over 10 ml solution B (2.1 M sucrose [= 72% wivl, 5 mM Hepes, pH 7.5) and nuclei were recovered as a pellet after centrifugation (Beckman SW28 rotor, 13.000rpm, 45 minutes, 4°C).Nuclei were washed with 5 ml solution C (0.25 M sucrose [= 8.6% wivl, 5 mM

P

B

Hepes, pH 7.5) and recovered by centrifugation (IEC, 1500 rpm, 5 minutes, 4°C). After repeating this step, nuclei were inspected and counted by lightmicroscopy, and extracted with solution D (25% [viv] glycerol, 0.42 M KC1, 0.2 mM EDTA, 25 mM Hepes, pH 7.5) in a 1.5 ml microcentrifuge tube using approximately 0.5 ml per 1 x lo8 nuclei. Nuclei were removed by microcentrifugation at 10,000 rpm for 10 minutes at 4°C. Nuclear extracts were desalted by 3-fold dilution with storage buffer without KC1 (20%glycerol, 0.01% NP40, 0.2 mM EDTA, 25 mM Hepes, pH 7.5) and concentrated to the original volume by ultra-filtration centrifu ation (Amicon) at 6,000 rpm (Beckman 5-20]. All so utions contained 0.75 mM s ermidine, 0.15 mM spermine, 1 mM DTT, and a COC tail of protease inhibitors (PMSF, leupeptin, pepstatin, TPCK, and trypsin inhibitor; Boehringer) at the concentrations recommended by the supplier. Gel retardation assays Binding reactions were performed in diluted storage buffer (10% glycerol, 50 mM KC1, 0.005% NP40, 0.1 mM EDTA, 1mM DTT, and 12.5 mM He esiNaOH, pH 7.5). Probes were prepared by 5'end-la elling of the DNA fragments mentioned above using calf intestine alkaline phosphataseiT4 kinase and approximately 0.5 n DNA was included in a binding reaction of 20 p1. T ! e nonspecific competitor DNA used was 2 pg poly (dG-dC)*poly (dG-dC) (= poly GIC DNA), 200 ng poly (dI-dC)*poly(dI-dC) (=poly IiC DNA), unless indicated otherwise. Deletion analysis in combination with the gel retardation assa , abbreviated stairwa assay, was performed as descri ed previously (van ijnen et al., l987,1988a, 1989). Electrophoresis was performed using low ionic strength conditions (1 mM EDTA, 3.3 mM sodium acetate, 6.6 mM TrisiHC1, pH 7.9; = "LIS-buffer") in a buffer-cooled electrophoresis unit (Hoefer) linked to a waterbath maintained at 4". Buffers in the anode- and cathode-chambers were circulated and mixed in the lower buffer tank using an electromagnetic stirrer. Polyacrylamide gels were prepared from a deaerated 4% acrylamide working solution containing an 80:1 ratio of acrylamide: bis-acrylamide and electrophoresed for 2.5 hours at 200 V. Glycerol containing samples without trackin -dye were loaded with minimal disturbance of the yceroliwater interphase, and the gels electrophorese for 2.5 hour at 200 V. Saranwrap covered gels were dried on blotting paper (BioRad) for 1 hour at 90°C and (after removal of the saran-wrap) subjected to autoradiography. RNA isolation and analysis Adult and fetal mice were sacrificed, respectively, by cervical dislocation or decapitation. Selected tissues were isolated and quickly frozen in liquid nitrogen. Tissue samples were disrupted for 30 to 60 seconds in 2 ml of solution A using a Brinkmann polytron equipped with a 7 mm probe. Tissue debris and nuclei were removed by micro-centrifugation for 30 seconds and the supernatants recovered. Samples were precipitated overnight at 4°C by the addition of 2 volumes of a solution containing 3 M LiCl and 6 M urea and were subject to centrifugation at 4,000 rpm in a JA-6 centri-

K

R

\

WY.

B

d

177

INTERACTIONS IN HISTONE GENE PROMOTERS

fuge (Beckman) for 45 minutes at 4°C. The precipitates were washed with 2 ml of isolation buffer and centrifugation was repeated. The resulting pellets were resuspended in 0.7 ml of proteinase buffer (50 pgiml Proteinase K, 0.5% SDS, 50 mM Tris, pH 7.51, and incubated for 15 minutes at 37°C. Solutions were extracted twice with unequilibrated (pH 5.5) pheno1:chloroform (2:l) and once with chloroform, and RNA was precipitated using two volumes of ethanol. The RNA pellets were dried in a Speed-vac concentrator (Savant Instruments), resuspended in H20 and stored at -70°C. RNA analysis by Northern blotting was performed as described in detail previously (Owen et al., 1990b). The DNA probe used for hybridization was a rat H4 histone gene (Grimes et al., 1987).

RESULTS We have previously studied the transcriptional regulation of histone genes by measuring expression parameters of the cloned H4-F0108, H3-ST519, and H1FNC16 histone genes (e.g., Marashi et al., 1986; Kroeger et al., 1987; Collart et al., 1989; Wright et al., 1991b;A.L. Ramsey-Ewing, AJvW, GS and JS, unpublished data). Subsequently, we established sites of protein-DNA interaction in these three prototypical, cell cycle regulated human H4, H3, and H1 histone genes both in vivo (Pauli et al., 1987,1989) and in vitro (van Wijnen et al., 1987, 1988a, 1989, 1991b). H4 and H3 histone gene promoters each have been shown to contain two sites of in vivo protein-DNA interactions, Site I (distal) and Site I1 ( roximal). Probe fragments used in our assays are {erived from the proximal promoters of H4, H3, and H1 histone genes and include analogous in vivo proteiniDNA interaction domains (Fig. la). Initially, we performed deletion analysis (stairway assays) of these promoter regions to provide evidence for sequence-specificity of proteiniDNA interactions detected in vitro (Fig. lb). Stairway assays analyze binding events in parallel to a set of large DNA fragments (labelled at the same terminus) that have been progressively shortened by endonuclease cleavage. Loss of binding upon deletion of certain DNA segments establishes maximal boundaries of DNA binding sites at predetermined positions (i.e., endonuclease cleavage sites), thereby providing direct evidence for sequence-specificity albeit at a modest level of resolution in nucleotides. The validity of this approach has been demonstrated by comparison with data obtained using other approaches, including DNaseI footprinting, DMS fingerprinting, methylation interference, competition analysis, and/or binding site mutagenesis studies for at least six other DNA binding proteins (HiNF-A, HiNF-B, HiNF-C, HiNF-D, HiNF-M and NMP-1) (van Wijnen et al., 1987, 198813, 1989, 1991b; Pauli et al., 1990; S. Dworetzky, JS and GS, unpublished data). Three sets of relatively large probes (0.05 to 0.2 kB) were prepared. Each of these was uniquely labelled at the proximal terminus near the mRNA cap-sites of, respectively, the H4-FO108, H3-ST519, and H1-FNC16 histone genes. Figure l b shows stairway assays of three distinct proteidDNA com lexes with relatively similar migration rates mediated y factors designated, respectively, HiNF-D, HiNF-D3, and HiNF-D1. These stair-

i

way assays were performed with HiNF-D-containing chromatography fractions (van Wijnen et al., 1989, 1991b). Factor HiNF-D3 appears to require sequences between nt -138 and -87, whereas HiNF-D1 requires sequences between nt -213 to - 160. Also indicated is the complex of the heteromeric CCAAT-box rotein HiNF-B that interacts specifically with the H1 istone gene promoter (nt -122 to -90; van Wijnen et al., 1988a,b). Interestingly, the regions required for HiNF-D and HiNF-D3 binding coincide with, respectively, in vivo proteiniDNA interaction domains H4Site I1 (nt -97 to -46) and H3-Site I1 (-148 to -60); in vivo binding sites for H1 histone genes have not been established. These data indicate that HiNF-D3 and HiNF-D1, similar to HiNF-D, represent sequencespecific DNA binding activities. Relative migration rates of proteiniDNA complexes are the combined result of several mobility parameters, including those related to the protein, the bound DNA, and the mutual effect of these interacting components on each other. However, as is evidenced in Figure lb, e.g., the HiNF-D complex mi rates relatively independent of the size of the boun DNA fragment, and the same observation has been made for the HiNF-D3 and HiNF-D1 complexes (data not shown). To illustrate similarities in mobilities directly for the HiNF-D and HiNF-D3 complexes, we electrophoresed binding mixtures containing these complexes on the same gel using DNA fragments of approximately equal length (Fig. lc). Gel retardation conditions were used that also show the relative migration rates of the Spl-like factor HiNF-C (binding to nt - 134 to - 113 of the H4 histone romoter; van Wijnen et al., 1989) and HiNF-B3 (H3 gist one promoter CCAAT-box binding protein binding to nt - 149 to - 122; see Fig. 7). The results show that the HiNF-D and HiNF-D3 complexes have indistinguishable relative migration rates. This is consistent with molecular similarities in these interactions. HiNF-D was originally defined as a DNA binding activity from human HeLa S3 carcinoma cells. To establish the identity of the HiNF-D complex in cells of different origin, it is necessary to show that, e.g., putative rodent homologues have similar competition behavior (cross-species compatibility). Also, HiNF-Dlike binding activities from different cells of the same species should have similar sequence-specificities, regardless of whether the cell dis lays properties of the normal diploid or transforme phenotype (cell-type independence). Competition assays were performed with nuclear proteins from several different cell types to address these issues (Fig. Id; see also Fig. 7). The results show that the sequence-specific DNA binding activity of HiNF-D is detected with nuclear protein preparations from both primate and rodent cells, and from normal diploid as well as transformed or tumorderived cells. These results suggest that detection of HiNF-D3 and HiNF-D1 binding activities in different cell types meets similar criteria (see Fig. 7). Coordination of rotein-DNA interactions in human H4, H3, an(PH1 histone promoters during the cell cycle We have previously established a panel of nuclear extracts derived from cell cycle synchrony experiments using normal diploid and transformed cells (Holthuis

K

cf

a

178

-

VAN WIJNEN ET AL.

%E

c

DO

1 H4-I

~ D T A T A

I ; : : : : ?

H4

H4-ll

-DD-,

H4-I I

] H 4 probes ] H 4 oligo's

H3-probe -H3-II

I

oligo

H I probe

Fig. 1. A. Diagram showing the promoter sequences (thin lines), transcriptional initiation sites (arrows) and histone coding regions (filled boxes) of human H4 (F01081, H3 (ST519), and H1 (FNC16) histone genes (DNA sequences, respectively, in Pauli et al., 1987; Marashi et al., 1986; van Wijnen et al., 1988b). In vivo protein-DNA interaction sites in the H4 and H3 histone gene promoters are indicated by wide, open boxes, and in vitro protein-DNA interaction sites are shown by thin open boxes above the sequences. DNA fragments used for probes and synthetic oligonucleotides for competition in gel retardation assays are indicated by bracketed lines underneath the sequences (see text for additional references). B. Deletion analysis of histone promoter proteiniDNA complexes using stairway assays. Promoter fragments were uniquely labelled a t endonuclease cleavage sites in H4, H3 and H1 histone promoters (respectively,Ban11 of pKUC8, Hind111ofjTP-1, and SmaI of pOXOO1) at the indicated positions (abbreviated P: nt#). These probes were progressively shortened by endonuclease cleavage at the indicated positions (1. tor., respectively: H4 = EcoRI, TaqI, ThaI, and AvaII; H3 = BstNI, ThaI, AvaII, and Hinff; H1 = RsaI, HinfI, and HaeIII) with the minus sign of nucleotide numbers (dash) pointing at the free DNA of each probe. Binding reactions were performed in parallel for each set using chromatography fractions containing HiNF-D activity: respectively, PO-200 (H4), P100-400 (H3), and DO-200 (Hl) (approxi-

mately 1 kg protein each). The HiNF-D (H41, HiNF-D3 (H3), and HiNF-D1 (Hl) complexes are indicated with arrowheads. The darkest band (relative migration of approximately 0.4) in the H1-series represents the HiNF-B complex (binds to nt -122 to -90) and this proteiniDNA complex occurs with all three probes (not indicated). C. Gel retardation assay illustrating similarity in the migration rates of the HiNF-D and HiNF-D3 proteiniDNA complexes (indicated by arrowheads) by electrophoresis of binding reactions on the same gel using probes with similar length (H4: 106 bp HindIIIiTaqI fragment of pFP-1; H3: 122 bp HindIIiBstNI fragment of pTP-1) and nuclear extract of exponentially growing HeLa S3 cells (approximately 2 kg protein each). Thin arrow points at the origin of electrophoresis. The HiNF-C and HiNF-B3 complexes are indicated for reference. Nonspecific competitor DNA in Figure lb,c was 2 kg poly IIC DNA per reaction; 2 pg poly GIC DNA and 200 ng IIC DNA were used in Figure Id. D. Competition analysis of Nuclear extracts from human HeLa S3 and WI-38 cells, as well as rat primary osteoblast and osteosarcoma cells (approximately 2 kg protein each), were incubated in the absence of competitor DNA (C), in the presence of the noncompeting H4-I oligonucleotide (N)or the specific H4-I1 oligonucleotide (S)(in each case approximately 500-fold molar excess). The H4-probe used is the HindIIIiTaqI fragment of pFP-1.

179

INTERACTIONS IN HISTONE GENE PROMOTERS

et al., 1990). Cell cycle dependent fluctuations in HiNF-D DNA binding activity were observed in extracts from normal diploid cells, irrespective of the cell synchronization procedure used (Holthuis et al., 1990; Wright et al., 1991a). We have now examined the regulation of DNA binding activities that interact with H3 and H1 histone promoters during the cell cycle and compared these with HiNF-D:H4-Site I1 proteinIDNA interactions in gel retardation assays (Fig. 2). Initially, we used cell cycle stage specific nuclear protein preparations from normal diploid, primary calvarial rat osteoblasts (supporting data in Holthuis et al., 1990). The results show that the binding activities of HiNFD3 and HiNF-D1 parallel the level of HiNF-D binding activity. These factors are abundant in S phase nuclear extracts, but are barely detectable in pre-release cells and G1 phase cells. To investigate whether the cell cycle fluctuations of HiNF-D3 and HiNF-Dl are coupled to DNA replication in the same way as HiNF-D (Holthuis et al., 19901, we inhibited DNA synthesis in rat osteoblasts during S-phase by treatment with hydroxyurea (1 mM) and analyzed the effect of this procedure on the levels of these activities (Fig. 2). HiNF-D3 and HiNF-D1 binding activities, like HiNF-D, persist during both shortterm (1 hr) and long-term (8 hr) inhibition of DNA synthesis. Thus these factors are upregulated in conjunction with HiNF-D at the onset of DNA replication, and coordinate downregulation of these activities requires the completion of DNA synthesis. These data suggest that HiNF-D3 and HiNF-D1 binding activities, similar to HiNF-D, are cell cycle regulated with respect to S-phase in normal diploid cells. Deregulation of cell cycle dependent H3 and H1 histone promoter protein-DNA interactions in tumor cells Tumor cells have been shown to exhibit deregulation of the cell cycle dependent fluctuations in HiNF-D binding activity (Holthuis et al., 1990).We explored the possibility that HiNF-D3 and HiNF-D1 DNA binding activities would be similarly deregulated in tumor cells. The levels of these factors during the cell cycle of normal diploid cells were analyzed and compared with results obtained with nuclear proteins derived from the transformed counterparts of these cells. DNA binding activities from synchronized WI-38 human fetal lung fibroblasts were compared with nuclear proteins isolated from SV40-transformed WI-38 cells (Fig. 3A) and, in parallel experiments, nuclear proteins from ROS 1712.8 rat osteosarcoma cells were studied in comparison with those from rat primary calvarial osteoblasts (Fig. 3a). Similar to HiNF-D, the H3 and H1 histone gene promoter bindin activities are maintained at high constitutive leve s during the cell cycle in the transformed cell lines but are strongly cell cycle dependent in normal diploid cells. The levels of HiNF-D3 and HiNF-D1 activity were also measured in S and G1 phase extracts of HeLa S3 heteroploid human cervical carcinoma cells and HL60 promyelocytic leukemia cells (Fig. 3a). HeLa S3 cells are continuously proliferating tumor-derived cells that have lost the potential to differentiate, whereas HL60

f

cells are pluripotent and capable of differentiating, for instance, into monocytes or granulocytes. Both HeLa S3 and HL60 cells have high levels of HiNF-D3 and HiNF-D1 activity in both S and G1 phase cells, paralleling the level of HiNF-D during the cell cycle in these cells. These data indicate that HiNF-D, -D3 and -D1 are coordinately deregulated in four different tumor cells consistent with aberrations in a common mechanism that modulates histone gene promoter binding activities in concert during the process of tumorigenesis. In some cases, HiNF-D binding activity in gel retardation assays is represented by two proteinlDNA complexes with equal competition behavior (not indicated; see also Figs. 5, 7). Dephosphorylation experiments suggest that these com lexes are mediated by two forms of the same DNA inding activity that differ in the extent of phosphatase-sensitive posttranslational modifications (van Wijnen et al., 1991b). Occasionally, HiNF-D3 and HiNF-D1 are also represented by two forms (not indicated) with indistinguishable competition behavior. Hence, it is possible that all three factors are subject to post-translational modifications. Factor HiNF-A is constitutive DNA binding activity during the cell cycle in normal diploid cells Factor HiNF-A is a ubiquitous, HMG-I like DNA binding protein that recognizes dAIdT containing sequences, and binding sites for this factor have been observed in the promoters of H4-F0108, H3-ST519,and H1-FNC16 histone genes (van Wijnen, 1987, 1988a). This factor is constitutively present in HeLa S3 cells in both S and G1 phases and present in both proliferating and differentiated HL60 cells (van Wijnen et al., 1989). Thus HiNF-A may serve as an internal control in our cell cycle assays. The binding activity of this factor was measured in cell cycle sta e specific extracts of both normal diploid WI-38 fibro lasts and primary rat calvarial osteoblasts (Fig. 3b). Both the H3 and H1 probes are capable of binding HiNF-A, although the H4 probes used in this study are devoid of a HiNF-A binding site (see Fig. 1).In most experiments presented in this study, detection of this activity with H3 and H1 probes is prevented by the inclusion of oly I/C DNA as nonspecific competitor DNA in the inding reaction (this quenching by poly IIC DNA may be a general pro erty of HMG-I like proteins). In contrast, the HiNF- complex represents a prominent proteidDNA complex when oly GIC DNA is used and poly IIC omitted in bin ing reactions containing, e.g., the H3 probe (Fig. 3b). Most importantly, HiNF-A is abundant in both S and G1 phase extracts from both cell types. Together with previous observations, this indicates that HiNF-A binding activity, unlike HiNF-D, is constitutive both in normal and tumor cells. This suggests that both constitutive and cell cycle dependent DNA binding activities interact with histone promoters. The following technical considerations should also be taken into account in the evaluation of cell cycle dependent modulations of H4, H3, and H1 histone promoter factors (see also Materials and Methods). The particular procedure (Holthuis et al., 1990)employed to

g

fl

E

x

CQ

180

VAN WIJNEN ET AL

Cell cycle analysis

Fig. 2. Cell cycle analysis of nuclear proteins from rat primary calvarial osteoblasts synchronized by double thymidine block using gel retardation assays. Each panel shows results with proteins derived from cells, respectively, blocked with 2 mM thymidine before release in the cell cycle (PR), traversing through S-phase and harvested 4 hr after release (S),and progressing through early G1 and harvested 12 hours after release (Gl); cells in m i d 3 phase were treated with the DNA synthesis inhibitor hydroxyurea and harvested 2 hours

(S+HUl) and 8 hours (S+HU8) after treatment. The upper panel shows results obtained with the H4 promoter probe using, respectively 2 , 4 , 6 , 9 , and 12 pg protein for each sample (Holthuis et al., 1990)and is shown for reference only. The middle (H3 promoter probe) and lower (H1 promoter probe) panels show results using, respectively 2,4,6,8, and 10 pg protein. The non-specific competitor DNA was 2 pg poly IIC DNA. The position of the HiNF-D, HiNF-D3, and HiNF-D1 proteinDNA complexes are indicated by arrowheads.

obtain cell cycle stage specific nuclear extracts was optimized to obtain nuclear extracts from rat osteoblast and osteosarcoma cells (see Markose et al., 1990). This protocol yields barely detectable amounts of the H1 histone promoter CCAAT-box factor HiNF-B (van Wijnen et al., 1988a,b)or the Spl-like H4 histone promoter factor HiNF-C (van Wijnen et al., 1989) that could function as additional controls. However, note that low

levels of both activities, and several other uncharacterized proteiniDNA complexes,can be detected in nuclear extracts of primary rat osteoblasts both during S and G1 using probes spanning, respectively, the H1 and H4 histone promoter (see Fig. 2; not indicated). Thus the formal possibility that nuclear extracts from G1 phase cells could be generally devoid of most DNA binding activities is not supported by our data.

INTERACTIONS IN HISTONE GENE PROMOTERS

Fig. 3. A. Cell cycle analysis of nuclear proteins derived from W138 human normal diploid fibroblasts, SV40 transformed W138 cells, rat primary calvarial osteoblasts (ROB) and rat 1712.8 osteosarcoma cells (ROS),human HeLa S3 heteroploid cervical carcinoma cells and HL60 promyelocytic leukemia cells using gel retardation assays. U per panels and lower left panel show results of S-phase and GI-pRase specific extracts from the indicated cell types with the H3 promoter probe and, respectively, 2,4,6, and 8 kg protein added. The lower right panel shows same for the H1 promoter probe, using 4 pg protein only

181

for each sample. Poly GiC DNA 12 pg) and poly I/C DNA 1200 ng) were used as nonspecific competitors. B. Cell cycle analysis of HiNF-A (indicatedwith arrowhead and A) in S and G1 phases of normal diploid cells (human WI-38 fibroblasts and primary rat osteoblasts IROBl) using, respectively, 2 , 3 , and 4 pg protein in each case. The position of the HiNF-D3 complex (indicated with arrowhead and D3) is also shown for reference. The probe was the BstNIiHindIII fragment of pTP-1 and poly GIC DNA 12 kg) was used as the only nonspecific competitor DNA.

182

VAN WIJNEN ET AL.

Fig. 4. Left panels: Northern blot analysis of RNA isolated from adult (A) or fetal (F)mouse tissues (Lv = liver, Sp = spleen, Kd = kidney, Br = brain, Th = thymus) by hybridization with an H4 histone gene probe (Grimes et al., 1987). Approximately 10 pg RNA was loaded per lane. Right panels: agarose gel (stained with ethidiumbromide) of the RNA samples used for Northern blot analysis.

Coordination in the downregulation of H4,H3, and H1 histone promoter factors during hepatic development The mechanism associated with the regulation of histone promoter factors during the onset of quiescence and differentiation was studied in the intact animal, where development of tissue organization is influenced by physiological mediators, and normal cell growth and developmental control mechanisms, functionally related to the cell division cycle, are operative. Initially, the distribution of cell cycle dependent histone mRNA levels in various tissues of fetal and adult mice was examined by Northern blot analysis (Fig. 4). H4 histone mRNA was abundant in adult spleen and thymus but barely detectable in adult brain and below the level of detection in adult liver. Because of the tight correlation between core (H4, H3, H2B, and H2A) and H1 histone mRNA levels, DNA replication and cell proliferation (Stein and Stein, 1984a; Marzluff and Pandey, 19881, the results indicate that s leen and thymus contain actively dividing cells. T e abundance of histone mRNA in spleen and thymus is most likely due to active lymphocyte proliferation occurring in those tissues, whereas the absence of histone mRNA in adult liver presumably is related to cell quiescence. Levels of histone mRNA were also monitored in fetal liver and brain. High levels of histone mRNA were observed in fetal liver indicating modulations in cell proliferative activity during hepatic development. Both fetal and adult brain have low levels of histone mRNA reflecting a relatively small, constant population of proliferating cells. Cell proliferative activity in brain is consistent with the presence of nonneuronal cells (e.g., glial cells) in this tissue. Nuclear proteins derived from fetal and adult liver were analyzed in gel retardation assays for the levels of HiNF-D3 and HiNF-D1 activity (Fig. 5). Levels of both factors are measurable in fetal liver but could not be detected in adult liver. Moreover, the levels of these factors were parallel to the level of HiNF-D activity (Fi . 5) (the latter was also monitored in adult spleen an thymus, showing abundant HiNF-D activity in

t:

f

both tissues; van Wi'nen et al., 1991a).In contrast, two protein-DNA comp exes mediated by, respectively, HiNF-B3 and HiNF-B (CCAAT-box binding proteins) are present in both fetal and adult liver, suggesting that the factors involved do not change during liver development. The differences in the levels of HiNF-D, HiNF-D3, and HiNF-D1 DNA binding activities in fetal versus adult liver parallels the decrease in cell roliferative activity in this tissue, as measured by Ristone mRNA levels (see Fig. 41, suggesting that HiNF-D, HiNF-D3, and HiNF-D1 are coordinately downregulated at the onset of quiescence and differentiation during hepatic development. Interestingly, although a strong correlation appears to exist between proliferative activity and the resence of histone promoter factors in several tissues, t e levels of HiNF-D3 and HiNF-D1 binding activities are constitutively high in both fetal and adult brain, although again arallel to the levels of HiNF-D (Fig. 5). The physioggical significance of high levels of these DNA binding activities in brain is not known but is consistent with the persistence of H4 histone gene transcription (as measured by reporter gene expression) in transgenic mice (van Wijnen et al., 1991a).

1

ph

Factors HiNF-D, HiNF-D3, and HiNF-D1 have similar protein domains To address similarities in the properties of the factors mediating these cell cycle regulated protein-DNA interactions, we performed thermal inactivation experiments using HeLa S3 derived nuclear proteins (Fig. 6). We have previously shown that HiNF-D is sensitive to preincubation at temperatures between 45°C and 55°C and is irreversibly inactivated above this temperature interval. The thermal inactivation profile is specific for a given DNA binding protein (e.g., see Hooft van Huisduinen et al., 1987 and references therein). For instance, the profile of HiNF-D is distinct from those of other histone gene promoter factors, such as HiNF-A (> 9O"C), HiNF-B (> 55") and HiNF-C (< 37°C) (numbers in brackets refer to temperatures at which greater than 90% of binding activity has become inactivated)

INTERACTIONS IN HISTONE GENE PROMOTERS

183

Mouse development:

Fig. 5. Gel retardation analysis of nuclear factors with nuclear proteins from mouse liver (Lv) and brain (Br) in both the fetal (F) and adult (A) developmental stages. Assays were performed using the H3 promoter robe (lower left panel) or the H1 promoter probe (lower right panefi; the upper panel using the H4 promoter probe is shown for reference. Respectively, 2 , 3 , and 4 pg protein was added per binding

reaction. Arrowheads in the upper panel indicate two forms of HiNF-D binding activity (which is related to phosphatase-sensitive posttranslational modifications) and another H4-Site I1 DNA binding protein designated HiNF-M (van Wijnen et al., 1991b). Complexes B3 and B are indicated by arrowheads in the lower panels.

(see Fig. 6 and data not shown). Thermal inactivation denatured at 55°C. The indistinguishable thermal inproperties are presumably related to the denaturation activation profiles of HiNF-D, HiNF-D3, and HiNF-D1 of critical domains in DNA binding proteins that suggest that these factors contain very similar, if not become rate-limiting for sequence-specific interactions identical, protein domains. Hence, the parallel in HiNF-D, HiNF-D3, and HiNF-D1 DNA binding activat elevated temperatures. Figure 6 shows that HiNF-D1 and HiNF-D3 have ities in various biological situations is reflected by thermal inactivation profiles indistinguishable from similar, critical protein structural domains in these HiNF-D. That is, these binding activities are barely factors. This similarity is further supported by the affected by pre-incubation at 45"C, but are irreversibly similar chromatographic behavior of these factors on

VAN WIJNEN ET AL.

184

Fig. 6. Thermal inactivation profiles of HiNF-D, HiNF-D3, and HiNF-D1 binding activity using gel retardation assays. Samples (10 pi;4 pg protein) were preincubated in storage buffer for 10 minutes at the indicated temperatures, placed on ice for 5 minutes, and diluted twofold in the binding mixture containing the indicated histone promoter probes and subjected to electrophoresis. Nonspecific competitor DNA is 2 pg poly IIC DNA. The H3 probe spans nt -200 to -13 in the H3 histone gene promoter, the H4 probe spans nt -130 to -30. Arrowheads indicate the positions of the complexes mediated by the HiNF-D related factors. Complexes mediated by HiNF-B and HiNF-C are shown for reference.

ion-exchange resins and by similar relative migration of the corresponding protein-DNA complexes in gel retardation assays (Fig. 1 and data not shown). Human H4 and H3 histone romoters interact with similar DNA bin ing activities The coupling between H4, H3, and H1 histone gene promoter proteinlDNA interactions could be mediated by a single DNA binding protein recognizing a similar DNA binding consensus sequence in each promoter. In order to address this possibility, we examined the sequences (for references see legend of Fig. 1) of the regions re uired for HiNF-D, HiNF-D3, and HiNF-D1 binding (jig. lb). The HiNF-D binding site encompasses an evolutionarily conserved and apparently H4 histone specific element (5'dCTTTCGGTTTTCAATCTGGTCCG) (van Wijnen et al., 1989). Recently, we have shown that this sequence is part of a multipartite proteiniDNA interaction domain involving a t least three distinct sequence-specific DNA binding activities including HiNF-D (van Wijnen et al., 1991b). HiNF-D appears to interact with an extended polynucleotide sequence with methylation interference proteiniDNA contacts distributed over 28 nucleotides. Interestingly, the regions required for binding of HiNF-D, -D3, and -D1 do not share obvious sequence similarities, although short stretches of similarity (4-5 nt) can be found. This observation is inconsistent with a simple DNA binding consensus sequence model. Competition experiments with HiNF-D1 and HiNF-

cp

D3 were performed using several oligonucleotides, each spanning specific portions of H4-Site I1 or H3-Site I1 sequences, to investigate whether these in vivo proteinDNA interaction sites contain binding elements for these factors (Fig. 7). An oligonucleotide spanning the HiNF-D binding site (nt -91 to -64; H4-11) was capable of competing with the H3 histone gene promoter for HiNF-D3 binding (Fig. 7). A second oligonucleotide (DD-1) that contains a subset of the sequences present in the HiNF-D oligonucleotide (nt -93 to -80) did not compete for either HiNF-D or HiNF-D3 binding. Hence, these results demonstrate that the HiNF-D binding site contains elements involved in HiNF-D3 binding. Contained within the HiNF-D binding site are a CCAAT-like sequence (5'dTCAAT) and a pentameric element (5'dGGTCC) that has been proposed to be a histone specific consensus sequence (see Wells, 1986, and references therein), with both elements in direct orientation (i.e., 5'dTCAATCTGGTCCGAT). Competition experiments (Fig. 7) were also performed using a DNA fragment spanning H3-Site I1 that contains a CCAAT-box and the pentameric element but arranged in opposite orientation (i.e., 5'dGATGGACCAATCCAA; H3-11). This third oligonucleotide did not compete efficiently for either HiNF-D or HiNF-D3 binding. Thus neither the pentameric element nor the CCAATlike sequence appears to account se arately for the observed competition between HiNF- and HiNF-D3, but rather a specific combination of DNA sequence elements contained within the HiNF-D oligonucleotide. Taken together, these competition results provide evidence that HiNF-D and HiNF-D3 are a t least in part related by a common DNA binding activity that does not recognize a simple consensus sequence. None of the three oligonucleotides mentioned above competed with the H1 histone gene promoter for HiNFD1 binding (Fig. 7). Assuming that these factors have a heteromeric structure, it is possible that the coordinate regulation of HiNF-D1 in conjunction with HiNF-D and HiNF-D3 may involve a non-DNA binding subunit. Alternatively, the binding activities of HiNF-D, HiNF-D3, and HiNF-D1 could in fact be the same, but the competition results are obscured by a possible hierarchy in affinity of this activity for its binding sites in the order H1 > H4 > H3. Irrespective of these and other possibilities, the competition between DNA sequence elements in the H4 and H3 histone gene promoters indicates that the coordinate regulation of these H4 and H3 histone gene proteinDNA interactions may at least in part be mediated by a common DNA binding activity intrinsic to HiNF-D.

E

DISCUSSION In this work we show similarities in the regulation of three analogous H4, H3, and H1 histone promoter DNA binding activities, respectively HiNF-D, HiNF-D3, and HiNF-D1. The properties of these factors suggest that they are directly related by shared molecular components. First, thermal inactivation profiles of HiNF-D and related factors are indistinguishable, which is consistent with a similar protein structural domain in all three factors, which may either be covalently or

INTERACTIONS IN HISTONE GENE PROMOTERS

Fig. 7. Competition analysis of protein-DNA complexes observed with the H4 (upper panels), H3 (middle panels), and H1 (lower panels) promoter probes using 500-fold molar excess of synthetic oligonucleotides spanning H4 (oligo’s H4-I1 and DD-1) and H3 (oligo H3-11) histone gene promoter sequences. All lanes contain 4 kg protein from,

185

as indicated, human HeLa S3 cells, fetal mouse liver and brain, and adult mouse liver and brain cells. Arrowheads indicate the positions of the HiNF-D3 and HiNF-D1 complexes, and complexes mediated by CCAAT-box binding activities (B and B3).

186

VAN WIJNEN ET AL.

noncovalently associated with these DNA binding activities. It is possible that HiNF-D and related factors are heteromeric proteins similar to the AP-1, CPliCP2 (or NF-Y), MaxiMyc, and ATF-families of factors (Hai et al., 1988; Mitchell and Tjian, 1989; Hooft van Huijsduijnen et al., 1990; Wingender, 1990; Blackwood and Eisenman, 19911, and we have shown that at least one histone promoter factor (HiNF-B) requires heteromerization prior to sequence specific binding (van Wijnen et al., 198813). Second, competition analysis has revealed that HiNF-D and HiNF-D3 have similar DNA binding activities, which indicates that the corresponding rotein-DNA interactions may involve a common D N I binding activity. Because HiNF-D activity may be dependent on a phosphatase-sensitive posttranslational modification (van Wijnen et al., 1991b),it is also possible that alterations in posttranslational modifications of these factors (e.g., phosphorylation) influence proteiniDNA interactions. Cell cycle control of histone promoter protein-DNA interactions Regardless of the exact relationship between these activities, the results presented here show that three analogous protein-DNA interactions (involving HiNF-D, -D3, and -D1) are regulated in a developmental manner and are cell cycle controlled with respect to S-phase. Inhibition studies with normal diploid cells blocked at the onset of S phase (using thymidine) or cells blocked in mid S phase (using hydroxyurea) suggest that an oscillatory mechanism regulates these DNA binding activities in concert and is dependent on events at both the onset of and exit from S-phase. This mechanism is deregulated during the process of cellular transformation, preventing down-regulation of these factors after completion of S-phase and permitting the accumulation of high levels of HiNF-D and related factors in the G1 phase. However, HL60 tumor cells, which maintain elevated, cell cycle independent levels of these activities, downregulate both HiNF-D and HiNF-D3 in concert at the shutdown of proliferation and onset of differentiation (Stein et al., 1989). This suggests that these histone promoter factors are subject to at least three regulatory mechanisms, two dependent on S-phase events and the third related to the exit from the cell cycle at the cessation of proliferation. Cells progressing through the cell division cycle from mitosis to S-phase travel through distinct hypothetical restriction points prior to the onset of S-phase (Cross et al., 1989; Pardee, 19891, Whereas normal cells appear to increase the activity of HiNF-D and related factors at the GUS phase boundary, apparently after fulfillment of the necessary molecular criteria for cell cycle continuation, tumor cells are permissive for high levels of these activities in G1, implying constitutive upre ulation of these factors. This suggests that tumor cells ypass a putative restriction point in the G1 phase of normal cells that is related to the activation of the regulatory mechanism that coordinately modulates histone promoter DNA-protein interactions. A second transition point in the G2iM phase requires the completion of S-phase and is related to the down-regulation

%

of the binding activities of HiNF-D, -D3, and -D1. The mechanism operative here may directly reflect reversal of specific activating modifications in roteidDNA interactions occurring at the putative 1-transition point, whereas events occurring at the third and differentiation-related transition oint may be related to permanent inactivation of DN binding activities.

8

1

Coordinate transcriptional control of multiple histone gene families Working models for the coordinate regulation of multiple histone genes should account for the control of histone promoter protein-DNA interactions at three distinct transition points in the cell cycle. Cell cycle control of histone gene transcription may be mediated by separate regulation of each individual histone promoter by a corresponding subtype-specific DNA binding activity, as has been suggested but not demonstrated by studies on the regulation of H4 (Dailey et al., 1988, van Wijnen et al., 1989,1991b;Lee et al., 19911, H3 (Artishevsky et al., 19871, H2B (LaBella et al., 1988), and H1 (Wells et al., 198813; Gallinari et al., 1989) histone gene transcription. Potential drawbacks of this model are: (1)it implies that during evolution, eukaryotic cells have developed at least five different histone gene specific factors (i.e.,assuming one for each class), and (2) it may invoke multiple cell cycle control mechanisms that mediate “pleiotropic activation” (Heintz, 1988) of these separate factors. Among other possibilities, the activity of such factors could be influenced at the level of DNA binding activity, the intrinsic transcription stimulating activity, the abundance of the factor, or a combination of these by either transcriptional or posttranscriptional processes and/or posttranslational modification(s) acting on each factor. Regulation of DNA binding activity of various histone subtype-specific factors has been studied as a function of the cell cycle in several laboratories. Contrasting results have been obtained with several of these factors (see below). Recent evidence suggests that this is not related to species differences or alternative cell synchronization procedures but rather may be related to the extent to which a particular cell type displays properties of the transformed phenotype (Ito et al., 1989; Holthuis et al., 1990). The DNA binding proteins HiNF-D (van Wijnen et al., 1989), OTF-1 (LaBella et al., 19881, and HlTF-liH1-SF (Dalton and Wells, 1988b; LaBella et al., 1989),respectively related to H4, HZB, and H1 histone genes, are cell cycle independent in heteroploid HeLa S3 tumor cells. However, the DNA binding activities of these three factors have been shown to fluctuate dramatically during the cell cycle in cells resembling the normal diploid phenotype (Dalton and Wells, 1988b; Ito et al., 1989; Holthuis et al., 19901, and, interestingly, similar observations have been made for a DNA binding activity interacting with the cell cycle regulated thymidine kinase promoter (Bradley et al., 1990). The above results and those obtained with HiNF-D3 and HiNFD1, whose DNA binding activities are cell cycle regulated only in normal diploid cells (this work), further support the notion that control at the level of DNA binding activity may be an important mode by which

INTERACTIONS IN HISTONE GENE PROMOTERS

cells regulate histone genes, although further control may be achieved at additional levels (see Dalton and Wells, 1988a,b; LaBella et al., 1989). Cross subtype-specific histone gene promoter factors The existence of histone gene specific consensus elements (see Wells, 1986 and references therein) has been noted by a number of investigators and apparent subtype specific elements have been described for H4 (Dailey et al., 1988; van Wijnen et al., 1989; Lee et al., 1991), H3 (Artishevsky et al., 19871, H2B (LaBella et al., 1988; Ito et al., 1989) and H1 (Coles and Wells, 1985; van Wijnen et al., 1988a; Gallinari et al., 1989). The H4 histone gene specific element coincides with the binding site for HiNF-D. In this work, we observed that an oligonucleotide spanning this element competes for binding of both HiNF-D to the H4 histone promoter and HiNF-D3 to the H3 histone gene promoter. However, the binding sites of HiNF-D and HiNF-D3 do not display obvious sequence identity, but primary sequence similarity is not always a prerequisite for binding of a sequence specific DNA binding protein to two distinct sites (e.g., see Gil et al., 1988a,b; England et al., 1990). Hence, our data provide evidence for a cell cycle regulated histone promoter factor that recognizes at least two distinct histone gene subtypes, although not according to a simple consensus sequence rule. This implies that the definition of histone gene specific consensus elements may not be meaningful in establishing absolute histone subtype-specificity of the cognate promoter factors. Because HiNF-D may be involved in the coordinate regulation of both H4 and H3 histone genes and the possibility that OTF-1 could be involved in the regulation of both H2B and H2A histone genes via binding of this factor to the 5’ intergenic region of divergently transcribed H2AiH2B gene pairs, it is possible that there is pairwise regulation of the core histone multi-gene families. Such a “cross-subtype specific” model implies a considerable reduction in gene-regulatory complexity. In conclusion, our results suggest that coordinate control of three distinct histone multigene families involves temporal regulation of corresponding, cell cycle dependent histone promoter protein-DNA interactions at three transition points during the cell cycle. The deregulation of these interactions in four different tumor-derived and transformed cells types suggests: (1) that these interactions are subject to concerted regulation mediated by a key cell growth control mechanism, and (2) that deregulation of histone promoter DNA binding activities frequently accompanies aberrations in normal cell growth mechanisms during the process of cellular transformation. Moreover, a DNA binding activity intrinsic to the H4 histone promoter factor HiNF-D may be involved in H3 histone proteiniDNA interactions suggesting that this factor is an important component of this shared cell cycle control mechanism.

ACKNOWLEDGMENTS We thank Gerard Zambetti. WieD ScheDer. Steve Dworetzky, Ken Wright, and Neil A r b i n fo; stimulating discussions. Special thanks to Mary Beth Kennedy

187

for tissue culture assistance, Shirwin Pockwinse for photography, and Dr. H.O. Voorma (University of Utrecht) for support in establishing a student exchange program. We are grateful to Steve Cosenza, Ruth Carter, and Ken Soprano (Temple University, Philadelphia) for roviding WI-38 nuclear extracts, and to Ted Choi an Rudolf Jaenisch (Massachusetts Institute of Technology, Boston) for providing mouse RNA samples. This work was supported by grants from NIH, NSF, and the March of Dimes Birth Defects Foundation. J.H. was su ported by the Scrinerius Stichting, Utrecht, The Net erlands.

cp

E

LITERATURE CITED Artishevsky, A., Wooden, S., Sharma, A., Resendez J r , E., and Lee, A.S. (1987) Cell cycle regulatory sequences in a hamster histone promoter and their interactions with cellular factors. Nature, 328:823-827. Blackwood. E.M.. and Eisenman. R.N. (1991) Max: A helix-looD-helix zipper protein that forms a sequence-specificDNA binding complex with Myc. Science, 251:1211-1217. Bradlev. D.W.. Dou. 9.-P.. Fridovich-Keil. J.L.. and Pardee. A.B. (1990) Transformed and nontransformed cells differ in stability and cell cycle regulation of a DNA binding activity to the murine thymidine kinase promoter. Proc. Natl. Acad. Sci. USA, 87:93109314. Carozzi, N., Marashi, F., Plumb, M., Zimmerman, S.,Zimmerman, A., Coles, L.S., Wells, J.R.E., Stein, G., and Stein, J. (1984) Clustering of human H1 and core histone genes. Science, 224:1115-1117. Coles, L.S., and Wells, J.R.E. (1985) An H 1 histone gene-specific 5 element and evolution of H 1 and H5 histone genes. Nucl. Acids Res., 13:585-594. Collart, D.G., Wright, K.L., van Wijnen, A.J., Ramsey, A.L., Lian, J.B., Stein, J.L., and Stein, G.S. (1988) The human H1 histone gene FNC16 is functionally expressed in proliferating HeLa S3 cells and is down-regulated during terminal differentiation in HL60 cells. J . Biol. Chem., 263:15860-15863. Cross, F., Roberts, J., and Weintraub, H. (1989) Simple and complex cell cycles. Annu. Rev. Cell Biol., 5:341-396. Dailey, L., Boseman Roberts, S., and Heintz, N. (1988) Purification of the human histone H4 gene-specific transcription factors H4-TF-1 and H4TF-2. Genes Dev., 2:1700-1712. Dalton, S., and Wells, J.R.E. (1988a) A gene-specificpromoter element is required for optimal expression ofthe histone H1 gene in S-phase. EMBO J., 7:49-56. Dalton, S., and Wells, J.R.E. (198813) Maximal levels of an H1 histone gene-specific factor in S-phase correlate with maximal H1 gene transcription. Mol. Cell. Biol., 8:4576-4578. England, B.P., Heberlein, U., and Tjian, R.T. (1990) Purified Drosophila transcription factor, Adh distal factor (Adf-l), binds to sites in several Drosophila promoters and activates transcription. J. Biol. Chem., 2655086-5094. Fletcher, C., Heintz, N., and Roeder, R.G. (1987) Purification and characterization of OTF-1, a transcription factor regulating cell cycle expression of a human H2B gene. Cell, 51:773-781. Gallinari, P., LaBella, F., and Heintz, N. (1989) Characterization and purification of HlTF-2, a novel CCAAT-binding protein that interacts with a histone H1 subtype-specific consensus element. Mol. Cell. Biol., 9:1566-1575. Gil, G., Osborne, T.F., Goldstein, J.L., and Brown, M.S. (1988a) Purification of a protein doublet that binds to six TGG-containing sequences in the promoter for hamster 3-hydroxy-3 methylglutarylcoenzyme A reductase. J . Biol. Chem., 263:19009-19019. Gil, G., Smith, J.R., Goldstein, J.L., Slaughter, C.A., Orth, K., Brown, M. S., and Osborne, T.F. (1988b) Multiple genes encode nuclear factor 1-like proteins that bind to the promoter for 3-hydroxy3-methylglutaryl-coenzyme A reductase. Proc. Natl. Acad. Sci. USA., 85:8963-8967. ~~~- - - Green, L., van Antwerpen, R., Stein, J., Stein, G., Triputti, P., Emanuel, B.S., and Croce, C. (1984)A major histone gene cluster on the long arm of chromosome 1. Science, 226:838-840. Grimes, S., Weisz-Carrington, P., Daum, H. 111, Smith, J., Green, L., Wright, K., Stein, G., and Stein, J . (1987) A rat histone H4 gene ~~

188

VAN WIJNEN ET AL

closely associated with the testis-specific H l t gene. Exp. Cell Res., 178:534-545. Hai, T., Fang, L., Coukos, W.J., and Green, M.R. (1989)Transcription factor ATF cDNA clones: an extensive family of leucine zipper proteins able to selectively form DNA-binding heterodimers. Genes Dev., 3:2083-2090. Hanly, S.M., Bleecker, G.C., and Heintz, N. (1985) Identification of promoter elements necessary for transcriptional regulation of a human histone H4 gene in vitro. Mol. Cell. Biol., 5:380-389. Heintz, N. (1988) Factors regulating histone gene transcription during the cell cycle. In: Cancer Cells: Eukaryotic DNA Replication, Vol. 6. T. Kelly and B. Stillman, eds. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, pp. 265-268. Heintz, N., Zernik, M., and Roeder, R.G. (1981) The structure of the human histone genes: clustered but not tandemly repeated. Cell, 24:661-668. Helms, S., van Wijnen, A.J., Kroeger, P., Shiels, A,, Stewart, C., Hirshman, J., Stein, J.L., and Stein, G.S. (1987) Identification of an enhancer-like element upstream from a cell cycle dependent human H4 histone ene J Cell. Physiol., 13552-558. Holthuis, J., Swen, T.A., van Wijnen, A.J., Wright, K.L., RamseyEwing, A,, Kennedy, M.B., Carter, R., Cosenza, S.C., Soprano, K.J., Lian, J.B., Stein, J.L., and Stein, G.S. (1990) Tumor cells exhibit deregulation of the cell cycle human histone gene promoter factor HiNF-D. Science, 247:1454-1457. Hooft van Huijsduijnen, R.A.M., Bollekens, J., Dorn, A,, Benoist, C., and Mathis, D. (1987) Properties of a CCAAT box-binding protein. Nucl. Acids Res., 157265-7282. Hooft van Huijsduijnen R., Li, X.Y., Black, D., Matthes, H., Benoist, C., and Mathis, D. (1990) Co-evolution from yeast to mouse: cDNA cloning of the two NF-Y (CP-1ICBF) subunits. EMBO J., 9:31193127. Hwang, I., and Chae, C.-B. (1989) S-phase specific transcription regulatory elements are present in a replication-independent testisspecific H2B histone gene. Mol. Cell. Biol., 9:1005-1013. Ito, M., Sharma, A,, Lee, A.S., and Maxson, R. (1989) Cell cycle regulation of H2b histone octamer DNA binding activity in Chinese hamster lung fibroblasts. Mol. Cell. Biol., 92369-873. Kroeger, P., Stewart, C., Schaap, T., van Wijnen, A., Hirshman, J., Helms, S., Stein, G., and Stein, J. (1987) Proximal and distal regulatory elements that influence in vivo expression of a cell cycle dependent human H4 histone gene. Proc. Natl. Acad. Sci. USA, 84:3982-3986. LaBella, F., Gallinari, P., McKinney, J., and Heintz, N. (1989)Histone H1 subtype-specific consensus elements mediate cell cycle-regulated transcription in vitro. Genes Dev., 3:1982-1990. LaBella, F., Sive, H.L., Roeder, R., and Heintz, N. (1988) Cell-cycle regulation of a human histone H2b gene is mediated by the H2b subtype-specific consensus element. Genes Dev., 232-39. Larson, D.E., Zahradka, P., Stein, G., Stein, J., and Sells, B.H. (1989) Down-regulation of histone H3 and H4 gene transcription in differentiated L6 myotubes. Biochim. Biophys. Acta, 1009:177-183. Lee, I.J., Tung, L., Bumcrot, D.A., and Weinberg, E.S. (1991) UHF-1, a factor required for maximal transcription of early and late sea urchin H4 histone genes. Mol. Cell. Biol., 11:1048-1061. Lichtler, A.C., Sierra, F., Clark, S., Wells, J.R.E., Stein, G.S., and Stein, J.L. (1982)The multiple H4 histone mRNAs of HeLa cells are encoded in different genes. Nature, 298:195-198. Marashi, F., Baumbach, L., Rickles, R., Sierra, F., Stein, J.L., and Stein, G.S. (1982)Histone proteins in HeLa S3 cells are synthesized in a cell cycle stage specific manner. Science, 225683-685. Marashi, F., Helms, S., Shiels, A,, Silverstein, S., Greenspan, D.S., Stein, G., and Stein, J . (1986) Enhancer-facilitated expression of prokaryotic and eukaryotic genes using human histone 5’ regulatory sequences. Can. J. Biochem. Cell Biol., 64:277-289. Markose, E.R., Stein, J.L., Stein, G.S., and Lian, J.B. (1990) Vitamin D-mediated modifications in protein-DNA interactions a t two promoter elements of the osteocalcin gene. Proc. Natl. Acad. Sci. USA, 87: 1701-1 705. Marzluff, W.F., and Pandey, N.B. (1988) Multiple regulatory steps control histone mRNA concentrations. Trends in Biochem. Sci., 13:49-52. Mitchell. P.J.. and Tiian. R.T. 119891 Transcriotional r e d a t i o n in mammalian cells b y sequence specific D ~ A binding proteins. Science, 245:371-378. Owen, T.A., Holthuis, J., Markose, E., van Wijnen, A.J., Lian, J.B., and Stein. G.S. (1990a) Modifications of orotein-DNA interactions in the proximal promoter of a cell growih regulated histone gene ~~

during the onset of osteoblast differentiation. Proc. Natl. Acad. Sci. USA, (in press). Owen, T.O., Aronow, M., Shalhoub, V., Barone, L.M., Wilming, L., Tassinari, M.S., Kennedy, M.-B., Pockwinse, S., Lian, J.B., and Stein, G.S. (1990b) Progressive development of the rat osteoblast phenotype in vitro: Reciprocal relationships in expression of genes associated with osteoblast proliferation and differentiation during formation of the bone extracellular matrix. J . Cell. Physiol., 143:420-430. Pardee. A. (1989) G1 Events and regulation of cell proliferation. Science, 248:603-608. Pauli, U., Chrysogelos, S., Nick, H., Stein, G., and Stein, J . (1989) In vivo protein binding sites and nuclease hypersensitivity in the romoter region of a cell cycle regulated human H3 histone gene. hucl. Acids Res., 27:2333-2350. Pauli, U., Chrysogelos, S., Stein, J., Stein, G., and Nick, H. (1987) Protein-DNA interactions in vivo upstream of a cell cycle regulated human H4 histone gene. Science, 236:1308-1311. Pauli, U., Wright, K.L., van Wijnen, A.J., Stein, G. and Stein,J . (1990) DNA footprinting techniques: Applications to eukaryotic nuclear proteins. In: Methods in Nucleic Research. J.D. Karam, L. Chao, and G.W. Warr. eds. CRC Press Boston. Schurnperli, D. (1986) Cell cycle regulation of histone gene expression. Cell, 45:471472. Shalhoub. V.. Gerstenfeld. L.. Collart. D.. Lian. J.B.. and Stein. G.S. (1989) Downregulation of cell growth and cell’cycleregulated genes during chick osteoblast differentiation with the reciprocal expression of histone gene variants. Biochem., 285318-5322. Sharma, A,, Bos, T.J., Pekkala-Flagan, A,, Vogt, P.K., and Lee, A S . (1989) Interaction of cellular factors related to the J u n oncoprotein with the promoter of a replication-dependent hamster histone H3.2 gene. Proc. Natl. Acad. Sci. USA, 86:491-495. Sierra, F., Lichtler, A,, Marashi, F., Rickles, R., Van Dyke, T., Clark, S., Wells, J., Stein, J., and Stein, G. (1982) Organization of human histone genes. Proc. Natl. Acad. USA, 79:1795-1799. Sierra, F., Stein, G., and Stein, J. (1983) Structure and in vitro transcription of a human H4 histone gene. Nucl. Acids Res., 11:7069-7086. Stein, G.S., Lian, J., Stein, J., Briggs, R., Shalhoub, V., Wright, K., Pauli, U., and van Wijnen, A. (1989b) Altered binding of human histone gene transcription factors during the shutdown of proliferation and the onset of differentiation in HL-60 cells. Proc. Natl. Acad. Sci. USA, 86:1865-1869. Stein, G., and Stein, J. (1984) The relationship between histone gene expression and DNA replication. BioEssays, 1:202-205. Stein, G.S., Stein, J.L., Lian, J.B., van Wijnen, A.J., Wright, K.L., and Pauli, U. (1989a) Modifications in molecular mechanisms associated with control of cell cycle regulated human histone gene expression during differentiation. Cell Bio hysics, 15201-223. Stein, G.S., Stein, J.L., and Marzluff, W.F., e&. (1984) Histone Genes. John Wiley & Sons, New York. Triputti, P., Emanuel, B.S., Croce, C.M., Green, L.G., Stein, G.S., and Stein, J.L. (1986) Human histone genes map to multiple chromosomes. Proc. Natl. Acad. Sci. USA, 83:31853188. van Wijnen, A.J., Choi, T.K., Owen, T.A., Wright, K.L., Lian, J.B., Jaenisch, R., Stein, J.L., and Stein, G.S. (1991a) Involvement of the cell cvcle regulated nuclear factor HiNF-D in cell mowth control of a human HThistone gene during hepatic developmint in transgenic mice. Proc. Natl. Acad. Sci. USA, 88:2573-2577. van Wiinen, A.J.. Massung, R.F.. Stein. J., and Stein, G. (1988b) Human H1 histone gene promoter CCAAT-box binding protein HiNF-B is a mosaic factor. Biochem., 27:65346541. van Wijnen, A.J., Ramsey-Ewing, A.L., Bortell, R., Owen, T.A., Lian, J.B., Stein, J.L., and Stein, G.S. (1991b) Transcriptional element H4-Site I1 of cell cycle regulated human H4 histone gene transcription is a multipartite proteiniDNA interaction site for factors HiNF-D, HiNF-M and HiNF-P: involvement of phosphorylation. J. Cell. Biochem. (in press). van Wijnen, A.J., Stein, J.L., and Stein, G.S. (1987)A nuclear protein with affinity for the 5’ flanking region of a cell cycle dependent human H4 histone gene in vitro. Nucl. Acids Res., 15:1679-1698. van Wijnen, A.J., Wright, K.L., Lian, J.B., Stein, J.L., and Stein, G.S. (1989) Human H4 histone gene transcription requires the proliferation specific nuclear factor HiNF-D: auxiliary roles for HiNF-C (Spl-like) and possibly HiNF-A (HMG-like). J . Biol. Chem., 264:15034-15048. van Wijnen, A.J., Wright, K.L., Massung, R.F., Gerretsen, M., Stein, J., and Stein, G. (1988a) Two target sites for protein binding in the Y

INTERACTIONS IN HISTONE GENE PROMOTERS promoter of a cell cycle regulated human H1 histone gene. Nucl. Acids Res., 16571-590. Wells, D.E. (1986) Compilation analysis of histones and histone genes. Nucl. Acids Res., 14:r119-r149 (supplement). Wells, D., and McBride, C. (1989) A comprehensive compilation and alignment of histones and histone genes. Nucl. Acids Res. 17x311r346 (supplement). Wingender, E. (1990) Transcription regulating proteins and their recognition sequences. Crit. Rev. Eukaryotic Gene Expression, lt1148. Wright, K.L., Dell’Orco, R.T., van Wijnen, A.J., Stein, J.L., and Stein,

189

G.S. (1990a) Multiple mechanisms regulate the proliferation specific histone gene transcription factor, HiNF-D, in normal human diploid fibroblasts, manuscript submitted. Wright, K.L., Ramsey-Ewing, A.L., Aronin, N., van Wijnen, A.J., Stein, G.S., and Stein, J.L. (1990b) A novel transcription factor, ATF-84, and S p l are involved in the transcriptional regulation of a human H4 histone gene, manuscript submitted. Zambetti, G., Stein, J., and Stein, G. (1987) Targeting of a chimeric human histone fusion mRNA to membrane-bound polysomes in HeLa cells. Proc. Natl. Acad. Sci. USA, 84:2683-2687.