DEVELOPMENTAL GENETICS 12:123-132 (1991)

Coordinate Regulation of the Spore Coat Genes in Dictyostelium discoideum KATHY L. FOSNAUGH AND WILLIAM F. LOOMIS Center for Molecular Genetics, Department of Biology, UCSD, La Jolla, California -

Genomic clones of the genes ABSTRACT coding for the three major spore coat proteins, SP60, SP70, and SP96, were used to measure the accumulation of their respective mRNAs in mutant and wild-type cells allowed to develop under a variety of conditions. These prespore-specific mRNAs were found to be both temporally and quantitatively coordinate under all conditions indicating that they may be subject to identical regulatory processes. Accumulation of the spore coat mRNAs is dependent upon the function of both cAMP receptors and Ga2 proteins during the aggregation stage as well as upon concomitant protein synthesis. When cells are dissociated from aggregates at 10 hr of development and rapidly shaken in 0.1 m M EDTA they form clumps but do not accumulate any of the prespore-specific RNAs assayed. However, if either 0.1 rnM C a t + or 20 pM cAMP is added to these cells, the spore coat mRNAs accumulate. Lower concentrations of either C a + + or cAMP had no effect. These results suggest that expression of the spore coat genes normally involves a C a + -dependent process, but the C a + requirement can be overcome by adding high concentrations of exogenous CAMP.Addition of 50 n M DIF to dissociated cell blocks the accumulation of the spore coat mRNAs even when is present. The upstream regions of cAMP or Ca' the spore coat genes were compared to those of another gene, D19, that codes for the presporespecific protein SP29. Short sequences related to CACCCAC were found at about the same position relative to the transcriptional start sites of these coordinately regulated genes. +

+

+

Key words: SP60, SP70, SP96, prespore-specific mRNAs

as the terminal differentiation of the two cell types, spores and stalk cells [Bonner, 1967; Loomis, 1975, 19821. Expression of about 300 developmental genes is required at precise stages of development for normal morphogenesis [Loomis, 19781. During terminal differentiation, the majority of the cells encapsulate into spores surrounded by rigid spore walls. The protein components of the spore coats are released from specialized prespore vesicles where they are stored during the previous 8 to 10 h r [Devine et al., 19831. Genes coding for the major spore coat proteins, SP60, SP70, and SP96, have recently been isolated and sequenced [Fosnaugh and Loomis, 1989a,b]. They code for related proteins that carry common repeated short sequences including a cysteine-rich motif that may participate in the disulphide cross-linking that is observed in complexes of the spore coat proteins within prespore vesicles. The formation of these complexes requires that these genes be expressed a t the same time in the same cell type. Therefore, understanding the mechanisms of coordinate regulation of the spore coat genes is central to understanding fruiting body formation in Dictyostelium. During the first 10 h r of development, cells of D. discoideum differentiate as a homogeneous, synchronous population. They cease growth and express genes that make them able to produce and respond chemotactically to cAMP [Gerisch, 19871. Subsequent changes in cell-cell adhesion permit aggregates containing up to lo5 cells to become integrated within a n extracellular sheath [Loomis et al., 1987; Loomis, 19721. Prespore and prestalk cells can first be distinguished at the tipped aggregate stage by the presence or absence of prespore vesicles and prespore-specific antigens [Hohl and Hamamoto, 1969; Gregg and Badman, 1970; Ikeda and Takeuchi, 19711. Subsequent molecular studies have shown that prespore cells accumulate the spore coat proteins and several other prespore proteins, such as SP29, while prestalk cells accumulate

INTRODUCTION Differentiation of specialized tissues often requires the coordinate expression of a considerable number of genes to give the cells a new function. Fruiting body formation in Dictyostelium discoideum is a complex process t h a t depends on previous developmental processes such as aggregation and slug formation as well

0 1991 WILEY-LISS, INC.

Received for publication July 31, 1990 Address reprint requests to Dr. William Loomis, Center for Molecular Genetics, Department of Biology, UCSD, La Jolla, CA 92093.

124

FOSNAUGH AND LOOMIS

two large structural proteins, ST430 and ST310 [Devine et al., 1982; Morrissey et ul., 1984; Williams, 19881. Transcription of the spore coat genes can first be observed at about 8 h of development, shortly before their protein products accumulate [Dowds and Loomis, 1984; Hong and Loomis, 1988; Fosnaugh and Loomis, 1989al. The fact that the SP60, SP70, and SP96 genes are all expressed a t the same stage and that their mRNAs accumulate in prespore cells but not in prestalk cells suggests that they are dependent on the same prior events of the developmental pathway and may share some or all regulatory components. We report some tests of these predictions.

RNA Analysis RNA was quantitated by absorption a t 260 nm [Maniatis et ul., 19821. Samples containing 5 pg of total cell RNA were denatured, electrophoretically separated on 1% agarose formaldehyde gels, base hydrolyzed, and then transferred to Nytran (Schleicher and Schuell, Inc.) [Maniatis et al., 19821. Hybridization was carried out a t 37°C in buffer containing 50% formamide [Maniatis et ul., 19821. Genomic clones or cDNA clones for each of the spore coat genes, SP60, SP70, and SP96, were digested and subcloned into pGEM-1 or pGEM-3 (Promega Corporation, Madison WI) [Fosnaugh and Loomis, 1989a,b; Hong and Loomis, 19881 and 32P-labeled transcripts generated from these plasmids were used as probes for the spore coat mRNAs.

MATERIALS AND METHODS Organism and Developmental Analysis Cells of D . discoideum strains AX4 [Knecht and Loomis, 19871 and 518 [Klein et al., 19881 were grown axenically in HL5 medium and collected while in exponential growth at 1-5 x lo6 cellsiml. Development was initiated by depositing 5 x lo7 washed cells on 4.5 cm Millipore filters supported on Gelman cellulose fiber pads bathed in 1.5 ml buffered salts solution [Sussman, 19871. Strain HC85 was grown in association with Klebsiella aerogenes plated on SM agar [Coukell et al., 19831 a t 22°C. Cells were collected, washed free of bacteria in glass-distilled H,O by several rounds of centrifugation (500g, 5 m i d , diluted, and plated for development as described above. At various times cells were collected for analysis of RNA by dissolving them in 2.5 ml guanidium isothiocyanate (GITC) followed by centrifugation of the RNA through a cesium chloride cushion [Maniatis et al., 19821. To determine the effects of protein synthesis the development filters were moved to new cellulose pads saturated with fresh buffered salts solution or with buffered salts solution containing 500 pg/ml cycloheximide [Sussman, 19871. For studies of developmental requirements cells were collected from filters a t various times, resuspended in 20 mM potassium phosphate buffer, pH 6.4, with 10 mM EDTA, and titurated through a n 18 G needle 8-10 x using luerlocked syringes to yield suspensions of single cells. For experiments a t low EDTA concentrations cells dissociated in 10 mM EDTA were washed in phosphate buffer by centrifugation (1,OOOg, 5 min), then resuspended in phosphate buffer with 0.1 mM EDTA. Suspensions were diluted to 2-3 x lo6 celldm1 in phosphate buffer with the appropriate EDTA concentration. Thirty milliliters of cell suspensions was shaken rapidly (200 rpm) in 125 ml flasks and additions made a s described in the text. Fifteen milliliter samples were collected 2 and 4 h r after dissociation, centrifuged (l,OOOg, 5 min), and the pellets resuspended in 2.5 ml GITC for preparation of RNA a s described above.

Sequence Analysis Genomic clones including the upstream regions of SP60, SP70, and SP96, have been isolated, subcloned, and sequenced as previously described [Fosnaugh and Loomis, 1989a,bl. Analyses of sequences were assisted by the DNA Strider program on a Mac I1 (Apple Computers) [Marck, 19881. Chemicals Synthetic differentiation-inducing factor (DIF), 1-(3,5-dichloro-2,6-dihydroxy-4-methoxyphenyl~-l-hexanone, was the generous gift of Dr. Robert Kay. RESULTS Dependence on Early Genes One of the physiological changes t h a t is essential for aggregation of cells during the first few hours of development is the acquisition of responsiveness to the chemoattractant, CAMP. Synthesis of the cell surface receptor for cAMP can be blocked by transformation with a genetic construct that results in the expression of anti-sense RNA homologous to the mRNA that codes for the receptor [Klein et al., 19881. Such transformed cells do not aggregate or respond to exogenous cAMP in any observable manner. Cells of a n anti-sense transformed strain, 518, were incubated on filter supports and samples were taken a t various times up to 24 h r to determine on whether the spore coat mRNAs accumulated (Table 1).There was no expression of any of the spore coat genes during the first 18 h r of development. Thereafter, a low level of accumulation could be observed that can be attributed to leakiness in the receptor antisense cells. Addition of 100 p M cAMP at 12 h r of development did not increase the amount of the spore coat mRNAs that accumulated (Table 1). The chemotactic signal is transduced in Dictyostelium from the surface receptor to internal responses of the cells by a specific Ga protein [Devreotes et al., 1987; Janssens and Van Haasert, 19871. Strain HC85 has recently been shown to carry a deletion of the gene coding for Ga2 [Kumagai et al., 1989; Pupillo et ul., 19891.Cells of this strain that have developed for a few

REGULATION OF SPORE COAT GENES IN DICTYOSTELIUM

125

We added cycloheximide at progressively later times to the buffer bathing the filters and collected the cells Time of at 14 hr of development, at which time mRNA of the development (hours) Diss** spore coat genes had accumulated to near-maximal levStrain 0 6 12 18 24 Diss* +CAMP els in the control cells (Fig. 1). RNA recognized by the A x 4 (wild-type) - - + + + + + ++ spore coat genes was barely detectable in cells blocked 518 (CAMP-R-) - - *- -in protein synthesis a t either 8 or 10 h r even though HC85 (Ga2-) these cells first started to express the spore coat genes *Constant amounts of RNA collected at the indicated times at 8 hr. Likewise, cells that were treated with cyclowere separated electrophoretically and transferred to Nytran before probing with clones of SP60, SP70, and SP96. The re- heximide a t 12 h r had significantly reduced levels of spective mRNAs (1.8 kb; 2.2 kb; 2.4 kb) accumulated coordi- the spore coat mRNAs 2 h r later; i t appears that the mRNA that was present at 12 h r decayed in the next nately in all cases. **Cells were dissociated from aggregates after 12 h r of devel- 2 h r and was not replaced in the absence of concomiopment on filters and suspended in buffer containing 10 mM tant protein synthesis (Fig. 1). Under all of these conEDTA. cAMP was added hourly to 100 FM where indicated. ditions accumulation of the products of all three spore Samples were collected 2 hr after dissociation. coats behaved coordinately. The same Northern blots were also analyzed for the hours bind cAMP normally but do not respond to i t in presence of transcripts recognized by plasmids Dd56 any observable manner; the cells do not aggregate and and Dd63 [Williams et al., 1987; McRobbie et al., 19881. remain a s a dense lawn of amoebae on the filters used These prestalk-specific mRNAs first appeared at 12 h r to support them during development. Cells of strain of development and accumulated to higher levels a t HC85 do not accumulate any of the spore coat mRNAs 14 h r of development even in cells treated with cycloeven 24 h r after the initiation of development (Table heximide 6 h r earlier (data not shown). In marked con1). Nor do they respond to addition of 100 pM cAMP trast to the spore coat genes, expression of these after 12 h r of development (Table 1). It appears that prestalk-specific genes does not appear to be dependent responses to pulses of exogenous cAMP are essential on concomitant protein synthesis. developmental prerequisites before the spore coat Requirement for cAMP genes can be expressed. Single cells shaken in suspension or kept from agDependence on Continued Protein Synthesis gregating by plating a t very low density in conditioned Dictyostelium cells respond to pulses of cAMP not buffer will not express many developmentally reguonly by chemotactic movement but also by expression lated genes unless cAMP is added [Kay, 1979; Mehdy et of a variety of early developmental genes [Gerisch et al., 1983; Mehdy and Firtel, 1985; Chisholm et al., al., 1985; Gomer et al., 1985; Chisholm et al., 1984, 19841. Since cAMP is normally released by aggregating 19871. Specific mRNAs that depend on the appearance cells and used a s a chemoattractant, it is thought that of new proteins will not accumulate if protein synthesis cAMP may synchronize differentiation during the is blocked before the necessary level of the regulatory early stages of development by regulating certain esprotein has been synthesized. Expression of several sential genes. Genes that are expressed during the first post-aggregative genes of D . discoideum has been 8 h r can be maximally induced by nanomolar pulses of shown to be blocked if cycloheximide is used to inhibit cAMP while those expressed at later stages require protein synthesis in dissociated cells held in suspension cAMP a t concentrations in excess of 20 pM for maxi[Mehdy et al., 1983; Ratner et al., 19891. Expression of mal expression, but pulsatile stimulation is not essenseveral other genes was found to be independent of tial. Thus, the mechanisms by which cAMP leads to continued protein synthesis under these conditions expression of genes a t these two different stages appear [Mehdy et al., 19831. To determine whether ongoing to differ significantly. Since the spore coat genes are protein synthesis is essential for expression of the spore expressed following aggregation, they would likely recoat genes, we added cycloheximide to cells developing quire high levels of cAMP for expression in dissociated on filter supports and extracted RNA several hours cells. Development was allowed to proceed on filter suplater for Northern analysis. Preliminary experiments showed that no RNA recognized by probes for SP96, ports for 10 h r before cells were dissociated and susSP70, or SP60 accumulated a t any time up to 30 h r pended in buffer containing 10 mM EDTA to block the when protein synthesis was blocked after only 6 h r or 8 reformation of clumps in rapidly shaken cultures. Durh r of development, well before the formation of aggre- ing the next 4 h r SP96, SP70, and SP60 mRNA accugates or appearance of these mRNAs in control cells mulated in cells incubated in the presence of 20 pM (data not shown). Thus, appearance of these mRNAs cAMP but failed to accumulate in cells incubated in the depends, either directly or indirectly, on synthesis of absence of cAMP or when cAMP was added to only 1 developmentally regulated proteins and is not simply a pM (Fig. 2). Because appreciable levels of cAMP phosphodiesterase are secreted by the cells, the exact level consequence of initiation of development.

TABLE 1. Accumulation of Spore Coat mRNAs* ~

~

126

FOSNAUGH AND LOOMIS HOURS CYCLOHEXIMIDE

8

10

+

-

12

+

-

8

14

+

SP60 1.8 KB ~

-

10

+

-

12

+

-

14

+

*

SP70 2.2 KB

SP96 2.4 KB+

Fig. 1. Effect of cycloheximide on accumulation of spore coat mRNAs. A x 4 cells developing on filters were moved a t 8 hr to new cellulose pads saturated with fresh buffered salts solution ( - ) or with fresh buffered salts solution containing 500 pgiml cycloheximide ( + ). Cells were collected at the hours indicated. RNA was prepared and

ACTIN *1.4 KB

analyzed on Northern blots as described in Materials and Methods. The Nytran filters were hybridized with RNA probes QV4 for SP60 [Hang and Loomis, 19881, 70.4 for SP70 [Fosnaugh and Loomis, 1989a1, 96.7 for SP96 [Fosnaugh and Loomis, 1989b1, and DA3 for actin 15 [Knecht et al., 19861.

containing up to 100 cells each. Nevertheless, these cells do not accumulate any of the spore coat mRNAs (Fig. 3 ) . The effects of low levels of EDTA on expression of the spore coat genes can be overcome by addition of 20 pM cAMP (Fig. 3). Since the accumulation of the spore coat mRNAs appeared to be sensitive to the presence of EDTA rather than the inhibition of cell-cell adhesion, we added equivalent calcium ions to buffer containing 0.1 mM EDTA and found that each of the spore coat mRNAs accumulated to significant levels even in the absence of exogenous cAMP (Fig. 4).Equimolar magnesium ions, on the other hand, did not overcome the effects of 0.1 mM EDTA (Fig. 3 ) . Moreover, when cells t h a t had developed on filters for 10 hr were resuspended without EDTA treatment and rapidly shaken in buffer lacking calcium, the spore coat mRNAs failed to accumulate in the clumps of cells (data not shown). These results indicate that calcium ions are specifically required for accumulation of these Requirement for Calcium Ions prespore gene products but that, in their absence, exThe presence of 10 mM EDTA in the buffer used to ogenously added cAMP can bypass the requirement. suspend dissociated cells blocks the early adhesion The fact that exogenous cAMP can bypass the requiremechanism (contact sites B) and ensures that clumps of ment for internal calcium ions suggests that there are cells do not form [Beug et al., 1973; Gerisch, 1962,1987; alternate signal transduction pathways that control Loomis et al., 19871. However, the effect of EDTA on this set of genes. cell-cell adhesion is very concentration dependent and Repression by DIF disappears if less than 1 mM is used. When cells are dissociated after 10 h r of development, washed, and At the tipped aggregate stage, cells of D. discoideum shaken rapidly in 0.1 mM EDTA, they form clumps begin to synthesize and accumulate a low molecular

of cAMP at any time could not be predicted but undoubtedly dropped during the experiment. Therefore, the cAMP was renewed every hour and the net concentration may have increased somewhat over the 6 h r period. However, it is clear t h a t hourly addition of cAMP to 1 pM had little or no effect while hourly addition of cAMP to 20 pM resulted in significant expression of all of the spore coat genes. Hourly addition of 100 pM cAMP resulted in somewhat higher levels of all the spore coat mRNAs (data not shown). Since the concentration of cAMP never rises above 1 pM in aggregates, the effect of CAMP on expression of the spore coat genes in dissociated single cells held in suspension by rapid shaking may be bypassing a normal requirement rather than mimicking the physiological stimuli. Again, accumulation of all three spore coat mRNAs occurred coordinately under these conditions.

REGULATION OF SPORE COAT GENES IN DICTYOSTELIUM TlME(Hours) 1 0 1 2 ADDITIONS

F

F

12

12

12

12

14

None CAMPCAMP DIF F

Conc. (p M)

1

14

14

14

127

14

NonecAMPcAMP DIF 1

20

20

SP60

SP70

SP96 I)

1

2

3

4

5

6

7

8

9 1 0 1 1

Fig. 2. cAMP requirement for accumulation of spore coat mRNAs in dissociated cells. After 10 hr of development on filters a fraction of A x 4 cells were dissociated in buffered salts solution with 10 mM EDTA (lanes 3-6 and 8-11). Dissociated cells were divided into four flasks with no additions (lanes 3 and 8), with cAMP added hourly to 1 FM (lanes 4 and 91, with cAMP added hourly to 20 p.M (lanes 5 and

lo), or with cAMP and DIF added hourly to 20 pM and 100 nM) (lanes 6 and 11).No additions were added to cells continuing development on filters F) (lanes 1, 2, and 7). Cells were collected at the times indicated. RNA was isolated and analyzed as described in Materials and Methods and the Northern transfers probed for SP60, SP70, and SP96 as described in Figure 1.

weight lipid soluble hexanophenone (1-(3,5-dichloro-2, 6-dihydroxy-4-methoxyphenyl)-l-hexanone) known a s DIF t h a t is a n essential signal for prestalk and stalk cell differentiations [Morris et al., 1987; Williams et al., 19871. It has also been shown that DIF represses the gene, D19, that codes for the prespore protein SP29 [Early and Williams, 19881. Therefore, i t was not surprising to find that DIF also represses the spore coat genes SP60, SP70, and SP96 (Fig. 3). We dissociated cells at either 8 or 12 h r of development and incubated them in buffer containing 0.1 mM EDTA, 20 FM CAMP, and various concentrations of DIF (Fig. 4). When DIF was present a t more than 10 nM, none of the spore coat mRNAs were present 4 h r later. The effect of DIF could be determined in the absence of cAMP by adding calcium ions to the dissociated cells. Under these conditions the spore coat mRNAs did not accumulate further and that which was present at the time of dissociation decayed within 2 h r (Fig. 3). These prespore genes, therefore, all share the property of being repressed by DIF.

pend on short G/C rich sequences found within the invariably A + T rich upstream region [Cohen et al., 1986; Nellen et al., 1986; Pears and Williams, 1988; Datta and Firtel, 19881. Since the spore coat genes appear to be coordinately controlled, they may share common cisacting sequences. We have sequenced 600 to 900 bases upstream of the translation start of each of the spore coat genes (Fig. 5). The sequence CACCCAC is found upstream of both SP60 and SP70, while the related sequence CACCCTA is found upstream of SP96. There are several other short sequences that have a high C content upstream of these genes. Each of the spore coat genes has a TATA box and T run that may signal the initiation of transcription (underlined in Fig. 5).

Upstream Sequences of the Spore Coat Genes Transcriptional control of several developmental genes analyzed in Dictyostelium has been found to de-

DISCUSSION Accumulation of the SP60, SP70, and SP96 mRNAs were coordinate under all the conditions that we tested, suggesting that they are subject to the same set of regulatory controls. Expression of each of the spore coat genes is dependent on the ability of cells to bind cAMP and respond to it via Go12 protein early in development. Protein synthesis during the early stages or" aggregation and into the slug stage is essential for accumulation of their mRNAs suggesting that newly made pro-

128

FOSNAUGH AND LOOMIS

TlME(Hours) 1 0 1 2 ADDITIONS F F Conc.

12 12 12 1 2 12 None Ca++ Q++Mg+'Mg++

(mM)

0.2

0.1

0.2

0.1

6

7

12

DIF

14

F

14 14 14 14 14 14 NOW Ca++ Ca++ ~ g + MCJ++DIF + 0.2

0.1

0.2 0.1

SP60

SP70

SP96

1

2

3

4

5

8

9

10

11

12

13

14

15

Fig. 3. Calcium requirement for accumulation of spore coat mRNAs in cells shaken in buffer containing 0.1 mM EDTA. A fraction of A x 4 cells developing on filters were collected a t 10 hr, dissociated in buffered salts solution with 10 mM EDTA, washed, then resuspended in buffered salts solution with 0.1 mM KUrA (lanes 3-8 and 10-15). Dissociated cells were divided into 6 flasks and given no addition (lanes 3 and lo), 0.2 mM CaC1, (lanes 4 and ll), 0.1 mM

CaCI, (lanes 5 and 12), 0.2 mM MgC1, (lanes 6 and 13), 0.1 mM MgCI, (lanes 7 and 141, or 0.2 mM CaCI, and hourly additions of DIF to 100 nM (lanes 8 and 15). No additions were made to the cells continuing development on filters (F) (lanes 1, 2, and 9). Cells were collected a t the times indicated. RNA was isolated and analyzed as described in Materials and Methods and the Northern transfers probed for SP60, SP70, and SP96 as described in Figure 1.

teins play essential roles in the activation of the spore coat genes. If the cells are dissociated in the presence of EDTA, the spore coat mRNAs only accumulate if exogenous CAMPis added a t 20 pM or higher concentration. However, if calcium ions are added then the spore coat mRNAs accumulate even in the absence of added CAMP.Under these conditions, addition of 50 nM DIF to the dissociated cells represses all of the spore coat genes. No conditions have been found that affect one but not the other of these spore coat genes. Previous studies using a variety of clones that recognize discrete but unassigned mRNAs have shown that genes expressed during the first 8 h r of development are regulated quite differently from genes expressed after aggregation is complete [Schaap et al., 1986; Mann and Firtel, 1987; Mann et al., 19881. Likewise, studies using clones that recognize either prespore- or prestalk-specific mRNAs have shown that they are regulated independently [Barklis and Lodish, 1983; Mehdy et al., 1983; Williams, 19881. No significant differences have been found between the regulation of the prespore-specific genes although the resolution of some of the analyses was limited. Early steps in development are dependent on a critical cell density due to the requirement for threshold levels of a mass effector [Grabel and Loomis, 1978;

Mehdy and Firtel, 19851. The spore coat proteins do not accumulate in populations of cells kept at low density on plates [Loomis, 19851. Likewise, several RNAs recognized by specific clones, including 2H3 that is now known to code for SP70, do not accumulate unless buffer conditioned by high-density cultures is used during development [Mehdy and Firtel, 19851. The presence of the mass effector is only required for the first 8 to 10 hr. Thereafter, accumulation of SP70 mRNA in dissociated cells does not require high population densities. The spore coat proteins are not synthesized in cells blocked from forming aggregates by the addition of antibodies specific to the surface glycoprotein, gp24, t h a t mediates early cell-cell adhesion [Loomis et al., 19871. However, they are synthesized normally in cells lacking the second adhesion molecule, gp80, that accumulates after 6 h r of development [Loomis, 19851. These results indicate that the formation of aggregates is a n essential prerequisite for expression of the spore coat genes but that the increased cell-cell adhesion mediated by gp80 is dispensible under laboratory conditions. Expression of prespore-specific genes is blocked in a wide range of mutant strains that fail to aggregate for one reason or another. However, in only a few cases, is the molecular basis for the morphological defect

REGULATION OF SPORE COAT GENES IN DICTYOSTELIUM TlME(Hours) 10 1 2 1 2 1 2 1 2 ADDITIONS F F DIF DIF DIF Conc. (nM) 0 1 5

12

14

14

14

14

14

14

DF

DIF

F

DIF

DIF

DIF

50

DIF 1

MF

10

5

10

50

12

0

129

SP60

SP70

SP96

1

2

3

4

5

Fig. 4. Effects of DIF on accumulation of spore coat mRNAs. A fraction of A X4 cells developing on filters were collected a t 10 hr, dissociated in buffered salts solution with 10 mM EDTA, washed, then resuspended in buffered salts solution with 0.1 mM EDTA and 0.2 mM CaCl, (lanes 3-7 and 9-13). The dissociated cells were divided into five flasks and given either nothing (lanes 3 and 9) or hourly additions of DIF to 1nM (lanes 4 and lo), to 5 nM (lanes 5 and

6

7

8

9

10

11

12

13

ll), to 10 nM (lanes 6 and 12), or to 50 nM (lanes 7 and 131. No additions were made to the cells continuing development on filters (F) (lanes 1, 2, and 8). Cells were collected at the times indicated. RNA was isolated and analyzed as described in Materials and Methods and the Northern transfers probed for SP60, SP70, and SP96 as described in Figure 1.

known. The best-defined aggregateless strains are of EDTA [Chung et al., 1981; Mangiarotti et al., 1989; those lacking the surface receptor for cAMP or Ga2 Barklis and Lodish, 1983; Mehdy et al., 1983; Oyama protein [Klein et al., 1988; Kumagai et al., 19891. None and Blumberg, 1986; Haribabu and Dottin, 19861. In of the spore coat genes are expressed in either of these these experiments, the accumulation of mRNAs recogstrains (Table 1)indicating that the early differentia- nized by some but not all clones was shown to be detions elicited by cAMP pulses are necessary before the pendent on added CAMP.Thus, the presence of EDTA cell-type specific genes can be activated. These results does not indiscriminately harm the cells but affects indicate t h a t the spore coat genes are controlled by transcription of specific genes. I t was not determined events on the central dependent pathway that has been whether addition of cAMP was necessary if calcium defined by the molecular phenotypes of a series of mor- ions were added to dissociated cells. When less than 10 mM EDTA is present in the buffer, clumps containing phological mutants [Loomis et al., 19761. While accumulation of many early developmental up to 100 cells can form. Addition of C a + is essential mRNAs is not dependent on concomitant protein syn- for expression of the spore coat genes unless 20 pM thesis, accumulation of several prespore mRNAs has cAMP is added to the buffer. We have found that the been shown to be blocked by any one of a variety of prespore-specific mRNAs recognized by clones D19 and translational inhibitors [Mehdy et al., 1983; Ratner et PL3 accumulated coordinately with the spore coat al., 19891. Protein synthesis both before and at the time mRNAs under all conditions in dissociated cells [Fosof first appearance of the spore coat proteins is essen- naugh and Loomis, unpublished3 suggesting that all of tial for accumulation of their mRNAs (Fig. 1). It is not these prespore genes depend on similar exogenous conclear if the lack of protein synthesis affects the synthe- ditions. When calcium ions are chelated by EDTA, accumusis or stability of the prespore gene products but seems to be a common property of these specific mRNAs. In lation of the spore coat mRNAs requires the addition of contrast, accumulation of the mRNAs that code for the cAMP to the buffer. Since the cells normally secrete prestalk-specific proteins ST310 and ST340 does not cAMP during aggregation, they might depend on exogenous CAMP.However, maximal accumulation of prerequire protein synthesis after 8 h r of development. Most of the previous analyses of cells dissociated spore-specific mRNA requires higher concentrations of from aggregates have been carried out in the presence cAMP than are ever encountered in situ by cells in a +

130

FOSNAUGH AND LOOMIS

sp60 TTTTTTTTTCACAC~CACACTAATTTAC~TTTTTTACATTTCTCATATAAAAATTATTTATTGTACATTG TTCAATATTCATTCACACATTAACACACTTTCAACTCAATTATTTTTTTTTCCAAAAAAACAATAATATATTATATACA

CTGTGAGAATTTTCTATTAATAGCGATAGAAAAAAATTTTATTTTCAAACACACT~CACACAAGCATATG~ AACTCACACCAATTATAATTTGTAAAACATAGAACAAATTTAAATAATTATTTTTTATTAAATTGTATTATTTTTTTTT ATTATTTATTTATTTTTTATTTTCAAAAAAAAAAAAAAAA GTTAACAGACAAAAAGTATAATCTATTTAATTATTCAA AAAAAAAAATATTAAATCATTGTAGTATTTTGTTCATATTCAAATTAAATATCAATACAATTAAAAAAAGTTAAAATGT AATTATTAATATATATATATATTTATCAATATATAATTTAATATAAAAAAAAAAAAGAAATTTAATAAACATAAATATT

TTTTTTAATATTTAAAAATTCTAATAAAAAGTTTTTTATATTTAGTAAAT T T G T A A A A T C A A T T T G T A A C A A A A A C T A G T A A T T T A A A A A A ATG

Sp70 AAAAAAATAGATAATAATAATATTAAAATAATAAAATTATCATACACAGAATAATTACTATGGGCAA

AATTTAGTTTACAAATTTTTATTATTATTATTT~TTTTTGTTTCTATGGAAGAATGTTTTTTTCCATATAATTTT GGAAGTGTGAGTTTGCGCAGTGTGTTAGTGTGGGCTTAATGAGAGTGTTTTTTTTTTTTTTTTTTTTTTTTTTGAACGTA CATATTTATTTGTTTTTATTAATATTTCATAAATGAATTTGTAAATATAAAAATAAATTGTTTTTTTTTATTTTATTTTT TTGATTATGACAATAATTTCAATAAAATGtAAAATATGATAAAAATAATTTTAATTATTGAAACACACACACTCACTCAC

TTTTTCCCACTAGTATTACACTTTCCAATGAAAAATAAATTAATATTGAAAAAGAAGGAAATGG~TG~TA AAAATAATTAAATAAACAATAATATTACAAACACACTATTTCTTTCTC~CACAACCAATATACTAACACTTCTCAT AC~CCAACACACCTAC~GTTCTTCACATTCATACACAAAGTTTAATATTACACTTTAAAAAACATTCATAT TAATGATTTTTATGATTTATTTATTTATTAATTTATTTAATTGTGTATTTTGATTATTGCTCTCTACTTTT~ P C A A T T A T T A T T A T T T T T T C C A G T A C A A A G T A C m

ACCAAAAAAAAAAAAAAATTATTTATATTATTACAAATAAAACAGTAACATTAAATATTAATAATTAGATACATTGAAAA AAAAAGAAATAATAATAATTAAGAATATATAATAACATTTCAATTGTATTTAAAAAAAAAAAAAAA

ATCTCATATACATATACCATTAATATAGTAAAAGTACCAGTAATAAA ATG

sp96 TTGCTAAAAATAAATTGATTTTGTGTGTGATAGTTTGTCAAAAATCATTTGAAATT~TCATATTAT AATATATATTAAAAAAATGTTGTATCTTTAATTTTTTTTCATACTAGTGTGTTAAATGAATTAAAGTGTGGTAATGAATA AATGAAAAAAAAAAAAAAATTAAAGTGAGAGAGTGTGT~GT~TAATGAATGTGTGTTTGAGTGTGTTAAAAATGTG TTTACAAAATATAATAATTTAAATTCATTCATATTCAACTATGGAGAAAGCGTGTTTTCAAACACAATAAATGTGTAATG AAAAATACAATTAAATAATTATTTAATTTTTTGTATGATTAAAAAAAAAAGAGTAAATTAGTAGTGCC~AAAACAA TAATAATAATAATTAAATAATATTAATATTTATTTAATTTTTTTATTTAATTTTTTTTCAAAACAATTCAT~ AAAAATATTCAACTCAGTAATAATAATAATAAAAATAATAACAATAATAA

GGAATTATAATCAAATAATAATATAGCTATAATCTATAATTACTATAGTAAAATTACGTATACATATATAAATAATTATT A T T A T C A T T G T T T T T A A A A A T A A A T A A A T A A A T A A T P ATG Fig. 5. Upstream sequences of SP60, SP70, and SP96. Sequences are shown of the 5' regions for SP60, SP70, and SP96 up to the ATG (bold) representing the first translated codon. The CCCA elements, common to high C motifs of the spore coat genes, are highlighted in bold and underlined. TATA boxes and the subsequent T-rich-runs which follow them are underlined for each of the genes.

REGULATION OF SPORE COAT GENES IN DICTYOSTELIUM slug (Fig. 3) [also Oyama and Blumberg, 19861. The pharmacological specificity of cAMP analogues that elicit induction is similar to but not identical with that of chemoattractants. Together with the fact that the cAMP receptor involved in chemotaxis decreases dramatically after 8 h r of development, these results suggest that the effects of exogenous cAMP are mediated by a separate receptor system. All prespore-specific mRNAs that have been studied, including those of the spore coat genes as well as D19, EB4, and 14E6, require added cAMP for accumulation in cells dissociated in EDTA. There is evidence that cAMP may be affecting the stability of these mRNAs under these conditions [Mangiarotti et al., 19891. The other well-characterized effector of Dictyostelium gene expression is the low-molecular weight lipidsoluble compound referred to as DIF [Morris et al., 1987; Williams et al., 19871. Addition of DIF to cells dissociated from aggregates or incubated in submerged cultures in the presence of cAMP results in the accumulation of the mRNAs for ST430 and ST310. It also results in the failure to accumulate the prespore mRNA that codes for SP29 [Early and Williams, 19881. We have found that it also blocks accumulation of the spore coat mRNAs in dissociated cells (Fig. 3). DIF accumulates shortly after aggregation of the cells and is found at almost equal levels throughout the slug [Brookman et al., 19871. However, the majority of the cells in slugs accumulate prespore mRNAs including those of the spore coat genes and only about 20% accumulate the prestalk mRNAs for ST430 and ST310. Thus, in situ the majority of the cells must be insensitive to the presence of DIF. It has been proposed that DIF insensitivity is a specific prespore differentiation [Loomis, 19891. Prestalk cells remain sensitive to DIF and accumulate prestalk mRNAs but not prespore mRNAs. If transcription of the prespore genes is coordinated by a common transacting regulator, we might be able to recognize related sequences near the transcriptional initiation sites of these genes t h a t bind the regulator. Early and Williams [ 19891 have shown that the region between -430 and -214 upstream of the translational start site of the prespore gene D19 is sufficient for correct temporal and cell-type specific regulation when inserted upstream of a heterologous promotor and reporter gene. Embedded in this generally high A + T sequence there are 3 related high C sequences: ACCACAC a t -344, CAACCAC at -269, and ACCCCAC a t -223. It is of interest that the sequence CACCCAC is found twice in the same general region of the SP70 gene (Fig. 4). This sequence is also found upstream of the SP60 gene in a region that has been shown to dramatically affect expression of this gene [Haberstroh and Firtel, submitted]. The upstream region of SP96 carries the related sequence CACCCTA. These high C boxes may help to coordinate transcription of prespore genes; however, transcription of several independently

131

regulated genes including actin, ras, and the cysteine proteases CP1 and CP2, have been shown to depend on upstream regions that contain the related sequences, 5’ CCCATT 3‘ and 5‘ CCCACA 3’ on the transcribed (non-coding) strands [Cohen et czl., 1986; Nellen and Firtel, 1986; Early and Williams, 1988; Datta and Firtel, 19881. It is possible that all of these sequences bind similar transcription factors and that temporal and cell-type specificity is conferred not by the binding sites alone but by the context in which they are found. Since we now have both the regulatory regions and the environmental effectors in hand, it may be possible to trace the pathways that connect him.

ACKNOWLEDGMENTS We are indebted to Dr. Robert Kay for the kind gift of chemically synthesized DIF-1, Dr. Barry Coukell for strain HC85, and Dr. Peter Devreotes for strain 518. We thank Eric Olsen for help on many of the preliminary experiments and Dr. Jeffery Williams for pertinent discussions. This work was supported by a grant from the National Institutes of Health (GM23822). REFERENCES Barklis E, Lodish HF (1983): Regulation of Dictyostelium discoLdeum mRNAs specific for prespore or prestalk cells. Cell 32:1139-1148. Beug H, Katz F, Gerisch G (1973): Dynamics of antigenic membrane sites relating to cell aggregation in Dictyostelzum discoideum. J Cell Biol 56:647-658. Bonner JT (1967): The Cellular Slime Molds.” Princeton, NJ: Princeton University Press. Brookman J, Jermyn K, Kay R (1987):Nature and distribution of the morphogen DIF in the Dictyostelium slug. Development 100:119124. Chisholm R, Hopkinson S, Lodish H (1987): Superinduction of the DLctyostelium discoideum cell surface cAMP receptor by pulses of CAMP. Proc Natl Acad Sci USA 841030. Chisholm RL, Barklis E, Lodish HF (1984): Mechanism of sequential induction of cell-type specific mRNAs in Dictyostelium differentiation. Nature 310:67-69. Chung S, Landfear S, Blumberg D, Cohen N, Lodish H (1981): Synthesis and stability of developmentally regulated Dictyostelium mRNAs are affected by cell-cell contact and CAMP. Cell 24:785797. Cohen SM, Knecht D, Lodish HF, Loomis WF (1986): DNA sequences required for expression of a Dictyostelium actin gene. EMBO J 5: 3361-3366. Coukell M, Lappano S, Cameron A (1983): Isolation and characterization of cAMP unresponsive (frigid) aggregation-deficient mutants of Dictyostelium discoideum. Dev Genet 3:283. Datta S, Firtel R (1988): An 80-bp cis-acting regulatory region controls cAMP and development regulation of a prestalk gene in Dictyostelium. Genes Dev 2:294-304. Devine KM, Bergmann JE, Loomis WF (1983): Spore coat proteins of Dictyostelium discoideum are packaged in prespore vesicles. Dev Biol 99:437-446. Devine KM, Morrissey J H , Loomis WF (1982): Differential synthesis of spore coat proteins in prespore and prestalk cells of Dictyostelium. Proc Natl Acad Sci USA 79:7361-7365. Devreotes P, Fontana D, Klein P, Sherring J , Theibert A (1987): Transmembrane signaling in Dictyostelium. Methods Cell Biol 28: 299-331. Dowds BC, Loomis WF (1984):Cloning and expression of a cDNA that comprises part of the gene coding for a spore coat protein of Dictyostelium discoideum. Mol Cell Biol 4:2273-2278.

132

FOSNAUGH AND LOOMIS

Early A, Williams J (1988):A Dictyostelium prespore-specific gene is transcriptionally repressed by DIF in vitro. Development 103:519524. Early A, Williams J (1989):Identification of sequences regulating the transcription of a Dictyostelium gene selectively expressed in prespore cells. Nucleic Acids Res 175473-6484. Fosnaugh K, Loomis WF (1989a): The spore coat genes, SP60 and SP70, of Dictyostelium. Mol Cell Biol 9:5215-5218. Fosnaugh K, Loomis W (1989b): Sequence of the Dictyostelium discoideum spore coat gene SP96. Nucleic Acids Res 17:9489. Gerisch G (1962): Zellfunktionen und zellfunktionswechsel in der entwicklung von Dictyostelium dzscoideum. VI. Inhibitoren der aggregation, ihr einfluss auf zellkontakbildung und morphogenetische bewegung. Exp Cell Res 26462-484. Gerisch G (1987): Cyclic AMP and other signals controlling cell development and differentiation in Dictyostelium. Annu Rev Biochem 56:853-879. Gerisch G, Hagmann J, Hirth P, Rossier C, Weinhart U, Westphal M (1985): Early Dictyostelium development: control mechanisms bypassed by sequential mutagenesis. Cold Spring Harbor Symp Quant Biol 50:813-822. Gomer RH, Datta S, Mehdy M, Crowley T, Sivertsen A, Nellen W, Reymond C, Mann S, Firtel RA (1985): Regulation of cell-type specific gene expression in Dictyostelium. Cold Spring Harbor Symp Quant Biol 50:801-812. Grabel L, Loomis W (1978): Effector controlling accumulation of Nacetylglucosaminidase during development of Dictyostelium discoideum. Dev Biol 64:203-209. Gregg J, Badman W (1970): Morphogenesis and ultrastructure in Dzctyostelium. Dev Biol 22:96-111. Haribabu B, Dottin R (1986): Pharmacological characterization of cyclic AMP receptors mediating gene regulation in Dictyostelium discoideum. Mol Cell Biol 62402. Hohl H, Hamamoto S (1969): Ultrastructure of spore differentiation in Dictyosteliumt the prespore vacuole. J. Ultrastruct Res 26442453. Hong C, Loomis W (1988):Regulation of SP60 messenger RNA during development of Dictyostelium discoideum. Biochim Biophys Acta 950:61-66. Ikeda T, Takeuchi I (1971): Isolation and characterisation of a prespore specific structure of the cellular slime mold, Dictyostelium discoideum. Dev Growth Differ 13:221-229. Janssens P, Van Haastert P (1987): Molecular basis of transmembrane signal transduction in Dictyostelium discoideum. Microbiol Rev 51:396-418. Kay R (1979):Gene expression in Dictyostelium discoideum: Mutually antagonistic roles of cyclic AMP and ammonia. J Embryo1 Exp Morphol 52:171-182. Klein P, Sun T, Saxe C, Kimmel A, Johnson R, Devreotes P (1988):A chemoattractant receptor controls development in Dictyostelium discoideum. Science 241: 1467-1472. Knecbt D, Cohen S, Loomis W, Lodish H (1986): Developmental regulation of Dzctyostelium discoideum actin gene fusions carried on low-copy and high-copy transformation vectors. Mol Cell Biol 6: 3973. Knecht D, Loomis W (1987): Antisense RNA inactivation of myosin heavy chain gene expression in Dictyostelium discoideum. Science 236:1081. Kumagai A, Pupillo M, Gundersen R, Miakelye R, Devreotes P, Firtel R (1989): Regulation and function of Gu protein subunits in Dictyostelium. Cell 57:265-275. Loomis W (1972):Role of the surface sheath in the control of morphogenesis in Dictyostelium discoideun. Nature New Biol 240:6-9. Loomis W (1975): “Dictyostelium drscozdeum: A Developmental System.” New York: Academic Press. Loomis W (1978): The number of developmental genes in Dictyostelium discoideum. In Lerner RA, Bergsma D (eds): “The Molecular Basis of Cell-Cell Interaction.” New York: Alan R. Liss, Inc., pp 497-505. Loomis W (1989): Essential genes for development of Dictyostelium. Prog Mol Subcell Biol 11:159-1843.

Loomis W, White S, Dimond R (1976):A sequence ofdependent stages in the development of Dictyostelium discoideum. Dev Biol 53:171177. Loomis WF (1982): “The Development of Dictyosteliumdzscoideum.” New York: Academic Press. Loomis WF (1985): Regulation of cell-type specific differentiation in Dictyostelium. Cold Spring Harbor Symp, Quant Biol 50:769-777. Loomis WF, Knecht D, Fuller D (1987): Adhesion mechanisms and multicellular control of cell-type divergence of Dictyostelium discoideum. UCLA Symp Mol Cell Biol 51: 339-349. McRobbie SJ, Jermyn KA, Duffy K, Blight K, Williams J G (1988): Two DIF-inducible, prestalk-specific mRNAs of Dictyostelium encode extracellular matrix proteins of the slug. Development 104: 275-284. Mangiarotti G, Bulfone S, Giorga R, Morandini P, Ceccarelli A, Hames B (1989): Analysis of specific mRNA destabilization during Dictyostelium development. Development 106:473-481. Maniatis T, Frisch E, Sambrook J (1982): “Molecular Cloning.” Cold Spring Harbor, NY: Cold Spring Harbor Laboratory. Mann S, Pinko C, Firtel R (1988): cAMP regulation of early gene expression in signal transduction mutants of Dictyostelium. Dev Biol 130:294-303. Mann SK, Firtel RA (1987): Cyclic AMP regulation of early gene expression in Dictyostelzum discoideumt mediation via the cell surface cyclic AMP receptor. Mol Cell Biol 7:458-469. Marck C (1988): DNA Strider: a ‘C’ program for the fast analysis of DNA and protein sequences on the Apple MacIntosh family of computers. Nucl Acid Res 16:1829-1836. Mehdy M, Firtel R (1985): A secreted factor and cyclic AMP jointly regulate cell-type specific gene expression in Dictyostelium dzscoideum. Mol Cell Biol 5705-713. Mehdy MC, Ratner D, Firtel RA (1983): Induction and modulation of cell type specific gene expression in Uzctyostelium. Cell 32:763-771. Morris HR, Taylor GW, Masento MS, Jermyn KA, Kay RR (1987): Chemical structure of the morphogen differentiation inducing factor from Dictyostelium discoideum. Nature 328:811-814. Morrissey JH, Devine KM, Loomis WF (1984): The timing of celltype-specific differentiation in Dictyostelium discoideum. Dev Biol 102:414-424. Nellen W, Silan C, Saur U, Firtel R (1986): Regulatory sequences in the promoter of the Dictyostelium Actin 6 gene. EMBO J 533673372. Oyama M, Blumberg D (1986): Interaction of cAMP with the cell surface receptor induces cell type specific messenger RNA accumulation in Dictyostelium discoideum. Proc Natl Acad Sci USA 83: 4819-4823. Pears CJ, Williams J G (1988): Multiple copies of a G-rich element upstream of a CAMP-inducibleDictyostelium gene are necessary but not sufficient for efficient gene expression. Nucleic Acids Res 16: 8467-8486. Pupillo M, Kumagai A, Pitt GS, Firtel RA, Devreotes PN (1989): Multiple alpha subunits of guanine nucleotide-binding proteins in Dictyostelium. Proc Natl Acad Sci USA 86:4892-6. Ratner DI, Pentz WH, Pelletier DA (1989): Prespore gene expression in Dictyostelium requires concomitant protein synthesis. Biochim Biophys Acta 1008:71-8. Schaap P, Van Lookeren-Campagne MM, Van Driel R, Spek W, Van Haastert PJ, Pinas J (1986):Postaggregative differentiation induction by cyclic AMP in Dzctyosteliumt Intracellular transduction pathway and requirement for additional stimuli. Dev Biol 1185263. Sussman M (1987): Cultivation and synchronous morphogenesis of Dictyosteliurn under controlled experimental conditions. Methods Cell Biol 28:9. Williams J (1988): The role of diffusible molecules in regulating the cellular differentiation of Dictyostelium discoideum. Development 103:l-16. Williams JG, Ceccarelli A, McRobbie S, Mahbubani H, Kay RR, Early A, Berks M, Jermyn KA (1987): Direct induction of Dictyostelzum prestalk gene expression by DIF provides evidence that DIF is a morphogen. Cell 49:185-192.