Vol. 10, No. 4

MOLECULAR AND CELLULAR BIOLOGY, Apr. 1990, p. 1530-1537

0270-7306/90/041530-08$02.00/0 Copyright © 1990, American Society for Microbiology

Conversion at Large Intergenic Regions of Mitochondrial DNA in Saccharomyces cerevisiae P. J. SKELLY AND G. D. CLARK-WALKER*

Molecular and Population Genetics Group, Research School of Biological Sciences, Australian National University, GPO Box 475, Canberra, ACT 2601, Australia Received 5 October 1989/Accepted 19 December 1989

Saccharomyces cerevisiae mitochondrial DNA deletion mutants have been used to examine whether base-biased intergenic regions of the genome influence mitochondrial biogenesis. One strain (A5.0) lacks a 5-kilobase (kb) segment extending from the proline tRNA gene to the small rRNA gene that includes oril, while a second strain (A3.7) is missing a 3.7-kb region between the genes for ATPase subunit 6 and glutamic acid tRNA that encompasses ori7 plus ori2. Growth of these strains on both fermentable and nonfermentable substrates does not differ from growth of the wild-type strain, indicating that the deletable regions of the genome do not play a direct role in the expression of mitochondrial genes. Examination of whether the 5- or 3.7-kb regions influence mitochondrial DNA transmission was undertaken by crossing strains and examining mitochondrial genotypes in zygotic colonies. In a cross between strain A5.0, harboring three active ori elements (ori2, ori3, and oriS), and strain A3.7, containing only two active oni elements (ori3 and oriS), there is a preferential recovery of the genome containing two active oni elements (37% of progeny) over that containing three active elements (20%). This unexpected result, suggesting that active oni elements do not influence transmission of respiratory-competent genomes, is interpreted to reflect a preferential conversion of the A5.0 genome to the wild type (41 % of progeny). Supporting evidence for conversion over biased transmission is shown by preferential recovery of a nonparental genome in the progeny of a heterozygous cross in which both parental molecules can be identified by size polymorphisms.

either a 5-kb segment, extending from the proline tRNA gene to the small rRNA gene and encompassing oril, or a 3.7-kb region between genes for ATPase subunit 6 and glutamic acid tRNA and including ori2 plus ori7 (Fig. 1). With these strains, we were particularly interested to see whether the loss of an active ori region changed any of the processes mentioned above. ori elements can be divided into either active or inactive types. Active ori elements contain an intact consensus transcription initiation sequence and are found in highly suppressive petite mutants (19). Inactive ori elements, on the other hand, contain an insert in the consensus sequence that disrupts the function of this locus. On the basis of observations from a number of different strains (12, 18), we expected ori2 to be active in our strain, while oril and ori7 would be inactive. Hence, by analogy to highly suppressive petite mutants, the presence of ori2 in a respiratory-competent mitochondrial genome should confer on molecules containing this element an advantage over those lacking such a sequence. Crossing experiments designed to examine this proposal have shown that larger genomes (generated, we propose, by conversion) are preferentially recovered in zygotic colonies and that this effect is independent of ori sequences.

An unresolved question concerning the structure of yeast mitochondrial DNA (mtDNA) is whether intergenic basebiased sequences play a vital role in mitochondrial biogenesis. More than half the 81-kilobase (kb) mtDNA of Saccharomyces cerevisiae has extreme bias in base composition. Long segments, up to 7 kb in one instance, are more than 90% A+T, while as many as 200 small (20 to 50 base pairs [bp]) G+C-rich clusters are interspersed in these regions (8, 10, 30). Furthermore, a complex of three G+C-rich clusters, separated by A+T stretches and extending for 270 to 300 bp, has been found in seven or eight regions, depending on the strain. These structures have been proposed as origins of replication (orilrep, henceforth referred to as oni) and are found in mtDNA from highly suppressive petite mutants (1, 2, 13). In addition, five open reading frames (ORFs) have been found in A+T-rich regions, but as yet no functions have been reported for them (see reference 28, however). Recent developments in manipulating the mitochondrial genome have enabled us to generate strains deleted for large segments of base-biased sequences (3, 4). This has allowed us to examine whether some of these regions influence mitochondrial biogenesis. A comparison between wild-type strains and strains lacking segments from two different regions of the mitochondrial genome (described in detail below) has not revealed detectable differences in growth rates on fermentable and nonfermentable substrates. This result suggests that these particular base-biased regions do not play a direct role in the expression of mitochondrial genes. However, a question remains as to whether specific base-biased segments influence other parameters of mitochondrial biogenesis such as replication, recombination, or transmission of mtDNA. To examine this question, we employed strains lacking *

MATERIALS AND METHODS Yeast strains. All strains used in this study are listed in Table 1 and were derived from the parental strains D13.1A and T3/3 (17). Strains with large deletions in the 81-kb mitochondrial genome of S. cerevisiae were obtained via a series of in vivo steps. The initial step involved crossing nascent spontaneous respiratory-deficient petite mutants that lack large regions of the mitochondrial genome. Recombination between the defective petite mtDNAs within the zygote can generate a novel DNA molecule containing a direct duplication (16). These zygotes have a restored respi-

Corresponding author. 1530

CONVERSION IN YEAST MITOCHONDRIAL GENOME

VOL. 10, 1990 0

10

20

C03 05 P

C02 P

S 2.3

5.3

40

30

PRO 01

| 3.7|IIS| 5.5 0.3 0.2

SrRNA 1

12.31

7.6

60

GLU CYB A6 07 02 -

COI

08

7.05

50

PP 12.01 4.8 | 4.35 |

A5.0

I0.85

8,0 kb

70

03 04 LrRNA

06A9 V

p4

1531

6.7

| 4.65 |

A3.7

FIG. 1. Linearized map of wild-type S. ceres'isiae mtDNA. starting at the unique Sall site in the large rRNA gene (S). Symbols: H. positions and sizes of fragments generated by Cfol-Ptl'II digestion: positions of genes: _, positions of the 3.7- and 5.0-kb deletions. Abbreviations: C01 C02. and C03, Subunits 1 to 3 of cytochrome oxidase: P. Pi'iull sites. SrRNA and LrRNA, small and large subunits of rRNA, respectively; A6 and A9, ATPase subunits 6 and 9: CYB. apocytochrome b: V. variant 1 protein. Also shown are positions of o/ilrep sequences (01 to 08) and tRNAs GLU and PRO.

ratory ability and are characterized by producing spontaneous petite mutants at a high frequency (>60% per generation). Revertants to a normal level of petite formation can be of two types, depending on which duplication is lost from the recombinant molecule (4). One revertant type has a rearranged genome, whereas the other class has a wild-type gene order. In both cases, however, part of the original wild-type sequence is lost. By these means, we have obtained two deleted mitochondrial genomes possessing wild-type gene order but lacking approximately 5 and 3.7 kb of sequence from different parts of the genome. In one deletion mutant, designated A5.0, a 5-kb segment extending between the genes for proline tRNA and small rRNA is missing. The second deletion mutant, designated A3.7, lacks 3.7 kb extending between the genes for ATPase subunit 6 and glutamic acid tRNA. A spontaneous variant of strain A5.0, designated A5.0/at, contains an approximately 50-bp mini-insertion in the 2.15kb CfoI fragment adjacent to the 5.0-kb deleted region. The precise nature of this insertion is presently under investigation. Crossing experiments (see below) involving A5.0 and A3.7 strains have generated a strain whose mtDNA lacks both the 5.0-kb fragment and the 3.7-kb fragment. A total of 8.7 kb is missing in the mtDNA of this doubly deleted strain which is

designated 2A8.7. Media. GYP contains 2% glucose, 0.5% yeast extract, and 1% Bacto-Peptone. GlyYP is GYP with 2% glycerol in place of glucose. GGYP is GlyYP with 0.2% glucose. Glucose minimal medium (GMM) contains 2% glucose and 0.67% yeast nitrogen base (Difco Laboratories, Detroit, Mich.). Sporulation medium contains 0.5% potassium acetate. All media were solidified with 1.5% agar. Methylene blue plates consist of GYP containing 0.03 mg of methylene blue per ml. Preparation of haploids. Asci were digested with ZymolTABLE 1. Yeast strains Strain

D13.1A T3/3

A3.7(i) A3.7(ii)" A5.0 A5.0/a' 2A8.7(i) 2A8.7(ii)

Genotype

oahis3-532 tipl a adel arg4-16

ota his3-532 trpl a arg4-16 trpl a adel his3-532 a adel Ihis3-532 a adel arg4-16 a his3-532 trpl

Mitochondrial genotype

Wild type Wild type A3.7 kb A3.7 kb A5.0 kb A5.0 kb + mini insert a A8.7 kb A8.7 kb

Source

17 17 This This This This This This

study

study study study

study study

" i and ii refer to different nuclear backgrounds used in crosses to obtain diploid prototrophs.

yase (80 ,ug/ml of water) for 15 min at room temperature, spores were released by mild sonication, and haploids were identified on methylene blue plates by increased intensity of

staining. Growth rates. Growth rates of strains in GYP or GlyYP were determined by periodically measuring the A640 of cultures incubated at 30°C with shaking. Petite frequency determination. Culture petite frequency was determined by growing strains for six generations in GlyYP before plating them on GGYP. The ratio of petitemutant to wild-type colonies was counted after 4 days at

300C. mtDNA preparation. Spheroplasts, produced by Zymolyase, were broken with a French press, and mtDNA was isolated by dye-buoyant density centrifugation with bisbenzamide and CsCl (5). Restriction endonuclease digestion and electrophoretic separation of fragments on 0.8% agarose gels were carried out as previously described (17), except that potassium glutamate buffer was used for all digestions (25). Cloning and sequencing. A 4.8-kb PvulII-CfoI fragment from wild-type mtDNA, containing the ATPase subunit 6 gene (Fig. 2), was recovered from an agarose gel with Geneclean (BIO 101 Inc., San Diego, Calif.) and digested with EcoRI. The resulting 2.5-kb EcoRI-CfoI fragment was blunt ended with Klenow DNA polymerase 1 and cloned into the SinaI site of pTZ18 (Bio-Rad Laboratories, Richmond, Calif.) to form pSCM17 by standard techniques (23). To determine the entire sequence from the EcoRI site through ori7 without recloning, a nested set of deletions beginning at the EcoRI site and extending towards ori7 was generated by the exonuclease III method of Henikoff (21). All sequencing was undertaken by the dideoxy-chain termination procedure (27) with [35SJdATP and Sequenase (U.S. Biochemicals, Cleveland, Ohio). The sequence of the region designated gap 12 (Fig. 2) was achieved by first cloning the 1.6-kb EcoRV fragment encompassing the region. This fragment was isolated from a gel and cloned into the SinaI site of pTZ18 to form pSCM30. The 0.5-kb ApaI-EcoRV portion of the plasmid was eliminated by digesting it with ApaI-BamHI, separating the fragments on a gel, and isolating, blunt-ending, and religating the larger fragment. The subclone generated by this procedure was designated pSCM30a. Sequencing into the gap was undertaken from the Apal site. By digesting pSCM30a with RsaI, an 0.8-kb RsaI fragment was isolated and cloned in both orientations into the SmaI site of pTZ18 to generate clones pSCM30b and pSCM30c. A further portion of gap 12 was sequenced beginning at the RsaI site within the gap. The clone containing the 0.8-kb RsaI fragment in the opposite orientation was treated with exonucle-

1532

SKELLY AND CLARK-WALKER

ORF4

WILD TYPE

_7 \y

A6 rl

,~

EcoRI

Pvull

_\~ ~ \~ OR17 ORF5 F-1m n

-+I

ILI

17

OR12

MOL. CELL. BIOL.

GLU

GAP 12

Ir hI rI 1-l

I

n

I

CfoI

RsaI Apal EcoRV DraI /[21 30 \ 30a

CfoI Dral EcoRV

\~ _24

30b,c

_

\-

_

500 bp

A/ Ab

l EcoRI Rsal Apol EcoRV mI 15 15a _

A3.7

rl

PvulI

l

li 11l ULU

n

CfoI (HinPI)

FIG. 2. Detailed maps of wild-type (top) and strain A3.7 (bottom) mtDNAs showing positions of cloned fragments and sequencing strategy used to determine the location of the 3.7-kb deletion (- -). Positions of landmark genes (LOI) are identified as explained in the legend to Fig. 1. Key restriction sites are marked by the appropriate endonucleases. Other symbols: LII]. position of GAP 12; _. cloned fragments; extent and direction of determined sequences: ml m. and 3, sequences in Fig. 5. - -

-**--,

ase III to generate clones with progressively deleted inserts. These were used to obtain part of the gap sequence on the opposite strand. To sequence across the novel junction of strain A3.7, mtDNA was digested with EcoRI-HinPI. HiniPI recognizes the same restriction sites as Cfol but produces different staggered ends. The fragments were separated on an agarose gel, and the 3.3-kb EcoRI-HinPI novel junction fragment (Fig. 2) was isolated and cloned into the EcoRI-AccI sites of pTZ18 to produce pSCM15. A 2.7-kb ApaI-HinPI fragment was subsequently removed from this plasmid to form pSCMl5a. Sequencing across the novel junction was undertaken starting from the ApaI site. To sequence the opposite strand, the 3.3-kb EcoRI-HinPI insert was reversed by using HindIII-EcoRI digestion to obtain the fragment which was blunt ended and inserted into the SmaI site of pTZ18. Exonuclease III digestions were undertaken to extend the sequence of this strand beyond the segment of gap 12 remaining in mutant A3.7. mtDNA fragments containing selected ori elements were isolated from agarose gels and cloned into the SinaI site of pTZ18. A 1.4-kb fragment containing oril and a 0.6-kb fragment containing ori2 were cloned and designated pSCM48 and pSCM24, respectively. ori7 is present on pSCM17. Investigation of ori activity in a wild-type strain. A wild-type culture, grown overnight in GlyYP, was plated on GGYP. After 72 h, petite mutants were identified by their smallness and paleness. Sampled colonies were grown overnight in 1.5-ml of GYP, treated with Zymolyase (0.2 mg/ml of water) for 15 min, lysed in 0.5 M NaOH, and dotted onto a nylon membrane. The membrane was baked for 2 h at 80°C in a vacuum oven and hybridized with the oril-containing probe BB5 (24) at 58°C, as described previously (6), such that all ori sequences cross hybridized with the ori probe. Selected petite mutants were then tested for suppressiveness by crossing them to wild-type strains (15). The ori element retained in hypersuppressive (>90%) mutants was determined with isolated mtDNA from petite mutants that was labeled and hybfidized to separated CfoI-PvuIl fragments of

wild-type and A3.7 mtDNAs. This combination of enzymes enabled the identification of o)i-containing mtDNA in petite mutants, because all eight o(i elements were separated onto different fragments. Recombination and transmission analyses. Recombination and transmission experiments were undertaken by growing strains overnight in GYP and then mixing 5 [L. of each culture in 2 ml of fresh GYP for 16 h. Cells were then washed in GMM, grown overnight in GMM, and plated on GMM. Total cellular DNA was isolated from colonies chosen at random

FIG. 3. CfoI digestion patterns of mtDNAs from wild-type and deletion mutants A3.7 AO5.0, and 2A8.7. Arrows indicate the positions of diagnostic restriction fragments. Lane M is an EcoRI digest of bacteriophage Sppl DNA showing size markers of (from top) 7.8, 7.0, 5.9, 4.7, 3.4, 2.7. 1.9, 1.8, 1.5, 1.3, 1.1, 0.9, and 0.7 kb. WT, Wild type.

VOL. 10, 1990

CONVERSION IN YEAST MITOCHONDRIAL GENOME

1533

TACAATTTATAATTTAATAAAGAAGGAAATAAATAATAATAACTCCTTTTGGGGTTCCGGTGGGGTTCAC 10 20 30 40 50 60 70

...I4 ........................................ ACCTTTATAAATAATAAATAAAGATGTTTACTCCTCTTCGGGGTTCGGTCCCCTTTTTGGGTTCCGGAAC 80 90 100 110 120 130 140 , 41...........

TAATTAATATTTTATATAATAATAATAATATATTAATATAATTTCATTATTAATAAATATCTCCTGCGGG 150 160 170 180 190 200 210 .4.--I 1

1

1

1d tW3II, , t ^ , l,A,-L 1

220

230

240

3\J

3.b

A

250

...I

.I LIA

260

I

I.L

A.L

1IJIA AILl-A-l -IJJ

270

280

TTATAATATAATTAAAAAGTATTATAATTGAAACGAAAATTGTAATTTTAAATGGAATAATAATTATTAT

290

300

310

330

320

340

350

ATATTTAATATATTTAATAAAGTTATAATATCTCTTTCTACCGGACTATTTTATTTTATTTTATTTTATT

360

370

380

400

390

TTTATAAAGAAAAATAGTATAATATTATCTTCTCCTC -+ 440 450 430

410

420

glu tRNA

FIG. 4. Nucleotide sequence of gap 12 and flanking sequences (underlined). EMBL accession number, X15185GAP 12. The direction of the Glu tRNA gene is indicated. Arrows and dots bound GC clusters.

by treating 1.5 ml of overnight GYP cultures with Zymolyase described above for mtDNA isolation. Pelleted protoplasts were lysed by the addition of a 0.5-ml solution of 50 mM EDTA (pH 8.5), 0.2% sodium dodecyl sulfate, and 1.5 ,ul of diethylpyrocarbonate and incubation at 70°C for 15 min. The dodecyl sulfate was precipitated by adding 50 ,ul of 5 M potassium acetate, incubating the suspension at 4°C for 1 h, and centrifuging it in a microfuge for 5 min. The supernatant was extracted with phenol and chloroform, and DNA was ethanol precipitated. Examination of mtDNA was performed on CfoI digests of total-cell DNA that had been electrophoretically separated in 0.8% agarose, transferred to nylon, and hybridized with 32P-labeled wild-type mtDNA. Some crosses were performed with GlyYP in place of GYP, as described above. No difference in the outcome of crosses under the two conditions was noted, and the results represent data pooled from experiments performed under both as

crossing conditions.

RESULTS Characterization of deletions from mtDNA. Characteristic changes in CfoI fragments from deleted strains relative to those of the wild type are shown in Fig. 3. With mtDNA from strain A3.7, the 4.35- and 14.4-kb fragments are missing, while a novel 15.1-kb fragment is present. This novel fragment is generated by a 3.7-kb deletion spanning a CfoI site and containing ori7, ORF5, ori2, and flanking sequences (see below). In strain A5.0, a 5.5-kb fragment containing oril is missing, whereas a novel 0.54-kb fragment was formed 10

20

30

(results not shown). Subsequent sequence analysis confirms that a deletion removed 5.0 kb of sequence from within the 5.5-kb CfoI fragment (see below). mtDNA from strain 2A8.7 has both sets of changes in the singly deleted strains, and its size (72.4 kb) makes it 11% smaller than the mtDNA of the wild-type strain (81.1 kb). Sequence analysis was undertaken to define the two deleted regions and the sequences at the deletion sites. In the case of strain A3.7, mapping studies and a preliminary sequence analysis indicated that one of the deletion endpoints forming the novel junction is situated in a part of the wild-type mtDNA that had not been sequenced previously. This segment has been designated gap 12 (8, 10). Consequently, the sequence from gap 12 was determined (Fig. 4). The sequence from the novel junction region of A3.7 and the two wild-type segments involved in the generation of this junction is shown in Fig. 5. It can be seen that a short direct repeat of 12 nucleotides is involved in deletion formation. The location of these deletion endpoints in wild-type mtDNA is shown in Fig. 2. The sequence at the novel junction of strain A5.0 has been reported elsewhere (26), and the location of the deletion is shown in Fig. 1. Two similar small repeats (ACCCTTCGGG and ACTCCTTCGGG) are involved in this deletion. Growth of strains and stability of the mitochondrial genome. The growth rate of 2A8.7 is indistinguishable from that of the wild-type strain under glucose-repressing conditions (0.26 generations per h) and derepressing conditions (0.46 generations per h). The frequency of the petite mutation was 0.78% for strain 2A8.7 (of 29,954 colonies examined, 233 40

50

60

(1)CTTCGGAGTTCGGCCCCCCCATAAGGGGGGGA CCTCACTCCTT ccactgcactggatgcgggacttat 111111 11 1111111 111111111111 11 (2)gcggggttcggtcccccccgtaaggggggggt 'CTCACTCCTTC GGAGCGTACTATTATTATAAATAATT FIG. 5. Wild-type sequences from the upstream and downstream regions (1 and 2, respectively) involved in deletion of the 3.7-kb segment encompassing ori7 and ori2 (Fig. 2, boxed numbers). Uppercase letters show the sequence (Fig. 2, box 3) at the novel junction of strain A3.7. The 12-bp direct repeats are enclosed by a rectangle. Arrows bound a 60-bp segment that is missing from the mtDNA of a second yeast strain

(22).

1534

SKELLY AND CLARK-WALKER

MOL. CELL. BIOL.

TABLE 3. mtDNA type in progeny from crosses of strain A5.0/a' or 5.0/a- with strain 2A8.7/a-

co

c.Cl

LC) 1fl-'

5t

% (n) with mtDNA"

Cross (n)

A5.0/a'

Mixed-

A5.0/a' 258.7/a- A5.0/a- 2A8.7/a+ Rho -b

x 2A8.7/a- (102) 21 (20) 38 (36) 39 (37) A5.0/a- x 2A8.7/a- (58) 25 (14) 75 (43)

3 (3)

(6) (1)

Recombinant types are underlined. "Colonies containing more than one type of mtDNA and Rho- colonies. These numbers are not included in the percentage calculations.

FIG. 6. Autoradiogram showing hybridization of 32P-labeled wild-type (wt) mtDNA to Cfol digests of total DNA from zygotic colonies arising from a cross between strains containing the A3.7 and A5.0 mitochondrial genomes. Patterns from parental types (A3.7 and A5.0) and recombinants (2A8.7 and wild type) are shown. Arrows identify diagnostic CfoI fragments.

were petite mutants), compared with 0.96% for the wild-type strain (of 6,675 colonies counted, 64 were petite mutants). Recombination and transmission of mitochondrial genomes. Mitochondrial genomes in zygotic colonies from a series of crosses were examined by hybridization of labeled wild-type mtDNA to digests of whole-cell DNA (Fig. 6), and the results of these analyses are recorded in Table 2. In the first instance, we were interested to know whether the genome with an active ori element (ori2; see below), A5.0, had an advantage over the zA3.7 molecule that lacks this element. To our surprise, the opposite result was obtained, since we found that 37% of progeny lacked ori2 (i.e., A3.7) and the recovery ratio of this genome to A5.0 mtDNA was close to 2:1. Interestingly, a greater bias was found in the recovery of reciprocal recombinant products (Table 2), of which 41% of progeny had wild-type mtDNA, whereas only 3% (five isolates) had genomes lacking both sectors of mtDNA. Note that recovery of wild-type mtDNA in zygotic colonies resulted from recombination and does not indicate the presence of a mixture of the two deleted genomes. If the latter situation arose, we would detect a substoichiometric amount of the 15.1-kb fragment, but this was not observed. When an experiment for the opposite configuration was performed, by crossing strains with wild-type and doubly deleted mitochondrial genomes, we again observed a bias in favor of the wild-type strain (79% of progeny). In this cross, both reciprocal recombinants were recovered in such small

numbers that it is unclear whether any significance should be attached to the differences in recovery of these genomes. Crosses involving the strain containing the doubly deleted genome with either of the singly deleted mtDNA strains again show a strong bias toward recovery of the larger genomes (Tables 2 and 3). These results can be explained either on the basis of conversion (analagous to gene conversion at genetic loci) of smaller to larger molecules or by the preferential replication (or transmission) of the larger molecules. To assess the importance of conversion over preferential recovery of larger genomes, a spontaneous variant of strain A5.0 was used. This variant (designated A5.0/a+) was crossed with strain 2A8.7/a-. Progeny from this cross are shown in Fig. 7, and the overall results are given in Table 3. Once again, a strong bias toward recovery of the larger genome (A5.0, comprising A5.0/a' plus A5.0/a- = -21 + 39 = 60%) was observed. Of the A5.0 genomes recovered, the A5.0/a- recombinant was seen almost twice as frequently as the parental iA5.0/a+. Investigation of ori activity in wild-type strain. Most laboratory strains of S. cerevisiae have eight ori elements, with ori2, ori3, and oriS being active and oril, ori4, ori6, ori7, and ori8 being inactive (18, 19). However, results from the crosses performed in this study could be interpreted to mean that oril is active in our wild-type strain. Hence, it was necessary to investigate the activity of ori elements in the

TABLE 2. mtDNA type in progeny from crosses of strains with different mitochondrial genomes % (n) with mtDNA"

Cross (n)

wild l5.0 i

A3.7 A5.0

type

'A8 7

-A.

A3.7 x A5.0 (157) 37 (54) 20 (29) 41 (61) 3 (5) Wild type x 2A8.7 (57) 8 (4) 6 (3) 79 (41) 8 (4) z3.7 x 2A8.7 (89) 80 (66) 21 (18)

MixedRho--

(8) (5) (5)

a Recombinant types are underlined. Multinomial analysis indicates that a difference in frequency of 0.1 is within a confidence limit of 90% if n > 135; likewise, a difference of 0.2 is obtained with 90% confidence if n > 33. b Colonies contained more than one type of mtDNA and Rho colonies. These numbers are not included in the percentage calculations.

FIG. 7. Autoradiogram showing hybridization of 32P-labeled wild-type mtDNA to CfoI digests of total DNA from zygotic colonies arising from a cross between strains containing the A5.0/a' and 2A8.7/a-- mitochondrial genomes. Patterns from parental types (55.0/a+ and 2A8.7a-) and the recombinant A5.0/a- are shown. Arrows identify diagnostic CfoI fragments.

VOL. 10, 1990

CONVERSION IN YEAST MITOCHONDRIAL GENOME

6.7

b

FIG. 8. Autoradiograms showing hybridization of 32P-labeled mtDNA from hypersuppressive petite mutants containing oniS, ori2. and ori3 to Cfo-Pvull' digests of wild-type (WT) and A3.7 mtDNAs. An ethidium bromide-stained gel showing CfoI-PvuII-digested wildtype and A3.7 mtDNA is at the left. Arrows indicate fragments showing strong hybridization. Because of homology between ori elements, many fragments showed weak hybridization.

mitochondrial genome of our strain. The status of an ori element is determined both by its sequence and by the suppressiveness of petite mutants containing that ori. To assess the status of ori elements in wild-type mtDNA by suppressiveness determinations, a total of 892 spontaneous petite mutants from strain D13.1A were analyzed by dot blot hybridization to the oril probe BB5. From this analysis, we obtained 37 strains showing stronger hybridization than that of the wild-type. Crossing these strains to wild-type strain T3/3 showed that 17 of the 37 strains were more than 90% suppressive. mtDNA was isolated from the 17 strains, labeled, and hybridized to CfoI-PillII diagnostic digests of wild-type and deletion mutant strain 1X3.7 mtDNAs (Fig. 8). Hybridization patterns revealed that seven petite mutants contained an oriS element, five contained an ori3 element, four contained an ori2 element, and one had ori3 plus oniS sequences. None of the suppressive petite strains tested in this experiment contained an oril element. As a further test of the status of ori elements in the deletable regions of mtDNA, we isolated and sequenced the three elements. This analysis revealed that both oril and ori7 contain insertions in the consensus transcription initiation sequence located adjacent to G+C-rich cluster C of the ori element, whereas ori2 does not (Fig. 9). This confirms that ori2, in agreement with suppressiveness determinations, is active, while oril and ori7 are inactive. DISCUSSION In crosses of strains with mtDNAs that contain different amounts of intergenic regions, biased recovery in favor of 10

20

30

1535

larger genomes may be due to conversion, whereby deleted molecules are preferentially converted to the wild type. Alternatively, biased recovery may represent the preferential replication or transmission of the larger molecules. This could occur if the larger molecules contain sequence elements (like ori) that enhance their replication-transmission over those of other molecules lacking such elements. As a basis for this assessment and to characterize the deletion mutants, it is necessary to ascertain which sequences have been lost from the A3.7 and A5.0 mitochondrial genomes. The precise location of the two deleted regions has been obtained by sequence analysis. In the first place, this determination has shown that deletion endpoints occur in short direct repeats of 10 to 11 and 12 bp. In both cases, these repeats comprise part of larger homologous GC clusters belonging to the a3 category (9). This result contrasts with those of another study in which it was found that GC clusters of the al category are involved in the generation of different deletions (3). However, both sets of findings confirm the recombinogenic nature of GC clusters and indicate that mitochondrial recombinases involved in deletion exhibit some flexibility with regard to sequence specificity. The involvement of short repeated sequences in the formation of deletions in yeast mtDNA is well documented (11, 14, 20, 33). Sequence analysis also reveals that ORF4 is missing in our wild-type strain and that a G+C-rich sequence at the upstream site of the 3.7-kb deletion is not present in a second yeast strain whose sequence in this region is known (22) (Fig. 5). Thus, a 60-bp G+C-rich region (Fig. 5) is replaced in the second yeast strain by the 11-mer TTAAAAAGGAA, demonstrating the polymorphic nature of the mitochondrial genome of S. cerevisiae, particularly with regard to GC clusters. Deletion endpoint determination has also defined sequences lacking in the A3.7 and A5.0 mtDNAs. In the case of zA3.7, both ori7 and ori2 are missing, as are ORF5 and 16 GC clusters (numbers 103 and 105 to 119, inclusive) (10). Some of these clusters comprise part of the ori elements. In addition, the GC clusters of the sequences given in Fig. 5, which are involved in the formation of the mutant strain, have been disrupted in A3.7. Finally, a 41-bp GC cluster found in gap 12 is absent from A3.7. Deletion in the A5.0 strain has removed oril and 16 known GC clusters (numbers 58b to 68) (10). However, since sequences for only approximately 3 kb of the regions flanking oril have been reported, we cannot estimate the total number of GC clusters that have been lost in the A5.0 mtDNA. Strain 2A8.7, as a composite of strains A3.7 and A5.0, lacks a minimum of 32 GC clusters as well as oril, ori2, ori7, ORF5, and surrounding A+T-rich sequences. As the growth of 2z8.7 is indistinguishable from that of the wild type, we 40

50

60

cluster c 2. TTTTTTTATAAGATAATTTTTGTAAATATATAAGTAATAAATTAAGTTTTATAGGGGGAGGGGGTGGGTG 7. TATAAATATATAAgtcccggtttcttacgaaaccgggacctcggagacGTAATAGGGGAGGGGGTGGGTG

1. TATAAATATATAAgtcccggtttcttacgaaaccgggacctcggagacGTAATAGGGGAGGGGGTGGGTG FIG. 9. Sequences of the consensus transcription initiation site (underlined) and flanking regions of ori2, oril, and ori7. In ori7 and oril, the consensus transcription initiation site is interrupted by the insertion of a G+C-rich sequence (lowercase letters). The sequence designated cluster c is common to all ori elements. Boldface type indicates base differences in these sequences relative to cognate regions of other strains.

1536

SKELLY AND CLARK-WALKER

conclude that the deleted base-biased sequences are dispensable and that mitochondrial gene expression has not been affected by these deletions. However, the stability of the mitochondrial genome has increased somewhat as a result of the deletions, since the frequency of the petite mutation of strain 2A8.7 is 20% lower than that of the wild type. This suggests that some spontaneous petite mutants in the wildtype strain arise from excisions involving repeated sequences in the dispensable 8.7 kb. Sequence analysis, together with characterization of mtDNA segments retained in highly suppressive petite mutants, has confirmed that mtDNA in our strain contains an active ori2 element, while oril and ori7 are inactive. These observations highlight the surprising nature of results from crosses between the A3.7 and zA5.0 strains in terms of ori activity. Instead of supporting the concept that genomes containing more active ori elements would have a competitive advantage over those with fewer elements, we found that the A3.7 genome, lacking ori2, was preferentially recovered. In other words, any effect of ori elements was overridden by another factor(s) that influenced recovery of respiratory-competent mitochondrial genomes. One explanation for the greater recovery of zA3.7 genomes over those of strain A5.0 is that the latter genomes were preferentially removed by conversion to the wild type. This conclusion is supported by the recovery of large numbers of progeny containing wild-type molecules. Moreover, the wild-type genome is found in substantially greater number than the 2A8.7 genome in the zA5.0 and A3.7 cross. An alternative explanation for this result is that wild-type and 2A8.7 molecules are formed in equal numbers as reciprocal recombinants and that a mechanism for preferential segregation of the larger wild-type genome exists. Although our results do not exclude the possibility that sequence elements other than active ori elements are present in the 5.0-kb regions and to a lesser extent in the 3.7-kb regions that may enhance transmission, it seems unlikely that such elements would exist in these two regions and be absent from the remaining long segments of intergenic base-biased sequences that still exist in the 2z8.7 genome. The preferential recovery of singly deleted genomes when either strain ZA3.7 or strain AS.0 is crossed to the doubly deleted strain is similarly explained by the conversion of the 2A8.7 molecule, when the singly deleted molecule is used as a template. Support for this concept comes from the results of crosses between strain 258.7/a- with either strain A5.0 or the variant A5.0/a'. A preferential recovery of the zA5.0 molecules in the progeny of these crosses is seen in both cases. In the case of the A5.0/a' strain with 2zA8.7/a- cross, enhanced recovery is clearly not due to the preferential transmission of the parental A5.0a' molecule, since most progeny contain the recombinant A5.0a- genome. This suggests that the bias towards recovery of the A5.0 genome is mainly the result of the conversion of the 2A8.7a- genome to A5.0a-. In view of the consistent preferential recovery of larger genomes in all crosses, we favor the notion of conversion over loss of the mini-insertion from the A5.0/a' genome.

Support for asymmetrical conversion from smaller to larger mitochondrial genomes comes from results of other studies of different loci (the variant 1 protein gene, the omega locus in the large rRNA gene, and the a14 group 1 intron in the coxl gene). In crosses between strains carrying a 46-bp G+C-rich element inserted into the varl gene and strains lacking this insert, the progeny preferentially contain the insert (29, 33). Likewise, at the omega locus, strains

MOL. CELL. BIOL.

carrying a 1,143-bp insertion in the large rRNA gene are preferentially recovered from crosses between strains possessing and lacking this element (32). Similarly, the a14 intron is transmitted in crosses to strains lacking it (31). However, it is unlikely that our results can be explained by the mechanisms of gene conversion at the omega locus and at the a14 intron which involve the action of nucleases encoded by the insertion sequences (7, 31). It is suggested that the conversions in our examples and at the varl locus share a common mechanism that must involve a nuclease encoded by the nucleus that is capable of recognizing a mismatched structure rather than a specific sequence in the mtDNA. ACKNOWLEDGMENTS We thank Daryl Daley for statistical evaluations, Erika Wimmer for skilled technical assistance, and Philip Nagley for the BB5 petite mutant. LITERATURE CITED 1. Baldacci, G., B. Cherif-Zahar, and G. Bernardi. 1984. The initiation of DNA replication in the mitochondrial genome of yeast. EMBO J. 3:2115-2120. 2. Blanc, H., and B. Dujon. 1980. Replicator regions of the yeast mitochondrial DNA responsible for suppressiveness. Proc. Natl. Acad. Sci. USA 77:3942-3946. 3. Clark-Walker, G. D. 1989. In vivo rearrangement of mitochondrial DNA in Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 86:8847-8851. 4. Clark-Walker, G. D., R. J. Evans, P. Hoben, and C. R. McArthur. 1985. The basis of diversity in yeast mitochondrial DNAs, p. 71-78. In E. Quagliariello, E. C. Slater, F. Palmiere, C. Saccone, and A. M. Kroon (ed.), Achievements and perspectives in mitochondrial research, vol. 2. Biogenesis. Elsevier Science Publishers B.V., Amsterdam. 5. Clark-Walker, G. D., C. R. McArthur, and K. S. Sriprakash. 1981. Partial duplication of the large ribosomal RNA sequence in an inverted repeat in circular mitochondrial DNA from Kloekera africana. Implications for mechanisms of the petite mutation. J. Mol. Biol. 147:399-415. 6. Clark-Walker, G. D., K. A. Sriprakash, C. R. McArthur, and A. A. Azad. 1980. Mapping of mitochondrial DNA from Torulopsis glabbrata. Location of ribosomal and transfer RNA genes.

Curr. Genet. 1:209-217. 7. Colleaux, L., L. d'Auriol, F. Galibert, and B. Dujon. 1988. Recognition and cleavage site of the intron-encoded omega transposase. Proc. Natl. Acad. Sci. USA 85:6022-6026. 8. deZamaroczy, M., and G. Bernardi. 1985. Sequence organization of the mitochondrial genome of yeast-a review. Gene 37:1-17. 9. deZamaroczy, M., and G. Bernardi. 1986. The GC clusters of the mitochondrial genome of yeast and their evolutionary origin. Gene 41:1-22. 10. deZamaroczy, M., and G. Bernardi. 1986. The primary structure of the mitochondrial genome of Saccharotnvces cerevisiae-a review. Gene 47:155-177. 11. deZamaroczy, M., G. Faugeron-Fonty, and G. Bernardi. 1983. Excision sequences in the mitochondrial genome of yeast. Gene 21:193-202. 12. deZamaroczy, M., G. Faugeron-Fonty, G. Baldacci, R. Goursot, and G. Bernardi. 1984. The on-i sequences of the mitochondrial genome of a wild-type yeast strain: number, location, orientation and structure. Gene 32:439-457. 13. deZamaroczy, M., R. Maritta, G. Faugeron-Fonty, R. Goursot, M. Mangin, G. Baldacci, and G. Bernardi. 1981. The origins of replication of the yeast mitochondrial genome and the phenomenon of suppressivity. Nature (London) 292:75-78. 14. Dieckmann, C. L., and B. Gandy. 1987. Preferential recombination between GC clusters in yeast mitochondrial DNA. EMBO J. 6:4197-4203. 15. Ephrussi, B., H. de Margerie-Hottinguer, and H. Roman. 1955.

VOL. 10, 1990

16.

17.

18.

19.

20. 21.

22.

23. 24.

CONVERSION IN YEAST MITOCHONDRIAL GENOME

Suppressiveness: a new factor in the genetic determinism of the synthesis of respiratory enzymes in yeast. Proc. Natl. Acad. Sci. USA 41:1065-1071. Evans, R. J., and G. D. Clark-Walker. 1985. Elevated levels of petite formation in strains of Saccharomvces cerevisiae restored to respiratory competence. 11. Organization of mitochondrial genomes in strains having high and moderate frequencies of petite mutant formation. Genetics 111:403-432. Evans, R. J., K. M. Oakley, and G. D. Clark-Walker. 1985. Elevated levels of petite formation in strains of Saccharomnvces cerev'isiae restored to respiratory competence. 1. Association of both high and moderate frequencies of petite formation with the presence of aberrant mitochondrial DNA. Genetics 111:389402. Faugeron-Fonty, G., and C. Goyon. 1985. Polymorphic variations in the ori sequences from the mitochondrial genomes of different wild-type yeast strains. Curr. Genet. 10:269-282. Faugeron-Fonty, G., C. Le Van Kim, M. deZamaroczy, R. Goursot, and G. Bernardi. 1984. A comparative study of the ori sequences from the mitochondrial genomes of twenty wild-type yeast strains. Gene 32:459-473. Gaillard, C., F. Strauss, and G. Bernardi. 1980. Excision sequences in the mitochondrial genome of yeast. Nature (London) 283:218-220. Henikoff, S. 1984. Unidirectional digestion with exonuclease III creates targeted breakpoints for DNA sequencing. Gene 28: 351-359. Macino, G., and A. Tzagoloff. 1980. Assembly of the mitochondrial membrane system: sequence analysis of a yeast mitochondrial ATPase gene containing the oli-2 and oli-4 loci. Cell 20:507-517. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory. Cold Spring Harbor, N.Y. Maxwell, R. J., R. J. Devenish, and P. Nagley. 1986. The

25. 26.

27. 28.

29. 30.

31. 32.

33.

1537

nucleotide sequence of the mitochondrial genome of an abundant petite mutant of Saccharomyces cere0isiae carrying the oril replication origin. Biochem. Int. 13:101-107. McClelland, M., J. Hanish, M. Nelson, and Y. Patel. 1988. KGB: a single buffer for all restriction endonucleases. Nucleic Acids Res. 16:364. Piskur, J. 1988. A 5 kb intergenic region containing oril in the mitochondrial DNA of Saccharomyces cerevisiae is dispensable for expression of the respiratory phenotype. FEBS Lett. 229: 145-149. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463-5467. Seraphin, B., M. Simon, and G. Faye. 1987. The mitochondrial reading frame RF3 is a function gene in Saccharonvyces uvcarurn. J. Biol. Chem. 262:10146-10153. Strausberg, R. L., and R. A. Butow. 1981. Gene conversion at the vanrl locus on yeast mitochondrial DNA. Proc. Natl. Acad. Sci. USA 78:494-498. Weiller, G., C. M. E. Schueller, and R. J. Schweyen. 1989. Putative target sites for mobile G+C clusters in yeast mitochondrial DNA: single elements and tandem arrays. Mol. Gen. Genet. 218:272-283. Wenzlau, J. M., R. J. Saldanha, R. A. Butow, and P. S. Perlman. 1989. A latent intron-encoded maturase is also an endonuclease needed for intron mobility. Cell 56:421-430. Zinn, A. R., and R. A. Butow. 1985. Nonreciprocal exchange between alleles of the yeast mitochondrial 21S rRNA gene: kinetics and involvement of a double-strand break. Cell 40: 887-895. Zinn, A. R., J. K. Pohlman, P. S. Perlman, and R. A. Butow. 1988. In Oi'o double-strand breaks occur at recombinogenic G+C rich sequences in the yeast mitochondrial genome. Proc. Natl. Acad. Sci. USA 85:2686-2690.