Vol. 11, No. 4
MOLECULAR AND CELLULAR BIOLOGY, Apr. 1991, p. 2096-2107 0270-7306/91/042096-12$02.00/0 Copyright © 1991, American Society for Microbiology
Coordination of Immunoglobulin DJH Transcription and D-to-JH Rearrangement by Promoter-Enhancer Approximation ALESSANDRO ALESSANDRINI AND STEPHEN V. DESIDERIO Department of Molecular Biology and Genetics and Howard Hughes Medical Institute, The Johns Hopkins University School of Medicine, Baltimore, Maryland 21205 Received 20 November 1990/Accepted 24 January 1991
The genes that encode the variable regions of immunoglobulin (Ig) heavy chains are encoded by three DNA segments: VH, D, and JH. During B-cell development these segments are brought together by a pair of sitespecific DNA rearrangements. The first of these joins a D segment to a JH segment; the second brings a VH segment in apposition to a DJH unit. B-cell precursors that have undergone D-to-JH joining express transcripts that initiate at the 5' flanks of rearranged D segments (DJH transcription). In this study we have examined the coordination of D-to-JH rearrangement and DJH transcription. The B-lymphoid progenitor cell line HAFTL-1 undergoes D-to-JH rearrangement when propagated in culture. In progeny of a single HAFTL-1 cell clone, joining of distal D segments (DSP2 and DFL16) to JH is accompanied by an increase in the steady-state level of transcripts initiating 5' of the D coding region. Steady-state transcription of a Dsp2 gene segment was undetectable prior to rearrangement and was observed to increase at least 20-fold upon joining to JH. In contrast, transcription from the 5' flank of DQ52, which lies within 700 bp of the JH cluster, was detected prior to rearrangement and did not increase significantly after rearrangement. The 5' flank of a DsP2 segment was found to support expression of a heterologous gene upon transfection into B progenitor cell lines. Expression from this Dsp2 promoter was at least 30-fold higher in the presence of the Ig heavy-chain enhancer, in either orientation, than in its absence. A DNA fragment spanning the interval from -165 to + 19 bp relative to the major Dsp2 transcriptional start site retained enhancer-dependent promoter activity. These observations imply that activation of DSP2JH and DFL16JH transcription is coordinated with D-to-JH rearrangement by approximation of enhancer-dependent D promoter elements to the Ig heavy-chain enhancer. This interpretation is consistent with our observation that the DQ52 segment, which is closely linked to the JH cluster, is transcribed both before and after rearrangement.
continue to be expressed; in addition, transcripts that initiate at the 5' flank of D (DJH transcripts) are detected (34). After VH-to-DJH joining, the predominant Cp.-containing RNAs in B-lymphoid cells are transcribed from a promoter at the 5' flank of VH (11, 22); these transcripts, termed p.. and Fs, encode membrane-bound and secreted forms of p. chain, respectively (2, 15, 36). Transcription from the VH promoter is stimulated by the H enhancer (6, 20), suggesting that its activation upon VH-to-DJH joining is effected, at least in part, by its approximation to the enhancer. Loci that have undergone VH-to-DJH joining continue to express Sp. transcripts, although the steady-state level of these transcripts remains low, relative to pm and ,w (24). Thus, at each stage in rearrangement, a distinct set of Cp.-containing transcripts is expressed from the H locus. The observation that Ig gene rearrangement is ordered during B-cell development implies that at different stages in ontogeny, recombination is restricted to distinct subsets of gene segments. Because Ig gene segments are rearranged by a common apparatus (45) and share similar recombinational signal sequences (42), it is unlikely that this restriction is effected at the substrate level. While the mechanisms that establish the sequence of Ig gene rearrangement during ontogeny are not yet established, several lines of evidence support the hypothesis that rearrangement of a given gene segment is facilitated by transcription at a nearby site (8, 43). First, rearrangement of exogenous, integrated substrates in pre-B-cells is positively correlated with expression of a linked genetic marker (8). Second, in transgenic mice carrying an artificial substrate for TCR,I gene rearrangement, Df0-to-J joining is observed in lymphoid cells only when
The variable regions of immunoglobulin (Ig) chains are encoded by discrete germ line DNA segments that are joined by an ordered series of site-specific rearrangements during lymphocyte differentiation (reviewed in references 7 and 42). The variable regions of Ig heavy chains (IgH regions), for example, are encoded by three elements, VH, D, and JH (14, 37). In mice, D segments fall into three families on the basis of nucleotide sequence: DSP2, containing at least nine members; DFL16, with at least two members; and DQ52, with a single member (25, 44). The DSP2 and DFL16 families form a cluster occupying a 70-kb region; this is separated from the cluster of four JH segments by 19.5 kb of DNA. The DQ52 segment, in contrast, is closely linked to the JH cluster, lying 696 bp to the 5' side of JH1 (44). Assembly of H genes initiates with the joining of a D segment to a JH segment; a VH segment is then added to form a complete VH-D-JH unit (5). Rearrangement of Ig light-chain gene segments begins only after assembly of a functional H gene (4, 35). The genes that encode T-cell antigen receptors (TCR) show similar patterns of segmentation and rearrangement (13). Ig and TCR gene rearrangements play a central role in establishing the primary immune repertoire, because they generate a diverse set of antigen receptors from a relatively small number of gene segments. IgH gene assembly is accompanied by ordered, sequential transcriptional activation at the H locus. Before rearrangement, B-cell progenitors express a form of C,u-containing RNA that does not support synthesis of p. protein (sterile or Sp. transcripts [3, 24, 31]). These transcripts initiate within the JH-C intron (28), from a promoter that resides in the H enhancer (41). After D-to-JH rearrangement, Sp. transcripts 2096
VOL . 1 l, 1991
these segments are linked to the IgH enhancer (18). Third, rearrangement of the K IOCUS in pre-B-cell lines carrying nonproductive rearrangements at both H alleles can be induced by treatment with lipopolysaccharide; under these conditions, activation of rearrangement is accompanied by induction of sterile transcription at the Ig K locus (40). These observations suggest that transcription and rearrangement share common elements of control. The function of DJH transcripts, which arise from partially assembled H genes, is not known. While in some instances DJH transcripts support synthesis of truncated ,u chains (34), the significance of these products is not clear, since productive D-to-JH rearrangement is apparently not required for subsequent VH-to-DJH joining (12). The relationship between transcriptional activation and Ig gene rearrangement suggests that DJH transcription may facilitate recombination. The potential importance of DJH transcription in the regulation of rearrangement led us to examine the mechanism whereby DJH transcription is activated during IgH gene assembly. Activation of DJH transcription has been proposed to occur when D-to-JH rearrangement brings the 5' flank of D in proximity to the H enhancer (34), by analogy to activation of transcription from the VH promoter. We have described a B-lymphoid progenitor cell line, HAFTL-1, that actively joins D segments to JH segments when propagated in culture (la). This cell line allowed us to test the hypothesis that D-to-JH rearrangement is accompanied by activation of DJH transcription. Using oligonucleotide probes specific for each of the three D segment families, DSP2, DFL16 and DQ52, we assayed DJH transcripts in progeny of a single HAFTL-1 cell clone. We observed that joining of distal D segments (DSP2 or DFL16) to a JH segment is accompanied by specific activation of transcription from the 5' flank of the rearranged D segment. In contrast, transcription from the 5' flank of DQ52, which lies within 700 bp of the JH cluster, was detected prior to rearrangement and did not increase significantly after rearrangement. The 5' flanking sequence of a Dsp2-JH recombinant was shown to support expression of a heterologous gene upon transfection into B-progenitor cell lines. Significantly, expression from the DsP2 promoter was at least 30-fold higher in the presence of the IgH enhancer, in either orientation, than in its absence. A 184-bp DNA fragment, spanning the interval from -165 to + 19 bp relative to the major DsP2 transcriptional start site, retained enhancer-dependent promoter activity. Taken together, these observations demonstrate that activation of DsP2JH and DFL16JH transcription is coordinated with D-to-JH rearrangement and suggest that this coordination occurs by approximation of an enhancer-dependent D promoter element to the IgH enhancer. This interpretation is consistent with our observation that the DQ52 segment, which is closely linked to the JH cluster, is transcribed in HAFTL-1 in the unrearranged and rearranged states. MATERIALS AND METHODS Cell lines and culture. The Harvey murine sarcoma virus (Ha-MSV)-transformed cell line HAFTL-1-14 (la) and the Abelson murine leukemia virus (Ab-MuLV)-transformed cell line 300-19 (4) were maintained in RPMI 1640 supplemented with 10% fetal bovine serum and 50 ,uM 2-mercaptoethanol. Cells were cloned by limiting dilution at 0.11 to 0.18 cells per microtiter well. Preparation and analysis of genomic DNA. Genomic DNA was prepared as described previously (la). DNA probes
IMMUNOGLOBULIN DJH TRANSCRIPTION
2097
were labeled to a specific activity of 108 to 109 cpm/l,g with 32P by the random primer method (17). Hybridization was carried out for 20 h at 42°C in 50% formamide-0.6 M NaCI-0.075 M sodium citrate-0.065 M KH2PO4-O.005 M Na2EDTA-1x Denhardt's solution (0.02% each bovine serum albumin, Ficoll, and polyvinylpyrrolidone 360)-100 ,ig
of heat-denatured salmon sperm DNA per ml-106 cpm of heat-denatured probe per ml. Filters were washed at 65°C for 1 h in 2x SSC (lx SSC is 0.150 M NaCl-0.015 M sodium citrate)-0.1% sodium dodecyl sulfate (SDS); 32P was detected by autoradiography. Probes specific for the JH-C,U intron and the 5' flanking sequences of DFL16 and Dsp2 were prepared from the plasmids PJH800, pJH38B9-7.1, and p40E4-2-5.2 as described previously (5). The 2.2-kb EcoRI-XbaI fragment of pRI-JH (4) was used as a probe for the 5' flank of DQ52Isolation of genomic DNA clones. Rearrangements from selected HAFTL-1-14 clones were amplified by the polymerase chain reaction and molecularly cloned. Amplification reactions (50 Rd) contained 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, 0.001% (wt/vol) gelatin, 200 ,uM each deoxynucleotide triphosphate, 1 ,uM D-specific 5' primer (PZ.7C for DQ52; PZ.7A for Dsp2 and DFL16), 1 ,UM each 3' primer (PZ.4A and PZ.4B), 1 ,ug of genomic DNA, and 2.5 U Taq polymerase (Perkin-Elmer Cetus). Before the first cycle, samples were heated to 94°C for 10 min. Each thermal cycle consisted of the following steps: 1 min at 94°C, 2 min at 55°C, and 1 min at 72°C; 40 cycles were performed. In the final cycle, the incubation at 72°C was extended to 7 min. After amplification, the mixture was extracted with chloroform, precipitated in ethanol, digested with the NotI restriction endonuclease, and cloned at the Notl site of pBluescript-SK (pBS-SK). Nucleotide sequences were determined by the dideoxynucleotide chain termination method (39), using Sequenase (United States Biochemicals). The oligonucleotide primers used in the polymerase chain reactions were 5'-TTTlGCGGCCGCTTTTl-lGACTAAGCGG AGCAC-3' (PZ.7C, DQ52 specific); 5'-TIfC G.CTT TTTTGT(G/C)AAGG(G/T)ATCTAC-3' (PZ.7A, Dsp2 and DFL16 specific); 5'-TTTCQGQCCG.CACCTGAGGAGAC GGTGA-3' (PZ.4A, specific for the 3' flanks of JH1, 2, and 4); and 5'-lT-lGCGGiCCGCACCTGCAGAGACAGTGAC3' (PZ.4B; specific for the 3' flank of JH3). The Notl recognition sequences within the primers are underlined. Preparation and analysis of RNA. Total cellular RNA was isolated by organic extraction (10). RNA was fractionated by electrophoresis through a 1% agarose gel containing 6.6% formaldehyde and transferred to nylon (Amersham) as described previously (38). Oligonucleotide probes were labeled as described previously (27), with modifications. The probes (see Fig. 2A) were 34 nucleotides (nt) long and consisted of a 21-nt region specific for a given D family and a 12-nt common annealing region at the 3' end. A 22-mer template oligonucleotide, consisting of a 12-nt 3' region complementary to the common annealing region and (dT)10 at the 5' end (see Fig. 2A), was annealed to each probe, and extension was carried out in the presence of a-32P-dATP by the large fragment of DNA polymerase I as described previously (27). Products were extracted with phenol, and the labeled oligonucleotide was recovered by precipitation in ethanol. Hybridization to radiolabeled oligonucleotides was carried out as described previously (33). Membranes were treated for 24 h at 37°C with a solution containing 5 x SSC, 20 mM NaH2PO4-Na2HPO4 (pH 7.0), lOx Denhardt's solution, 7% SDS, and 100 ,ug of heat-denatured salmon sperm DNA per
2098
ALESSANDRINI AND DESIDERIO
ml. Hybridization was performed in a solution containing 5 x SSC, 20 mM NaH2PO4-Na2HPO4 (pH 7.0), 1Ox Denhardt's solution, 7% SDS, 10% dextran sulfate, 100 ,ug of heatdenatured salmon sperm DNA per ml, and 32P-labeled, D-specific oligonucleotide (8.2 x 107 to 1 X 108 cpM/ml; specific activity, 21,000 to 26,000 Ci/mmol) for 5 h at 37°C. Filters were washed in a solution containing 3 x SSC, 10 mM NaH2PO4-Na2HPO4 (pH 7.0), 5 x Denhardt's solution, and 5% SDS for 1 h and then in 1 x SSC-1% SDS for 1 h at 52°C (DSP2 and DFL16 probes) or 56°C (DQ52 probe). 32p was detected by autoradiography. A double-stranded probe specific for the 3' flank of DQ52 was obtained as follows. The 2.2-kb XbaI-HindIII fragment of pRI-JH (4), spanning the unrearranged DQ52 segment, was cloned into pBS-SK to yield pBS-DQ52. Cleavage of this plasmid with Sacl and BamHI yielded a 217-bp probe specific for the 3' flank of DQ52. This was labeled with 32P by the random primer method (17), and hybridization was carried out for 20 h at 42°C in 50% formamide-0.6 M NaCl-0.075 M sodium citrate-0.065 M KH2PO4-0.005 M Na2EDTA-lx Denhardt's solution-100 ,ug of heat-denatured salmon sperm DNA per ml-106 cpm of heat-denatured probe per ml. The filter was washed in 2x SSC-0.1% SDS for 1 h at 65°C. DQ52-containing transcripts were analyzed with oligonucleotide probes specific for the 3' and 5' flanks of DQ52 as follows. A sense transcript spanning the unrearranged DQ52 segment was synthesized in vitro with T7 RNA polymerase (Stratagene) from 1 ,ug of pBS-DQ52 that had been linearized with HindlIl (see Fig. 4A). Total cellular RNA (20 ,ug) from clone 93 was fractionated alongside the in vitro transcript (2 ng each) by electrophoresis through a 1% agarose-6.6% formaldehyde gel, and RNA was transferred to nylon (Amersham). The filter was hybridized to the 32P-labeled DQ52 5' oligonucleotide (see Fig. 3A) as described above. After autoradiography, the filter was heated to remove the 5' probe and then reprobed with a 32P-labeled DQ52 3' oligonucleotide (5'-GTTGAGCCACGTGTCACCGTGCGCCAGT CAAGCG-3', corresponding to the antisense sequence at the immediate 3' flank of DQ52). Hybridization was quantitated by autoradiography and densitometry. Si nuclease protection assays. To obtain a probe specific for DsP22-containing transcripts, a template plasmid (pHAFTL-1-14.53) was first constructed by a polymerase chain reaction-based procedure as described above, with the following modifications. Genomic DNA (1 jig) from HAFTL-1-14-53 was amplified in a reaction containing primers SD158 (5'-GGCCCCCACTACCAGGTCCCCACTAC CAGGCTT-3', complementary to a site 639 bp 5' of DSP2.2) and PZ.4A. The 746-bp amplification product was digested with the BgIII and NotI restriction endonucleases to yield a 548-bp DNA fragment spanning the DsP2 2-JH4 rearrangement from HAFTL-1-14-53. This was cloned between the BamHI and Notl sites of pBS-SK to yield pHAFTL-1-14-53. This plasmid (18 ,ug) was denatured in 0.2 N NaOH for 5 min at room temperature and precipitated in ethanol. The pellet was resuspended and annealed to oligonucleotide SD25 (5'-CACAGTAGTAGATCCCTTGAC-3'), which had been labeled with 32P at its 5' end by polynucleotide kinase (specific activity, 6,000 Ci/mmol). Annealing was carried out for 15 min at 40°C in a 69-,ul reaction mixture containing 10 mM Tris-HCl, 10 mM MgCl2, and 100 ng of SD25. The reaction was made 800 jiM (each) in dGTP, dATP, dTTP, and dCTP; 5 U of DNA polymerase I large fragment was added, and the reaction mixture was incubated for 1 h at 37°C. After being heated to 65°C for 5 min, the DNA was
MOL. CELL. BIOL.
digested with 100 U of EcoRI for 1 h at 37°C. DNA was recovered by precipitation in ethanol; the pellet was taken up in 1 x alkaline loading buffer (30 mM NaOH, 1 mM EDTA [pH 8.0], 10% Ficoll, 0.025% bromcresol green) and fractionated by electrophoresis through a 1% low-melting-point agarose gel in 30 mM NaOH-1 mM EDTA (29), and a 499-nt, single-stranded, radiolabeled probe was isolated. Si nuclease assays of DJH transcripts were performed as described previously (16), with the following modifications. Total cellular RNA (20 jig) was annealed with 0.02 pmol of the DSP22 probe for 12 h at 45°C in a 20-jIl reaction containing 80% formamide, 40 mM PIPES [piperazine-N,N'bis(2-ethanesulfonic acid)] (pH 6.4), 1 mM EDTA, and 400 mM NaCl; 280 [lI of a solution containing S1 nuclease (Boehringer-Mannheim; 0.3 U/pl), 280 mM NaCl, 50 mM sodium acetate (pH 4.5), and 4.5 mM ZnSO4 was added, and the reaction was incubated for 1 h at 25°C. Products were fractionated by electrophoresis through 8% polyacrylamide-7 M urea; 32p was detected by autoradiography. S1 nuclease assays of ,-tubulin transcripts were performed as described previously (19), using as a probe the plasmid pm,B5 (a gift of D. Cleveland), which was linearized with the XhoI restriction endonuclease and labeled at both 5' ends with 32P by polynucleotide kinase. DsP2-chloramphenicol acetyltransferase (CAT) expression plasmids. A 5.5-kb EcoRI fragment, containing the DSP2-JH3 rearrangement from cell line 300-19 (34), was molecularly cloned into the EcoRI site of the bacteriophage vector X-ZAP and subcloned into pBS-SK. The resulting plasmid was digested with PstI, and a 2.3-kb fragment, spanning bp -2263 to +37 relative to the start of the DSP2JH3 coding sequence, was purified. This fragment (3 jig) was digested with 1 U of nuclease Bal31 (New England BioLabs) for 30 s at 17°C in a 30-jil reaction containing 200 mM NaCl, 20 mM Tris-HCl (pH 8.0), 12 mM CaC12, 12 mM MgCl2, and 1 mM EDTA. The reaction was stopped by the addition of 20 mM EGTA [ethylene glycol-bis(P-aminoethyl ether)-N,N,N',N'tetraacetic acid]. The DNA was extracted with phenol and precipitated in ethanol; ends were made blunt by treatment with 5 U of DNA polymerase I large fragment (BoehringerMannheim) for 30 s at 37°C in a 50-pl reaction mixture containing 50 mM Tris-HCI (pH 7.5), 10 mM MgCl2, 1 mM dithiothreitol, and 50 jig of bovine serum albumin per ml. After extraction with phenol and precipitation in ethanol, the DNA was digested with the BamHI restriction endonuclease and products, ranging in size from 872 to 913 bp, were purified by electrophoresis and cloned into the plasmid pGCATm (a gift of Marylin West and Jeffry Corden) between the BglII and StuI restriction sites. One resulting plasmid, pDSP2CAT, contains a portion of the DSP2JH sequence spanning -876 to + 19 bp relative to the start point of DSP2JH transcription (as defined by S1 nuclease protection and primer extension [34 and data not shown]), fused to the CAT reporter gene (see Fig. SA). The plasmids pRXDsP2CAT and pXRDSP2CAT (see Fig. SA) were derived from pDSP2CAT as follows. A 991-bp XbaI fragment, containing the IgH enhancer, was isolated from ppu (22) (a gift of R. Grosschedl) and cloned in either orientation into the XbaI restriction site of pDSP2CAT, which lies at -939 bp relative to the DSP2JH transcription start point. Deletion mutagenesis of pRXDsp2CAT. The plasmid pRXDsP2CAT (5 jig) was digested with the ApaI and BssHII restriction endonucleases, which cleave 883 and 881 bp upstream of the DsP2JH transcription start point, respectively. The DNA was then digested with 180 U of exonuclease III (Promega) at 29°C in a 60-jil reaction mixture con-
VOL. 11, 1991
taining 66 mM Tris-HCl (pH 8.0) and 0.66 mM MgCl2. Aliquots (0.2 ,ug of DNA) were taken at 0.5, 1.0, 1.5, 2.0, 2.5, 3.0, 4.0, 5.0, 6.0, 7.0, and 10.0 min and treated with 2.3 U of S1 nuclease (Promega) for 30 min at room temperature in a 10-,u reaction mixture containing 255 mM NaCl, 30 mM potassium acetate (pH 4.6), 1 mM ZnSO4, and 5% glycerol. Reactions were stopped by the addition of Tris base to 30 mM and EDTA to 5 mM, and then the mixtures were heated to 70°C for 10 min. DNA ends were made blunt by treatment with 0.17 U of DNA polymerase I large fragment for 3 min at 37°C in a 12-,u reaction mixture containing 1.7 mM Tris-HCl (pH 8.0) and 8.3 mM MgCl2. To the reaction were then added dGTP, dATP, dTTP, and dCTP each to 10 mM, and incubation was continued for 5 min at 37°C. The products were then ligated for 13 h at 14WC in a 50-pI reaction mixture containing 80 mM MgCl2, 40 mM Tris-HCl (pH 7.6), 8 mM ATP, and 0.2 U of T4 DNA ligase (Promega). Aliquots (10 pI) were taken from each reaction for transformation of the Escherichia coli strain DH1 (23). The nucleotide sequences of the resulting plasmids in the vicinity of the deletions were determined by the dideoxynucleotide chain termination method (39). DNA transfections and CAT assay. Cells were transfected as described by Grosschedl and Baltimore with modifications (22). The cell line 300-19 was grown to a density of 1.1 x 106 to 1.5 x 106 cells per ml. For each transfection, 2 x 107 cells were washed twice in phosphate-buffered saline-EDTA (137 mM NaCl, 8 mM Na2HPO4 H20, 1.1 mM KH2PO4, 2.7 mM KCl, 0.5 mM EDTA), washed twice in TS (137 mM NaCl, 25 mM Tris-HCl [pH 7.5], 5 mM KCl, 0.37 mM Na2HPO4 7H20, 0.68 mM CaCl2, 1 mM MgCL2, and resuspended in 1 ml of TS containing 2.5 p.g of plasmid DNA per ml and 0.25 mg of DEAE-dextran (molecular weight, 5 x 107; Pharmacia) per ml. After incubation for 30 min at room temperature, 10 ml of RPMI 1640 supplemented with 20% fetal bovine serum and 0.18 mM chloroquine diphosphate (Sigma) was added, and the suspension was incubated for an additional 30 min at 37°C. The cells were collected by centrifugation and resuspended in 50 ml of RPMI 1640 supplemented with 20% fetal bovine serum. After 45 to 48 h at 37°C, cells were harvested and extracts were prepared as described previously (30). Transfections of experimental plasmids and control transfections of pSV2CAT (21) were performed in parallel. After 45 to 48 h at 37°C, cells were harvested and extracts were prepared. Cells were washed twice in phosphate-buffered saline and once in 40 mM Tris (pH 7.4)-i mM EDTA-150 mM NaCl and were resuspended in 65 of 250 mM Tris (pH 8.0). Cells were then lysed by freeze-thawing (three times). Lysates were heated for 10 min at 60°C and clarified by centrifugation at 12,000 x g for 5 min at 4°C. Extracts were assayed for protein by the method of Bradford (9). Extracts (50 pA) were assayed for CAT assay in a total volume of 150 plA containing 470 mM Tris (pH 8.0), 0.5 mM acetyl coenzyme A, 2 of [14C]chloramphenicol (60 mCi/ mmol; DuPont-NEN). Samples were incubated at 37°C for 8 h, at which time acetylation had been determined to proceed linearly (data not shown). Acetylated derivatives were separated from chloramphenicol by thin-layer chromatography and 14C counts per minute in acetylated and unacetylated forms were determined by scintillation spectrometry. Percent conversion per microgram of protein (C) was calculated from the formula:
IMMUNOGLOBULIN DJH TRANSCRIPTION
(
AcCm
2099
\
x 100 AcCm + Cm micrograms of protein
where AcCm and Cm refer to "'C counts per minute recovered as acetylated and unacetylated chloramphenicol, respectively. The values of C obtained for cells transfected with the test plasmids (Cexp) were normalized to those obtained with pSV2CAT (C,v). Values of Cexp/Csv were determined for each of three trials, and the mean and standard deviation of the mean were calculated. RESULTS Hybridization assay for D-to-JH rearrangements in the Ha-MSV-transformed cell line HAFTL-1. To test the idea, advanced by Reth and Alt (34), that activation of DJH transcription is coordinated with D-to-JH rearrangement, we examined these processes in the Ha-MSV-transformed cell line HAFTL-1, which undergoes continuing D-to-JH joining during propagation in culture (la). A primary clone of HAFTL-1, designated HAFTL-1-14, had been previously isolated and characterized (la). HAFTL-1-14 carries a single germ line H allele that undergoes D-to-JH rearrangement; the other allele had undergone spontaneous deletion of its D and JH segments. The presence of a single H allele in HAFTL1-14 simplified analysis of D-to-JH joining and made it possible to observe DJH transcription as a function of D-to-JH rearrangement. The HAFTL-1-14 clone was expanded to 107 cells, and subclones were isolated by limiting dilution. Of 128 subclones obtained, 97 were selected at random and expanded to 2 x 107 cells. Genomic DNA and total cellular RNA were prepared from each subclone. DNA was digested with EcoRI and assayed for D-to-JH rearrangement by hybridization to JH- and D-specific probes (4, 5). Of the 97 clones analyzed, 92 yielded a single predominant JH-containing fragment. In 40 clones, the JH probe hybridized to a unique 6.2-kb EcoRI fragment that comigrated with the fragment detected in mouse liver DNA (Fig. 1A, lane 1 versus lanes 3, 4, 6, 9, 10, 12, and 15, and data not shown), suggesting that the H locus in these clones is predominantly unrearranged. This interpretation was supported by the observation that a probe specific for the 5' flank of DQ52 hybridized to a fragment of the same size (Fig. 1B), because DQ52 is the most JH-proximal D segment, and joining of any other D segment to a JH segment would have resulted in deletion of DQ52. Joining of DQ52 to JH was expected to yield a family of fragments 4.3 to 5.5 kb long that hybridized to the JH and DQ52 probes. Such a fragment was observed in each of 22 clones, suggesting that in these cells DQ52-to-JH rearrangement had occurred (Fig. 1A and B, lanes 2, 7, 11, 13, and 16, and data not shown). Consistent with this interpretation was the observation that in these clones the DSP2 and DFL16 segments are unrearranged (Fig. 1C). In 30 clones the DQ52 segment was deleted and the JH probe detected a unique, rearranged EcoRI fragment that also hybridized to the combined DSP2 and DFL16 probes (Fig. 1A and C, lanes 5, 14 and 17, and data not shown), indicating that these cells had undergone DSP2- or DFL16-to-JH rearrangement. Of the 52 clones that yielded a unique rearranged EcoRI fragment, 22 (42%) had undergone DQ52-to-JH joining and 30 (58%) had undergone DSP2- or DFL16-to-JH joining. Assuming that the parental cell line contains one DQ52 segment and 12 DsP2 or DFL16 segments (25, 44), we observed a 9:1 bias
~ wit
ALESSANDRINI AND DESIDERIO
2100
2 3 4 5
1
A
B
C_
_
6 7
8
9 10 11
-
MOL. CELL. BIOL.
12 13 14 15 16 17 18
W1W
ON:
FIG. 1. Assay for D-to-JH rearrangement in clones of the HAFTL-1-14 cell line. Genomic DNA (10 ,ug) from mouse liver (lane 1) or from subclones of HAFTL-1-14 (lanes 2 through 18) was digested with EcoRI, fractionated by electrophoresis through 0.8% agarose, transferred to nitrocellulose, and hybridized to JH- and D-specific probes as described in Materials and Methods. (A) Hybridization to the JH-specific probe. (B) Hybridization of the same filter to the DQ52-specific probe, after removal of the JH specific probe. (C) Hybridization of the same filter to combined DSP2- and DFLl6-specific probes, after removal of the DQS2-specific probe. The dashes at left indicate the positions of 23.1-, 9.4-, 6.6-, 4.4-, and 2.3-kb DNA markers.
in favor of clones carrying DQ52 rearrangements. Similar overrepresentation of clones carrying DQ52 rearrangements has been observed among human B-cell progenitors transformed with the Epstein-Barr virus (32). Molecular cloning of D-to-JH rearrangements and nucleotide sequence analysis. To confirm the results of the hybridization assay, and to obtain specific probes for DJH tran-
scripts (see below), JH-associated rearrangements were molecularly cloned from cells predicted to have undergone DQ52-to-JH and DSP2- or DFL16-to-JH joining. In each case, the nucleotide sequence of the recombinant agreed with the prediction of the hybridization assay. Clones HAFTL-114-64 (clone 64) and HAFTL-1-14-65 (clone 65) were found to carry independent DQ52-JH rearrangements; clones HAFTL-1-14-53 (clone 53) and HAFTL-1-14-83 (clone 83) carry independent DsP2-JH rearrangements; and HAFTL-114-47 (clone 47) carries a DFL16-JH rearrangement (Fig. 2). DFL16-JH rearrangements from three other clones-HAFTL1-14-54, 71, and 79-had nucleotide sequences that were identical to that of clone 47, implying that these clones inherited the same rearrangement from a common progenitor (data not shown). Distal D segments exhibit coordinate regulation of D-to-JH
joining and DJH transcription. A survey of lymphoid cell lines for the presence of DJH transcripts by Reth and Alt showed that cell lines carrying DsP2-JH rearrangements
expressed DsP2-specific transcripts, while cell lines with DFL16-JH rearrangements expressed DFL16-specific transcripts (34). The availability of a cell line that undergoes D-to-JH joining during propagation in culture made it possible to examine this relationship directly, among progeny of a single cell. To assay DJH transcripts, we employed three oligonucleotide probes, each specific for one of the D segment families. The 5' ends of the probes were complementary to the 21 nucleotides immediately upstream of the D coding sequences, and the 3' ends of the probes were complementary to the 3' end of a common template oligonucleotide (Fig. 3A). The D probes were annealed to the template oligonucleotide and labeled by extension in the presence of [a-32P]dATP. The probes were tested separately for hybridization to total cellular RNA from cell lines carrying DQ52-, DSP2-, or DFL16-JH rearrangements, or from a cell line (HAFTL-1-14-5) that had undergone spontaneous deletion of both H alleles. Each probe exhibited specificity for RNA from the cell line carrying the cognate rearrangement (Fig. 3B, lanes 1 to 4). Thus, the assay could discriminate among transcripts from each of the three D families and was sensitive enough to allow measurements to be made with total cellular RNA. Eight clones carrying a predominantly unrearranged JH allele and eight clones with D-JH rearrangements were assayed with these probes for the presence of D-containing RNA. The DsP2 probe hybridized to a 2,100-nt species in RNA from the cell line 300-19, which previously had been shown to express a DSP2-containing transcript (34), and from clone 53, which carries a DSP2 2-JH4 rearrangement (Fig. 3B, panel a, lanes 3 and 14). The DFL16 probe detected a species of similar size in control RNA from HAFTL-1-14-6, in which DFL16.1 is joined to JH2 (la), and in RNA from clones 47, 54, 71, and 79, all of which carry a DFL16-JH4 rearrangement (Fig. 3B, panel b, lanes 2, 13, 15, 18, and 19). None of the eight unrearranged clones showed detectable hybridization to the DSP2 or the DFL16 probes (Fig. 3B, panels a and b, lanes 5 through 12). In addition, the DsP2 probe failed to detect transcripts in RNA from clone 83 (Fig. 3B, panel a, lane 20), which, like clone 53, carries a DsP2 2-JH rearrangement. A nuclease protection assay, however, did reveal DsP2.2-containing transcripts in clone 83, albeit at a lower level than in clone 53 (see below). With this exception, all progeny of HAFTL-1-14 that had undergone DSP2- or DFL16tO-JH joining were found by the oligonucleotide hybridization assay to express D-containing transcripts, specific for the rearranged D segment; these transcripts were not detectable in the unrearranged progeny. Accumulation of DQS2JH transcripts is independent of DQ52to-JH rearrangement. The DQ52 probe hybridized to RNA from HAFTL-1-14-101 and from clones 64 and 65, which had undergone independent DQ52-to-JH rearrangements (Fig. 3B, panel c, lanes 4, 16, and 17). Unlike the DSP2 and DFL16 probes, the DQ52 probe also detected transcripts in each of the unrearranged clones (Fig. 3B, panel e, lanes 5 to 12). These could have originated from the unrearranged DQ52 segment or from a subpopulation of cells carrying DQ52-JH rearrangements. We considered the second possibility less likely, since neither DSP2- nor DFL16-containing transcripts were detected in the unrearranged clones, despite the fact that clones of cells carrying DsP2 and DFL16 rearrangements were obtained at greater frequency than those with DQ52 rearrangements. Transcription of the unrearranged DQ52 segment would not be inconsistent with the hypothesis that
GTS AC TAG TCAG
IMMUNOGLOBULIN DJH TRANSCRIPTION
VOL. 11, 1991 HAFTL-1-14-47
DFL1 6.1 CTTTTTG TGAAGGGATCTAC
T
TTATTACTACG T TA
Clone47 CTTTTTGTGAAGGGATCTACT JH4
DSP2. 2
A
TGCTATGGACTACTGGGGTC.
GGGATCTACT
GGTTTTGTCGGGTACAGAGGAAAAACCCACTAT
BAFTL-1-14--64
. .
r-
--,-%~~~~~~~~~~~~~~~~~~~
TACTATGCTATGGACTACTGGGGTC...I
GToTTTGACTAAGCGGACGAC
GC7GACrACGGTrv.
Clone64
%--3rL-TWUACTAAGCGGACGAC
GGdACtGGTTTGCTTACTGGGGCCAAGGGA...I
Clone65
CTTTTG&CTAAGCGGACGACC&TAGCi CTTSTGL,ALTAA.GCGGACGACC
JH2
BAFTL-1-14-83 DSP2. 2
_CAAGGGA...I
A!TTA!GTGCAGGGGTCTAATCATTGTTGT
BAFTL-1-14-65 DQ52
AII
...
DQ52
JH3
I
* *
CAAGGGATCTACI TATGCTATGGACTACTGGGGTC...I
Clone53
JH4
...
GGTTTTGTCGGGTACAGAGGAAAAACCCACTTTTATGCTATGGACTACTGGGGTC.
BAFTL-1-14-53
2101
{M~~
CTA
C.....
CTACTTTGACTACTGGGGCCAAGGCA.
..
CTACTTTGACTACTGGGGCCAAGGCA...
GGGATCTAC
Clone83 A3SSTSTGTCAAGGGATCTAC
LTGGATTACGACGGG7pkCTACTTTGACTACTGGGGC
*
*
-
GGTTTTTGTACACCCACTAAAGGGGTCTATGA TTGTACTGGG JH2 FIG. 2. Nucleotide sequences at D-JH junctions in HAFTL-1-14 clones. The D-JH junctions from HAFTL-1-14 clones 47, 53, 64, 65, and 83 were molecularly cloned and their nucleotide sequences were determined as described in Materials and Methods. For each cell clone, the middle line represents the nucleotide sequence spanning the recombinant junction, the top line represents the corresponding germ line D sequence, and the bottom line represents a part of the corresponding JH sequence. The heptamer and nonamer recombinational signals are shown in boldface. Stippled and open boxes denote nucleotides derived from D and JH coding sequences, respectively. Junctional nucleotides not encoded by the germ line sequences (N regions) are shown in italics. The recombined D segment in clone 47 differs at two positions from the published sequence of DFL161; these residues are underlined.
DJH transcription is enhancer dependent, since the DQ52 segment lies within 700 bp Of JH1This issue was resolved by the following experiments, which demonstrated that most of the DQ52JH transcripts detectable in predominantly unrearranged clones originated from the unrearranged DQ52 segment. First, to determine whether the unrearranged DQ52 segment is transcribed in these cells, RNA was assayed for hybridization to a probe specific for the 3' flank of DQ52. If the DQ52-containing RNA in predominantly unrearranged clones were transcribed from rearranged DQ52 segments, then it would not hybridize to the probe, because the 3' flank of DQ52 would be deleted on joining to JH. A 217-bp probe specific for the 3' flank of DQ52 hybridized to RNA present in the germ line clones (Fig. 3B, panel d, lanes 5 through 12), indicating that the unrearranged DQ52 segment is transcriptionally active. We then estimated the proportion of DQ52-containing transcripts in a predominantly unrearranged clone that originated from the unrearranged DQ52 segment. Filters containing total cellular RNA from clone 93 and an in vitro transcript spanning the unrearranged DQ52 segment (Fig. 4A) were hybridized to DQ52specific 5' and 3' oligonucleotides as described in Materials
and Methods. Hybridization of 5' and 3' probes to RNA from clone 93 was quantitated by densitometry, and each value was normalized to the signal observed upon hybridization to the in vitro transcript. This analysis indicated that most of the DQ52-containing RNA in clone 93 originated from the unrearranged DQ52 segment (Fig. 4B). The steady-state levels of DQ52JH transcripts did not change greatly upon DQ52-to-JH joining (Fig. 3B, panel e). Analysis by Si nuclease protection and primer extension showed that DQ52JH transcripts in unrearranged (HAFTL-1-14-102) and rearranged (HAFTL-1-14-101) cell clones initiated at identical sites within the 5' flank of DQ52 (data not shown). Transcription of an Ds52 gene segment is enhanced upon D-to-JH joining. To determine the relative levels of DJH transcription in rearranged and unrearranged clones, we used an S1 nuclease protection assay. A probe specific for the DJH transcript expressed in HAFTL-1-14-53 was obtained by molecular cloning of the Dsp2-JH junction and 480 bp of its 5' flank. A 21-nt synthetic primer, complementary to a site immediately upstream of the D segment on the coding strand, was radiolabeled at its 5' end, annealed to the Dsp2-JH junction fragment, and extended. The product was
2102
ALESSANDRINI AND DESIDERIO
MOL. CELL. BIOL.
A DSP2.1,
GTCAAGGGATCTAACT .TG
J
SCGAACT GAC.".C
T TAGATA .CT AC7C -C
C
-
ACTAAGCGGAGCACL&9G 3 'GCGAACT GA CC G' A-C C --ko''
MOLECULAR AND CELLULAR BIOLOGY, Apr. 1991, p. 2096-2107 0270-7306/91/042096-12$02.00/0 Copyright © 1991, American Society for Microbiology
Coordination of Immunoglobulin DJH Transcription and D-to-JH Rearrangement by Promoter-Enhancer Approximation ALESSANDRO ALESSANDRINI AND STEPHEN V. DESIDERIO Department of Molecular Biology and Genetics and Howard Hughes Medical Institute, The Johns Hopkins University School of Medicine, Baltimore, Maryland 21205 Received 20 November 1990/Accepted 24 January 1991
The genes that encode the variable regions of immunoglobulin (Ig) heavy chains are encoded by three DNA segments: VH, D, and JH. During B-cell development these segments are brought together by a pair of sitespecific DNA rearrangements. The first of these joins a D segment to a JH segment; the second brings a VH segment in apposition to a DJH unit. B-cell precursors that have undergone D-to-JH joining express transcripts that initiate at the 5' flanks of rearranged D segments (DJH transcription). In this study we have examined the coordination of D-to-JH rearrangement and DJH transcription. The B-lymphoid progenitor cell line HAFTL-1 undergoes D-to-JH rearrangement when propagated in culture. In progeny of a single HAFTL-1 cell clone, joining of distal D segments (DSP2 and DFL16) to JH is accompanied by an increase in the steady-state level of transcripts initiating 5' of the D coding region. Steady-state transcription of a Dsp2 gene segment was undetectable prior to rearrangement and was observed to increase at least 20-fold upon joining to JH. In contrast, transcription from the 5' flank of DQ52, which lies within 700 bp of the JH cluster, was detected prior to rearrangement and did not increase significantly after rearrangement. The 5' flank of a DsP2 segment was found to support expression of a heterologous gene upon transfection into B progenitor cell lines. Expression from this Dsp2 promoter was at least 30-fold higher in the presence of the Ig heavy-chain enhancer, in either orientation, than in its absence. A DNA fragment spanning the interval from -165 to + 19 bp relative to the major Dsp2 transcriptional start site retained enhancer-dependent promoter activity. These observations imply that activation of DSP2JH and DFL16JH transcription is coordinated with D-to-JH rearrangement by approximation of enhancer-dependent D promoter elements to the Ig heavy-chain enhancer. This interpretation is consistent with our observation that the DQ52 segment, which is closely linked to the JH cluster, is transcribed both before and after rearrangement.
continue to be expressed; in addition, transcripts that initiate at the 5' flank of D (DJH transcripts) are detected (34). After VH-to-DJH joining, the predominant Cp.-containing RNAs in B-lymphoid cells are transcribed from a promoter at the 5' flank of VH (11, 22); these transcripts, termed p.. and Fs, encode membrane-bound and secreted forms of p. chain, respectively (2, 15, 36). Transcription from the VH promoter is stimulated by the H enhancer (6, 20), suggesting that its activation upon VH-to-DJH joining is effected, at least in part, by its approximation to the enhancer. Loci that have undergone VH-to-DJH joining continue to express Sp. transcripts, although the steady-state level of these transcripts remains low, relative to pm and ,w (24). Thus, at each stage in rearrangement, a distinct set of Cp.-containing transcripts is expressed from the H locus. The observation that Ig gene rearrangement is ordered during B-cell development implies that at different stages in ontogeny, recombination is restricted to distinct subsets of gene segments. Because Ig gene segments are rearranged by a common apparatus (45) and share similar recombinational signal sequences (42), it is unlikely that this restriction is effected at the substrate level. While the mechanisms that establish the sequence of Ig gene rearrangement during ontogeny are not yet established, several lines of evidence support the hypothesis that rearrangement of a given gene segment is facilitated by transcription at a nearby site (8, 43). First, rearrangement of exogenous, integrated substrates in pre-B-cells is positively correlated with expression of a linked genetic marker (8). Second, in transgenic mice carrying an artificial substrate for TCR,I gene rearrangement, Df0-to-J joining is observed in lymphoid cells only when
The variable regions of immunoglobulin (Ig) chains are encoded by discrete germ line DNA segments that are joined by an ordered series of site-specific rearrangements during lymphocyte differentiation (reviewed in references 7 and 42). The variable regions of Ig heavy chains (IgH regions), for example, are encoded by three elements, VH, D, and JH (14, 37). In mice, D segments fall into three families on the basis of nucleotide sequence: DSP2, containing at least nine members; DFL16, with at least two members; and DQ52, with a single member (25, 44). The DSP2 and DFL16 families form a cluster occupying a 70-kb region; this is separated from the cluster of four JH segments by 19.5 kb of DNA. The DQ52 segment, in contrast, is closely linked to the JH cluster, lying 696 bp to the 5' side of JH1 (44). Assembly of H genes initiates with the joining of a D segment to a JH segment; a VH segment is then added to form a complete VH-D-JH unit (5). Rearrangement of Ig light-chain gene segments begins only after assembly of a functional H gene (4, 35). The genes that encode T-cell antigen receptors (TCR) show similar patterns of segmentation and rearrangement (13). Ig and TCR gene rearrangements play a central role in establishing the primary immune repertoire, because they generate a diverse set of antigen receptors from a relatively small number of gene segments. IgH gene assembly is accompanied by ordered, sequential transcriptional activation at the H locus. Before rearrangement, B-cell progenitors express a form of C,u-containing RNA that does not support synthesis of p. protein (sterile or Sp. transcripts [3, 24, 31]). These transcripts initiate within the JH-C intron (28), from a promoter that resides in the H enhancer (41). After D-to-JH rearrangement, Sp. transcripts 2096
VOL . 1 l, 1991
these segments are linked to the IgH enhancer (18). Third, rearrangement of the K IOCUS in pre-B-cell lines carrying nonproductive rearrangements at both H alleles can be induced by treatment with lipopolysaccharide; under these conditions, activation of rearrangement is accompanied by induction of sterile transcription at the Ig K locus (40). These observations suggest that transcription and rearrangement share common elements of control. The function of DJH transcripts, which arise from partially assembled H genes, is not known. While in some instances DJH transcripts support synthesis of truncated ,u chains (34), the significance of these products is not clear, since productive D-to-JH rearrangement is apparently not required for subsequent VH-to-DJH joining (12). The relationship between transcriptional activation and Ig gene rearrangement suggests that DJH transcription may facilitate recombination. The potential importance of DJH transcription in the regulation of rearrangement led us to examine the mechanism whereby DJH transcription is activated during IgH gene assembly. Activation of DJH transcription has been proposed to occur when D-to-JH rearrangement brings the 5' flank of D in proximity to the H enhancer (34), by analogy to activation of transcription from the VH promoter. We have described a B-lymphoid progenitor cell line, HAFTL-1, that actively joins D segments to JH segments when propagated in culture (la). This cell line allowed us to test the hypothesis that D-to-JH rearrangement is accompanied by activation of DJH transcription. Using oligonucleotide probes specific for each of the three D segment families, DSP2, DFL16 and DQ52, we assayed DJH transcripts in progeny of a single HAFTL-1 cell clone. We observed that joining of distal D segments (DSP2 or DFL16) to a JH segment is accompanied by specific activation of transcription from the 5' flank of the rearranged D segment. In contrast, transcription from the 5' flank of DQ52, which lies within 700 bp of the JH cluster, was detected prior to rearrangement and did not increase significantly after rearrangement. The 5' flanking sequence of a Dsp2-JH recombinant was shown to support expression of a heterologous gene upon transfection into B-progenitor cell lines. Significantly, expression from the DsP2 promoter was at least 30-fold higher in the presence of the IgH enhancer, in either orientation, than in its absence. A 184-bp DNA fragment, spanning the interval from -165 to + 19 bp relative to the major DsP2 transcriptional start site, retained enhancer-dependent promoter activity. Taken together, these observations demonstrate that activation of DsP2JH and DFL16JH transcription is coordinated with D-to-JH rearrangement and suggest that this coordination occurs by approximation of an enhancer-dependent D promoter element to the IgH enhancer. This interpretation is consistent with our observation that the DQ52 segment, which is closely linked to the JH cluster, is transcribed in HAFTL-1 in the unrearranged and rearranged states. MATERIALS AND METHODS Cell lines and culture. The Harvey murine sarcoma virus (Ha-MSV)-transformed cell line HAFTL-1-14 (la) and the Abelson murine leukemia virus (Ab-MuLV)-transformed cell line 300-19 (4) were maintained in RPMI 1640 supplemented with 10% fetal bovine serum and 50 ,uM 2-mercaptoethanol. Cells were cloned by limiting dilution at 0.11 to 0.18 cells per microtiter well. Preparation and analysis of genomic DNA. Genomic DNA was prepared as described previously (la). DNA probes
IMMUNOGLOBULIN DJH TRANSCRIPTION
2097
were labeled to a specific activity of 108 to 109 cpm/l,g with 32P by the random primer method (17). Hybridization was carried out for 20 h at 42°C in 50% formamide-0.6 M NaCI-0.075 M sodium citrate-0.065 M KH2PO4-O.005 M Na2EDTA-1x Denhardt's solution (0.02% each bovine serum albumin, Ficoll, and polyvinylpyrrolidone 360)-100 ,ig
of heat-denatured salmon sperm DNA per ml-106 cpm of heat-denatured probe per ml. Filters were washed at 65°C for 1 h in 2x SSC (lx SSC is 0.150 M NaCl-0.015 M sodium citrate)-0.1% sodium dodecyl sulfate (SDS); 32P was detected by autoradiography. Probes specific for the JH-C,U intron and the 5' flanking sequences of DFL16 and Dsp2 were prepared from the plasmids PJH800, pJH38B9-7.1, and p40E4-2-5.2 as described previously (5). The 2.2-kb EcoRI-XbaI fragment of pRI-JH (4) was used as a probe for the 5' flank of DQ52Isolation of genomic DNA clones. Rearrangements from selected HAFTL-1-14 clones were amplified by the polymerase chain reaction and molecularly cloned. Amplification reactions (50 Rd) contained 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, 0.001% (wt/vol) gelatin, 200 ,uM each deoxynucleotide triphosphate, 1 ,uM D-specific 5' primer (PZ.7C for DQ52; PZ.7A for Dsp2 and DFL16), 1 ,UM each 3' primer (PZ.4A and PZ.4B), 1 ,ug of genomic DNA, and 2.5 U Taq polymerase (Perkin-Elmer Cetus). Before the first cycle, samples were heated to 94°C for 10 min. Each thermal cycle consisted of the following steps: 1 min at 94°C, 2 min at 55°C, and 1 min at 72°C; 40 cycles were performed. In the final cycle, the incubation at 72°C was extended to 7 min. After amplification, the mixture was extracted with chloroform, precipitated in ethanol, digested with the NotI restriction endonuclease, and cloned at the Notl site of pBluescript-SK (pBS-SK). Nucleotide sequences were determined by the dideoxynucleotide chain termination method (39), using Sequenase (United States Biochemicals). The oligonucleotide primers used in the polymerase chain reactions were 5'-TTTlGCGGCCGCTTTTl-lGACTAAGCGG AGCAC-3' (PZ.7C, DQ52 specific); 5'-TIfC G.CTT TTTTGT(G/C)AAGG(G/T)ATCTAC-3' (PZ.7A, Dsp2 and DFL16 specific); 5'-TTTCQGQCCG.CACCTGAGGAGAC GGTGA-3' (PZ.4A, specific for the 3' flanks of JH1, 2, and 4); and 5'-lT-lGCGGiCCGCACCTGCAGAGACAGTGAC3' (PZ.4B; specific for the 3' flank of JH3). The Notl recognition sequences within the primers are underlined. Preparation and analysis of RNA. Total cellular RNA was isolated by organic extraction (10). RNA was fractionated by electrophoresis through a 1% agarose gel containing 6.6% formaldehyde and transferred to nylon (Amersham) as described previously (38). Oligonucleotide probes were labeled as described previously (27), with modifications. The probes (see Fig. 2A) were 34 nucleotides (nt) long and consisted of a 21-nt region specific for a given D family and a 12-nt common annealing region at the 3' end. A 22-mer template oligonucleotide, consisting of a 12-nt 3' region complementary to the common annealing region and (dT)10 at the 5' end (see Fig. 2A), was annealed to each probe, and extension was carried out in the presence of a-32P-dATP by the large fragment of DNA polymerase I as described previously (27). Products were extracted with phenol, and the labeled oligonucleotide was recovered by precipitation in ethanol. Hybridization to radiolabeled oligonucleotides was carried out as described previously (33). Membranes were treated for 24 h at 37°C with a solution containing 5 x SSC, 20 mM NaH2PO4-Na2HPO4 (pH 7.0), lOx Denhardt's solution, 7% SDS, and 100 ,ug of heat-denatured salmon sperm DNA per
2098
ALESSANDRINI AND DESIDERIO
ml. Hybridization was performed in a solution containing 5 x SSC, 20 mM NaH2PO4-Na2HPO4 (pH 7.0), 1Ox Denhardt's solution, 7% SDS, 10% dextran sulfate, 100 ,ug of heatdenatured salmon sperm DNA per ml, and 32P-labeled, D-specific oligonucleotide (8.2 x 107 to 1 X 108 cpM/ml; specific activity, 21,000 to 26,000 Ci/mmol) for 5 h at 37°C. Filters were washed in a solution containing 3 x SSC, 10 mM NaH2PO4-Na2HPO4 (pH 7.0), 5 x Denhardt's solution, and 5% SDS for 1 h and then in 1 x SSC-1% SDS for 1 h at 52°C (DSP2 and DFL16 probes) or 56°C (DQ52 probe). 32p was detected by autoradiography. A double-stranded probe specific for the 3' flank of DQ52 was obtained as follows. The 2.2-kb XbaI-HindIII fragment of pRI-JH (4), spanning the unrearranged DQ52 segment, was cloned into pBS-SK to yield pBS-DQ52. Cleavage of this plasmid with Sacl and BamHI yielded a 217-bp probe specific for the 3' flank of DQ52. This was labeled with 32P by the random primer method (17), and hybridization was carried out for 20 h at 42°C in 50% formamide-0.6 M NaCl-0.075 M sodium citrate-0.065 M KH2PO4-0.005 M Na2EDTA-lx Denhardt's solution-100 ,ug of heat-denatured salmon sperm DNA per ml-106 cpm of heat-denatured probe per ml. The filter was washed in 2x SSC-0.1% SDS for 1 h at 65°C. DQ52-containing transcripts were analyzed with oligonucleotide probes specific for the 3' and 5' flanks of DQ52 as follows. A sense transcript spanning the unrearranged DQ52 segment was synthesized in vitro with T7 RNA polymerase (Stratagene) from 1 ,ug of pBS-DQ52 that had been linearized with HindlIl (see Fig. 4A). Total cellular RNA (20 ,ug) from clone 93 was fractionated alongside the in vitro transcript (2 ng each) by electrophoresis through a 1% agarose-6.6% formaldehyde gel, and RNA was transferred to nylon (Amersham). The filter was hybridized to the 32P-labeled DQ52 5' oligonucleotide (see Fig. 3A) as described above. After autoradiography, the filter was heated to remove the 5' probe and then reprobed with a 32P-labeled DQ52 3' oligonucleotide (5'-GTTGAGCCACGTGTCACCGTGCGCCAGT CAAGCG-3', corresponding to the antisense sequence at the immediate 3' flank of DQ52). Hybridization was quantitated by autoradiography and densitometry. Si nuclease protection assays. To obtain a probe specific for DsP22-containing transcripts, a template plasmid (pHAFTL-1-14.53) was first constructed by a polymerase chain reaction-based procedure as described above, with the following modifications. Genomic DNA (1 jig) from HAFTL-1-14-53 was amplified in a reaction containing primers SD158 (5'-GGCCCCCACTACCAGGTCCCCACTAC CAGGCTT-3', complementary to a site 639 bp 5' of DSP2.2) and PZ.4A. The 746-bp amplification product was digested with the BgIII and NotI restriction endonucleases to yield a 548-bp DNA fragment spanning the DsP2 2-JH4 rearrangement from HAFTL-1-14-53. This was cloned between the BamHI and Notl sites of pBS-SK to yield pHAFTL-1-14-53. This plasmid (18 ,ug) was denatured in 0.2 N NaOH for 5 min at room temperature and precipitated in ethanol. The pellet was resuspended and annealed to oligonucleotide SD25 (5'-CACAGTAGTAGATCCCTTGAC-3'), which had been labeled with 32P at its 5' end by polynucleotide kinase (specific activity, 6,000 Ci/mmol). Annealing was carried out for 15 min at 40°C in a 69-,ul reaction mixture containing 10 mM Tris-HCl, 10 mM MgCl2, and 100 ng of SD25. The reaction was made 800 jiM (each) in dGTP, dATP, dTTP, and dCTP; 5 U of DNA polymerase I large fragment was added, and the reaction mixture was incubated for 1 h at 37°C. After being heated to 65°C for 5 min, the DNA was
MOL. CELL. BIOL.
digested with 100 U of EcoRI for 1 h at 37°C. DNA was recovered by precipitation in ethanol; the pellet was taken up in 1 x alkaline loading buffer (30 mM NaOH, 1 mM EDTA [pH 8.0], 10% Ficoll, 0.025% bromcresol green) and fractionated by electrophoresis through a 1% low-melting-point agarose gel in 30 mM NaOH-1 mM EDTA (29), and a 499-nt, single-stranded, radiolabeled probe was isolated. Si nuclease assays of DJH transcripts were performed as described previously (16), with the following modifications. Total cellular RNA (20 jig) was annealed with 0.02 pmol of the DSP22 probe for 12 h at 45°C in a 20-jIl reaction containing 80% formamide, 40 mM PIPES [piperazine-N,N'bis(2-ethanesulfonic acid)] (pH 6.4), 1 mM EDTA, and 400 mM NaCl; 280 [lI of a solution containing S1 nuclease (Boehringer-Mannheim; 0.3 U/pl), 280 mM NaCl, 50 mM sodium acetate (pH 4.5), and 4.5 mM ZnSO4 was added, and the reaction was incubated for 1 h at 25°C. Products were fractionated by electrophoresis through 8% polyacrylamide-7 M urea; 32p was detected by autoradiography. S1 nuclease assays of ,-tubulin transcripts were performed as described previously (19), using as a probe the plasmid pm,B5 (a gift of D. Cleveland), which was linearized with the XhoI restriction endonuclease and labeled at both 5' ends with 32P by polynucleotide kinase. DsP2-chloramphenicol acetyltransferase (CAT) expression plasmids. A 5.5-kb EcoRI fragment, containing the DSP2-JH3 rearrangement from cell line 300-19 (34), was molecularly cloned into the EcoRI site of the bacteriophage vector X-ZAP and subcloned into pBS-SK. The resulting plasmid was digested with PstI, and a 2.3-kb fragment, spanning bp -2263 to +37 relative to the start of the DSP2JH3 coding sequence, was purified. This fragment (3 jig) was digested with 1 U of nuclease Bal31 (New England BioLabs) for 30 s at 17°C in a 30-jil reaction containing 200 mM NaCl, 20 mM Tris-HCl (pH 8.0), 12 mM CaC12, 12 mM MgCl2, and 1 mM EDTA. The reaction was stopped by the addition of 20 mM EGTA [ethylene glycol-bis(P-aminoethyl ether)-N,N,N',N'tetraacetic acid]. The DNA was extracted with phenol and precipitated in ethanol; ends were made blunt by treatment with 5 U of DNA polymerase I large fragment (BoehringerMannheim) for 30 s at 37°C in a 50-pl reaction mixture containing 50 mM Tris-HCI (pH 7.5), 10 mM MgCl2, 1 mM dithiothreitol, and 50 jig of bovine serum albumin per ml. After extraction with phenol and precipitation in ethanol, the DNA was digested with the BamHI restriction endonuclease and products, ranging in size from 872 to 913 bp, were purified by electrophoresis and cloned into the plasmid pGCATm (a gift of Marylin West and Jeffry Corden) between the BglII and StuI restriction sites. One resulting plasmid, pDSP2CAT, contains a portion of the DSP2JH sequence spanning -876 to + 19 bp relative to the start point of DSP2JH transcription (as defined by S1 nuclease protection and primer extension [34 and data not shown]), fused to the CAT reporter gene (see Fig. SA). The plasmids pRXDsP2CAT and pXRDSP2CAT (see Fig. SA) were derived from pDSP2CAT as follows. A 991-bp XbaI fragment, containing the IgH enhancer, was isolated from ppu (22) (a gift of R. Grosschedl) and cloned in either orientation into the XbaI restriction site of pDSP2CAT, which lies at -939 bp relative to the DSP2JH transcription start point. Deletion mutagenesis of pRXDsp2CAT. The plasmid pRXDsP2CAT (5 jig) was digested with the ApaI and BssHII restriction endonucleases, which cleave 883 and 881 bp upstream of the DsP2JH transcription start point, respectively. The DNA was then digested with 180 U of exonuclease III (Promega) at 29°C in a 60-jil reaction mixture con-
VOL. 11, 1991
taining 66 mM Tris-HCl (pH 8.0) and 0.66 mM MgCl2. Aliquots (0.2 ,ug of DNA) were taken at 0.5, 1.0, 1.5, 2.0, 2.5, 3.0, 4.0, 5.0, 6.0, 7.0, and 10.0 min and treated with 2.3 U of S1 nuclease (Promega) for 30 min at room temperature in a 10-,u reaction mixture containing 255 mM NaCl, 30 mM potassium acetate (pH 4.6), 1 mM ZnSO4, and 5% glycerol. Reactions were stopped by the addition of Tris base to 30 mM and EDTA to 5 mM, and then the mixtures were heated to 70°C for 10 min. DNA ends were made blunt by treatment with 0.17 U of DNA polymerase I large fragment for 3 min at 37°C in a 12-,u reaction mixture containing 1.7 mM Tris-HCl (pH 8.0) and 8.3 mM MgCl2. To the reaction were then added dGTP, dATP, dTTP, and dCTP each to 10 mM, and incubation was continued for 5 min at 37°C. The products were then ligated for 13 h at 14WC in a 50-pI reaction mixture containing 80 mM MgCl2, 40 mM Tris-HCl (pH 7.6), 8 mM ATP, and 0.2 U of T4 DNA ligase (Promega). Aliquots (10 pI) were taken from each reaction for transformation of the Escherichia coli strain DH1 (23). The nucleotide sequences of the resulting plasmids in the vicinity of the deletions were determined by the dideoxynucleotide chain termination method (39). DNA transfections and CAT assay. Cells were transfected as described by Grosschedl and Baltimore with modifications (22). The cell line 300-19 was grown to a density of 1.1 x 106 to 1.5 x 106 cells per ml. For each transfection, 2 x 107 cells were washed twice in phosphate-buffered saline-EDTA (137 mM NaCl, 8 mM Na2HPO4 H20, 1.1 mM KH2PO4, 2.7 mM KCl, 0.5 mM EDTA), washed twice in TS (137 mM NaCl, 25 mM Tris-HCl [pH 7.5], 5 mM KCl, 0.37 mM Na2HPO4 7H20, 0.68 mM CaCl2, 1 mM MgCL2, and resuspended in 1 ml of TS containing 2.5 p.g of plasmid DNA per ml and 0.25 mg of DEAE-dextran (molecular weight, 5 x 107; Pharmacia) per ml. After incubation for 30 min at room temperature, 10 ml of RPMI 1640 supplemented with 20% fetal bovine serum and 0.18 mM chloroquine diphosphate (Sigma) was added, and the suspension was incubated for an additional 30 min at 37°C. The cells were collected by centrifugation and resuspended in 50 ml of RPMI 1640 supplemented with 20% fetal bovine serum. After 45 to 48 h at 37°C, cells were harvested and extracts were prepared as described previously (30). Transfections of experimental plasmids and control transfections of pSV2CAT (21) were performed in parallel. After 45 to 48 h at 37°C, cells were harvested and extracts were prepared. Cells were washed twice in phosphate-buffered saline and once in 40 mM Tris (pH 7.4)-i mM EDTA-150 mM NaCl and were resuspended in 65 of 250 mM Tris (pH 8.0). Cells were then lysed by freeze-thawing (three times). Lysates were heated for 10 min at 60°C and clarified by centrifugation at 12,000 x g for 5 min at 4°C. Extracts were assayed for protein by the method of Bradford (9). Extracts (50 pA) were assayed for CAT assay in a total volume of 150 plA containing 470 mM Tris (pH 8.0), 0.5 mM acetyl coenzyme A, 2 of [14C]chloramphenicol (60 mCi/ mmol; DuPont-NEN). Samples were incubated at 37°C for 8 h, at which time acetylation had been determined to proceed linearly (data not shown). Acetylated derivatives were separated from chloramphenicol by thin-layer chromatography and 14C counts per minute in acetylated and unacetylated forms were determined by scintillation spectrometry. Percent conversion per microgram of protein (C) was calculated from the formula:
IMMUNOGLOBULIN DJH TRANSCRIPTION
(
AcCm
2099
\
x 100 AcCm + Cm micrograms of protein
where AcCm and Cm refer to "'C counts per minute recovered as acetylated and unacetylated chloramphenicol, respectively. The values of C obtained for cells transfected with the test plasmids (Cexp) were normalized to those obtained with pSV2CAT (C,v). Values of Cexp/Csv were determined for each of three trials, and the mean and standard deviation of the mean were calculated. RESULTS Hybridization assay for D-to-JH rearrangements in the Ha-MSV-transformed cell line HAFTL-1. To test the idea, advanced by Reth and Alt (34), that activation of DJH transcription is coordinated with D-to-JH rearrangement, we examined these processes in the Ha-MSV-transformed cell line HAFTL-1, which undergoes continuing D-to-JH joining during propagation in culture (la). A primary clone of HAFTL-1, designated HAFTL-1-14, had been previously isolated and characterized (la). HAFTL-1-14 carries a single germ line H allele that undergoes D-to-JH rearrangement; the other allele had undergone spontaneous deletion of its D and JH segments. The presence of a single H allele in HAFTL1-14 simplified analysis of D-to-JH joining and made it possible to observe DJH transcription as a function of D-to-JH rearrangement. The HAFTL-1-14 clone was expanded to 107 cells, and subclones were isolated by limiting dilution. Of 128 subclones obtained, 97 were selected at random and expanded to 2 x 107 cells. Genomic DNA and total cellular RNA were prepared from each subclone. DNA was digested with EcoRI and assayed for D-to-JH rearrangement by hybridization to JH- and D-specific probes (4, 5). Of the 97 clones analyzed, 92 yielded a single predominant JH-containing fragment. In 40 clones, the JH probe hybridized to a unique 6.2-kb EcoRI fragment that comigrated with the fragment detected in mouse liver DNA (Fig. 1A, lane 1 versus lanes 3, 4, 6, 9, 10, 12, and 15, and data not shown), suggesting that the H locus in these clones is predominantly unrearranged. This interpretation was supported by the observation that a probe specific for the 5' flank of DQ52 hybridized to a fragment of the same size (Fig. 1B), because DQ52 is the most JH-proximal D segment, and joining of any other D segment to a JH segment would have resulted in deletion of DQ52. Joining of DQ52 to JH was expected to yield a family of fragments 4.3 to 5.5 kb long that hybridized to the JH and DQ52 probes. Such a fragment was observed in each of 22 clones, suggesting that in these cells DQ52-to-JH rearrangement had occurred (Fig. 1A and B, lanes 2, 7, 11, 13, and 16, and data not shown). Consistent with this interpretation was the observation that in these clones the DSP2 and DFL16 segments are unrearranged (Fig. 1C). In 30 clones the DQ52 segment was deleted and the JH probe detected a unique, rearranged EcoRI fragment that also hybridized to the combined DSP2 and DFL16 probes (Fig. 1A and C, lanes 5, 14 and 17, and data not shown), indicating that these cells had undergone DSP2- or DFL16-to-JH rearrangement. Of the 52 clones that yielded a unique rearranged EcoRI fragment, 22 (42%) had undergone DQ52-to-JH joining and 30 (58%) had undergone DSP2- or DFL16-to-JH joining. Assuming that the parental cell line contains one DQ52 segment and 12 DsP2 or DFL16 segments (25, 44), we observed a 9:1 bias
~ wit
ALESSANDRINI AND DESIDERIO
2100
2 3 4 5
1
A
B
C_
_
6 7
8
9 10 11
-
MOL. CELL. BIOL.
12 13 14 15 16 17 18
W1W
ON:
FIG. 1. Assay for D-to-JH rearrangement in clones of the HAFTL-1-14 cell line. Genomic DNA (10 ,ug) from mouse liver (lane 1) or from subclones of HAFTL-1-14 (lanes 2 through 18) was digested with EcoRI, fractionated by electrophoresis through 0.8% agarose, transferred to nitrocellulose, and hybridized to JH- and D-specific probes as described in Materials and Methods. (A) Hybridization to the JH-specific probe. (B) Hybridization of the same filter to the DQ52-specific probe, after removal of the JH specific probe. (C) Hybridization of the same filter to combined DSP2- and DFLl6-specific probes, after removal of the DQS2-specific probe. The dashes at left indicate the positions of 23.1-, 9.4-, 6.6-, 4.4-, and 2.3-kb DNA markers.
in favor of clones carrying DQ52 rearrangements. Similar overrepresentation of clones carrying DQ52 rearrangements has been observed among human B-cell progenitors transformed with the Epstein-Barr virus (32). Molecular cloning of D-to-JH rearrangements and nucleotide sequence analysis. To confirm the results of the hybridization assay, and to obtain specific probes for DJH tran-
scripts (see below), JH-associated rearrangements were molecularly cloned from cells predicted to have undergone DQ52-to-JH and DSP2- or DFL16-to-JH joining. In each case, the nucleotide sequence of the recombinant agreed with the prediction of the hybridization assay. Clones HAFTL-114-64 (clone 64) and HAFTL-1-14-65 (clone 65) were found to carry independent DQ52-JH rearrangements; clones HAFTL-1-14-53 (clone 53) and HAFTL-1-14-83 (clone 83) carry independent DsP2-JH rearrangements; and HAFTL-114-47 (clone 47) carries a DFL16-JH rearrangement (Fig. 2). DFL16-JH rearrangements from three other clones-HAFTL1-14-54, 71, and 79-had nucleotide sequences that were identical to that of clone 47, implying that these clones inherited the same rearrangement from a common progenitor (data not shown). Distal D segments exhibit coordinate regulation of D-to-JH
joining and DJH transcription. A survey of lymphoid cell lines for the presence of DJH transcripts by Reth and Alt showed that cell lines carrying DsP2-JH rearrangements
expressed DsP2-specific transcripts, while cell lines with DFL16-JH rearrangements expressed DFL16-specific transcripts (34). The availability of a cell line that undergoes D-to-JH joining during propagation in culture made it possible to examine this relationship directly, among progeny of a single cell. To assay DJH transcripts, we employed three oligonucleotide probes, each specific for one of the D segment families. The 5' ends of the probes were complementary to the 21 nucleotides immediately upstream of the D coding sequences, and the 3' ends of the probes were complementary to the 3' end of a common template oligonucleotide (Fig. 3A). The D probes were annealed to the template oligonucleotide and labeled by extension in the presence of [a-32P]dATP. The probes were tested separately for hybridization to total cellular RNA from cell lines carrying DQ52-, DSP2-, or DFL16-JH rearrangements, or from a cell line (HAFTL-1-14-5) that had undergone spontaneous deletion of both H alleles. Each probe exhibited specificity for RNA from the cell line carrying the cognate rearrangement (Fig. 3B, lanes 1 to 4). Thus, the assay could discriminate among transcripts from each of the three D families and was sensitive enough to allow measurements to be made with total cellular RNA. Eight clones carrying a predominantly unrearranged JH allele and eight clones with D-JH rearrangements were assayed with these probes for the presence of D-containing RNA. The DsP2 probe hybridized to a 2,100-nt species in RNA from the cell line 300-19, which previously had been shown to express a DSP2-containing transcript (34), and from clone 53, which carries a DSP2 2-JH4 rearrangement (Fig. 3B, panel a, lanes 3 and 14). The DFL16 probe detected a species of similar size in control RNA from HAFTL-1-14-6, in which DFL16.1 is joined to JH2 (la), and in RNA from clones 47, 54, 71, and 79, all of which carry a DFL16-JH4 rearrangement (Fig. 3B, panel b, lanes 2, 13, 15, 18, and 19). None of the eight unrearranged clones showed detectable hybridization to the DSP2 or the DFL16 probes (Fig. 3B, panels a and b, lanes 5 through 12). In addition, the DsP2 probe failed to detect transcripts in RNA from clone 83 (Fig. 3B, panel a, lane 20), which, like clone 53, carries a DsP2 2-JH rearrangement. A nuclease protection assay, however, did reveal DsP2.2-containing transcripts in clone 83, albeit at a lower level than in clone 53 (see below). With this exception, all progeny of HAFTL-1-14 that had undergone DSP2- or DFL16tO-JH joining were found by the oligonucleotide hybridization assay to express D-containing transcripts, specific for the rearranged D segment; these transcripts were not detectable in the unrearranged progeny. Accumulation of DQS2JH transcripts is independent of DQ52to-JH rearrangement. The DQ52 probe hybridized to RNA from HAFTL-1-14-101 and from clones 64 and 65, which had undergone independent DQ52-to-JH rearrangements (Fig. 3B, panel c, lanes 4, 16, and 17). Unlike the DSP2 and DFL16 probes, the DQ52 probe also detected transcripts in each of the unrearranged clones (Fig. 3B, panel e, lanes 5 to 12). These could have originated from the unrearranged DQ52 segment or from a subpopulation of cells carrying DQ52-JH rearrangements. We considered the second possibility less likely, since neither DSP2- nor DFL16-containing transcripts were detected in the unrearranged clones, despite the fact that clones of cells carrying DsP2 and DFL16 rearrangements were obtained at greater frequency than those with DQ52 rearrangements. Transcription of the unrearranged DQ52 segment would not be inconsistent with the hypothesis that
GTS AC TAG TCAG
IMMUNOGLOBULIN DJH TRANSCRIPTION
VOL. 11, 1991 HAFTL-1-14-47
DFL1 6.1 CTTTTTG TGAAGGGATCTAC
T
TTATTACTACG T TA
Clone47 CTTTTTGTGAAGGGATCTACT JH4
DSP2. 2
A
TGCTATGGACTACTGGGGTC.
GGGATCTACT
GGTTTTGTCGGGTACAGAGGAAAAACCCACTAT
BAFTL-1-14--64
. .
r-
--,-%~~~~~~~~~~~~~~~~~~~
TACTATGCTATGGACTACTGGGGTC...I
GToTTTGACTAAGCGGACGAC
GC7GACrACGGTrv.
Clone64
%--3rL-TWUACTAAGCGGACGAC
GGdACtGGTTTGCTTACTGGGGCCAAGGGA...I
Clone65
CTTTTG&CTAAGCGGACGACC&TAGCi CTTSTGL,ALTAA.GCGGACGACC
JH2
BAFTL-1-14-83 DSP2. 2
_CAAGGGA...I
A!TTA!GTGCAGGGGTCTAATCATTGTTGT
BAFTL-1-14-65 DQ52
AII
...
DQ52
JH3
I
* *
CAAGGGATCTACI TATGCTATGGACTACTGGGGTC...I
Clone53
JH4
...
GGTTTTGTCGGGTACAGAGGAAAAACCCACTTTTATGCTATGGACTACTGGGGTC.
BAFTL-1-14-53
2101
{M~~
CTA
C.....
CTACTTTGACTACTGGGGCCAAGGCA.
..
CTACTTTGACTACTGGGGCCAAGGCA...
GGGATCTAC
Clone83 A3SSTSTGTCAAGGGATCTAC
LTGGATTACGACGGG7pkCTACTTTGACTACTGGGGC
*
*
-
GGTTTTTGTACACCCACTAAAGGGGTCTATGA TTGTACTGGG JH2 FIG. 2. Nucleotide sequences at D-JH junctions in HAFTL-1-14 clones. The D-JH junctions from HAFTL-1-14 clones 47, 53, 64, 65, and 83 were molecularly cloned and their nucleotide sequences were determined as described in Materials and Methods. For each cell clone, the middle line represents the nucleotide sequence spanning the recombinant junction, the top line represents the corresponding germ line D sequence, and the bottom line represents a part of the corresponding JH sequence. The heptamer and nonamer recombinational signals are shown in boldface. Stippled and open boxes denote nucleotides derived from D and JH coding sequences, respectively. Junctional nucleotides not encoded by the germ line sequences (N regions) are shown in italics. The recombined D segment in clone 47 differs at two positions from the published sequence of DFL161; these residues are underlined.
DJH transcription is enhancer dependent, since the DQ52 segment lies within 700 bp Of JH1This issue was resolved by the following experiments, which demonstrated that most of the DQ52JH transcripts detectable in predominantly unrearranged clones originated from the unrearranged DQ52 segment. First, to determine whether the unrearranged DQ52 segment is transcribed in these cells, RNA was assayed for hybridization to a probe specific for the 3' flank of DQ52. If the DQ52-containing RNA in predominantly unrearranged clones were transcribed from rearranged DQ52 segments, then it would not hybridize to the probe, because the 3' flank of DQ52 would be deleted on joining to JH. A 217-bp probe specific for the 3' flank of DQ52 hybridized to RNA present in the germ line clones (Fig. 3B, panel d, lanes 5 through 12), indicating that the unrearranged DQ52 segment is transcriptionally active. We then estimated the proportion of DQ52-containing transcripts in a predominantly unrearranged clone that originated from the unrearranged DQ52 segment. Filters containing total cellular RNA from clone 93 and an in vitro transcript spanning the unrearranged DQ52 segment (Fig. 4A) were hybridized to DQ52specific 5' and 3' oligonucleotides as described in Materials
and Methods. Hybridization of 5' and 3' probes to RNA from clone 93 was quantitated by densitometry, and each value was normalized to the signal observed upon hybridization to the in vitro transcript. This analysis indicated that most of the DQ52-containing RNA in clone 93 originated from the unrearranged DQ52 segment (Fig. 4B). The steady-state levels of DQ52JH transcripts did not change greatly upon DQ52-to-JH joining (Fig. 3B, panel e). Analysis by Si nuclease protection and primer extension showed that DQ52JH transcripts in unrearranged (HAFTL-1-14-102) and rearranged (HAFTL-1-14-101) cell clones initiated at identical sites within the 5' flank of DQ52 (data not shown). Transcription of an Ds52 gene segment is enhanced upon D-to-JH joining. To determine the relative levels of DJH transcription in rearranged and unrearranged clones, we used an S1 nuclease protection assay. A probe specific for the DJH transcript expressed in HAFTL-1-14-53 was obtained by molecular cloning of the Dsp2-JH junction and 480 bp of its 5' flank. A 21-nt synthetic primer, complementary to a site immediately upstream of the D segment on the coding strand, was radiolabeled at its 5' end, annealed to the Dsp2-JH junction fragment, and extended. The product was
2102
ALESSANDRINI AND DESIDERIO
MOL. CELL. BIOL.
A DSP2.1,
GTCAAGGGATCTAACT .TG
J
SCGAACT GAC.".C
T TAGATA .CT AC7C -C
C
-
ACTAAGCGGAGCACL&9G 3 'GCGAACT GA CC G' A-C C --ko''
