GENOMICS

12, 474-484

(19%)

Construction of a 2.6-Mb Contig in Yeast Artificial Chromosomes Spanning the Human Dystrophin Gene Using an STS-Based Approach ALISON J. COFFEY,* ROLAND G. ROBERTS,* ERIC D. Gmtd,t CHARLOTTE G. COLE,* RACHEL BUTLER,+ RAKESH ANAND,* FRANCESCO GIANNELLI,* AND DAVID R. BENTLEY* *Paediatric

Research Unit, Division of Medical Hospitals, 8th floor, Guy’s Tower, Washington University School and $ Biotechnology

and Molecular Genetics, United Medical and Dental Schools of Guy’s and St. Thomas’ London Bridge, London SE7 9RT, United Kingdom; tDepartment of Genetics, of Medicine, Box 8232, 4566 Scott Avenue, St. Louis, Missouri 63 110; Department, ICI Pharmaceuticals, Cheshire, United Kingdom

Received

August12.

1991;

A sequence tagged site (STS)-based approach has been used to construct a 2.6-h% contig in yeast artificial chromosomes (YACs) spanning the human dystrophin gene. Twenty-seven STSs were used to identify and overlap 34 YAC clones. A DNA fingerprint of each clone produced by direct Alu-PCR amplification of YAC colonies and the isolation of YAC insert ends by vectorette PCR were used to detect overlaps in intron 1 (280 kb) where no DNA sequence data were available, thereby achieving closure of the map. This study has evaluated methods for mapping large regions of the X chromosome and provides a valuable resource of the dystrophin gene in cloned form for detailed analysis of gene structure and function in the future. 0 1992 Academic Press, Inc.

INTRODUCTION

Dystrophin is a large 427-kDaprotein with amino acid sequence homology to the spectrin family of membrane cytoskeletal proteins. Dystrophin is found in smooth muscle throughout the body and in brain but is most abundant in skeletal and cardiac muscle, where it has been localized to the inner face of the plasma membrane (Zubrzycka-Gaarn et al., 1988). The human dystrophin gene spans approximately 2.3 Mb of the X chromosome at Xp21.2 (den Dunnen et al, 1989a). It contains an estimated 79 exons (den Dunnen et al., 1989a; Roberts et al., manuscript in preparation), of which about one-third have been localized. The gene is transcribed from different promoters (Fig. 1) (Boyce et al., 1991) in muscle and brain. The full-length 14-kb cDNA has been cloned and sequenced (Koenig et al., 1987, 1988). The X-linked diseasesDuchenne and Becker muscular dystrophies (DMD and BMD, respectively) are associated with mutations in the dystrophin gene. A large proportion of mutations are partial gene deletions or duplications (60 and 6-10% of the total, respectively) of varying size (Koenig et al., 1987; den Dunnen et al., 1989; Hu et al., 1990). Deletions that maintain the reading o&3%7543/92 $3.00 Copyright 0 1992 by Academic Press, Inc. All rights of reproduction in any form reserved.

414

revised

October

25, 1991

frame in the deleted transcript generally cause BMD, while those in which a frameshift has occurred usually cause DMD (the frameshift hypothesis) (Monaco et al., 1988; Malhotra et al., 1988). Further analysis of both gene structure and mutations has been hampered by the size and complexity of the dystrophin gene and would be facilitated by the isolation of the entire genomic region in cloned form. Yeast artificial chromosomes (YACs) allow the cloning of large fragments of DNA of up to at least 1 Mb (Burke et al., 1987). This has made possible the attainment of long-range continuity over regions of l-2 Mb in physical mapping of the human genome by the overlapping of cloned segments (Green and Olson, 1990b; Anand et al., 1991; Silverman et al., 1991; Ragoussis et al., 1991). The accessibility of YAC clones has been greatly enhanced by the development of ordered libraries and rapid screening methods based on the polymerase chain reaction (PCR) (Green and Olson, 1990a). Sequence tagged sites (ST&) are defined as short stretches of operationally unique DNA sequence that can be detected via PCR and act as a class of landmarks on the physical map (Olson et al., 1989). We have used an “STS-content mapping” approach (Green and Olson, 1990a) to isolate a contiguous set of overlapping YAC clones spanning the dystrophin gene. Construction of the 2.6-Mb contig has allowed refinement of the genomic map. This study also represents a good model system with which to evaluate methods for mapping other large regions of the X chromosome and provides the necessary reagents for further detailed structural and biological studies.

MATERIALS

AND

METHODS

Screening of the YAC libraries. YAC clones were isolated from the libraries of Washington University (Burke and Olson, 1991; Brownstein et al., 1989) and Anand (Anand et al., 1989) using a PCR-based approach to screen DNA representing pools of clones, followed by a filter hybridization step (Green and Olson, 1990a). All clones listed in

2.6-Mb Table 2 are from stated.

the Washington

University

YAC

CONTIG

library

unless

ACROSS otherwise

PCR analysis. The STS content of each YAC clone was determined by colony PCR (Huxley et al., 1990; Green and Olson, 1990a). The tip of a toothpick was touched on a colony and stirred in a 15-pl reaction containing 150 ng of each oligonucleotide primer, 67 mM Tris-HCl, pH 8.8, 16.6 mM (NH4)*S0,, 6.7 mM MgCl,, 0.5 mM of each deoxyribonucleoside triphosphate (dATP, dCTP, dGTP, dTTP), 1.5 units Amplitaq (Cetus Inc.). @-Mercaptoethanol (10 mM) and BSA (170 pg/ml, Sigma A-4628) were added to the reactions as they were set up. Thirty cycles of PCR under the conditions 93’C/l min, 6O”C/l min, 72”C/3 min were performed in a DNA thermal cycler (Perkin-Elmer Cetus). The primer sequences and sizes of expected products for each STS are given in Table 1. Products were run on either 2.5% agarose (Ultrapure BRL) or 5% polyacrylamide minigels and made visible by ethidium bromide staining. Colony Alu-PCR fingerprinting was performed as above using primers ALE1 (GCCTCCCAAAGTGCTGGGATTACAG) and ALE3 (CCA(C/T)GCACTCCAGCCTGGG) together (Cole et al., 1991) in 25-pl reactions. Cycling conditions were as follows: 30 cycles of 93”C/ 1 min, 65’C/l min, 72”C/7 min. Products were run on either 2.5% agarose minigels or 10% polyacrylamide vertical minigels containing 10% glycerol (Green and Olson, 1990a) and made visible by ethidium bromide staining. Charucterization of the YAC clones. Yeast chromosomal minipreps were prepared in agarose plugs using a lithium dodecyl fate method adapted from Southern et al. (1987) and Anand (1989) to give approximately 5 pg DNA per plug. YAC clones sized using contour-clamped homogeneous electric field (CHEF) trophoresis (DRII, Bio-Rad).

DNA sulet al. were elec-

Restriction digest analysis of YAC clones. All digests were performed as follows: Agarose plugs of yeast chromosomal DNA minipreps were rinsed three times in 20 ml TO.lE (TO.lE is 10 m&f TrisHCl, pH 8.0, 0.1 mM EDTA) for 30 min at room temperature with gentle shaking. Plugs were cut to the required size and incubated at 37’C for 30 min in the appropriate restriction enzyme buffer. The buffer was replaced, restriction enzyme was added, and the reactions were incubated at the appropriate temperature for 6 h or overnight. Hind111 digests of each clone were analyzed using conventional agarose slab gel electrophoresis. SfiI digests were electrophoresed using a CHEF apparatus. Following electrophoresis, the DNA was transferred to nylon membranes (Hybond N, Amersham) using standard protocols (Southern, 1975). Preparation ofpooled cDNA probe. To minimize vector contamination causing vector-vector cross-hybridization, all cDNA probes (Koenig et al., 1987) were prepared by PCR amplification of 50 pg of linearized plasmid using primers flanking the cloning site. The cDNA clone 63-l was divided into conveniently sized sections for PCR using a combination of insert and vector primers. The PCR products were pooled in approximately equimolar amounts to give a probe representing the entire dystrophin cDNA. Probe labeling and hybridization. Hybridizations to Southern filters were carried out at 65°C using established protocols (Maniatis et al., 1982). Hybridizations to gridded YAC clones were performed at 65°C in 6X SSC, 10X Denhart’s, 50 mMTris-HCl, pH 7.4,1% Sarkosyl, 10% dextran sulfate. Probes were labeled either by random hexanucleotide priming (Feinberg and Vogelstein, 1983) or by PCR under cycling conditions as described above, under buffer conditions as in Green and Olson (1990a), and replacing dCTP with 50 &i [~u-~xP]dCTP (John Collins, personal communication). Generation of end probes from YACs. End probes from YAC clone 22-1 were generated using a modified vectorette method. The vectorette library was constructed using RsuI and following the procedure outlined by Riley et al. (1990). A 5O-/.d PCR reaction included 5 ~1 of the library, 1 unit of Perfect Match (Stratagene), and primer 1089 or 1091 with 224 (primers as in Riley et al. ). Cycling conditions were as follows: 38 cycles of 93”C/l min, 6O”C/l min, 72”C/3 min. The amplified DNA fragment was gel-purified according to the method of Cole et al. (1991) and subjected to a further 20 cycles of PCR (without the

THE

DYSTROPHIN

GENE

475

Perfect Match) using primers in the sup-4 gene [Sup4-2 for the “left” end (GTTGGTTTAAGGCGCAAGAC) or Sup4-3 for the “right” end (GTCGAACGCCCGATCTCAAG)] .m conjunction with the universal primer 224. The probes were pre-reassociated with sonicated human placental DNA prior to use in hybridizations (Sealey et al., 1985).

RESULTS Construction

of YAC Contigs by STS Analysis

STSs for the dystrophin gene were generated from genomic probes pERT84,87-1, and 87-15 and from cDNA sequence for the remainder as detailed in Table 1. In addition, reaction 23, which lies in the P20 intron 40 kb upstream of exon 45, was generated from sequence data obtained by analysis of a deletion breakpoint in a DMD patient (Love et al., 1990). Sixteen STSs (asterisked in Table 1; see also Fig. 1) spaced at an average interval of 150 kb throughout the gene were used to identify YAC clones from the libraries of Washington University and Anand et al. (1991) by a PCR-based screening strategy. Of 48 clones identified, 34 were isolated for further analysis and are shown in Fig. 1. For example, STS reaction 7 (R7; exon 7) identified three clones, 7-1, 7-2, 7-3, that were chosen for further analysis; R3 (genomic probe 8715) also identified three clones, 3-1,3-2, and 3-3. Eleven additional STSs (also listed in Table 1 and shown in Fig. 1) were used in PCR analysis of individual colonies to determine the STS content of each YAC clone and hence to establish overlaps between sets of clones. As shown in Fig. 2, for example, clone 7-2 was found to contain R12 (exon 2), R13 (exon 3), R7 (exon 7), R2 (exon 8), R14 (exon ll), and R27 (genomic probe 87-l) but was negative for R21 (exon 25) and R3 (genomic probe 87-15). Clone 3-3 was positive for R14 (exon 11) and R27 (genomic probe 87-l), both of which thus defined an overlap between clones 7-2 and 3-3. Further overlaps identified by STS analysis shown in Fig. 2 defined a contiguous set of overlapping clones from R12 (exon 2) to R16 (exon 33). This approach identified overlaps between clones covering the entire gene, including the brain promoter, except across intron 1 (280 kb) (see below). A further 12 STSs (not listed; Roberts et al., manuscript in preparation; sequences available on request) were used to assist in exon assignment to the YAC clones from the 3’ region of the dystrophin gene. Further characterization of the YAC clones was carried out by hybridizing dystrophin cDNA probes to Southern blots of HindIII-digested DNA of individual YAC clones. Hybridization was initially carried out with a single pool of probes representing the entire dystrophin cDNA. Further confirmation was also obtained using individual cDNA probes. Clones were scored for the presence of each exon by the presence of the Hind111 fragment known to contain that exon (see Table 2) (den Dunnen et al, 1989a). For example, cDNA clones 9-7 (probes l-2a, comprising exons l-10, see Fig. 3a) and 30-2 (probes 2b-3, comprising exons 11-19, see Fig. 3b) were hybridized to clones 7-3,7-l, 7-2,3-3, 3-2, and 3-l. The overlap between clones 7-2 and 3-3 is shown by the

1 (5’ +

of Expected

Primer

and Sizes

CTTTCAGGAAGATGACAGAATC CTTTCCCCCTACAGGACTCAG GAAAGAGAAGATGTTCAAAAG GGCAAGCAGCATATTGAGAAC CTATTTGACTGGAATAGTGTG CCTATCCAGATAAGAAGTCC GTACATGATGGATTTGACAGC CTATCATGCCTTTGACATTCCAG CtgatgaaATAATTCTGAATAGTCACAAAAAG GTTCCTGGATGCAGACTTTGTG CAATTCAGCCCAGTCTAAAC GCTAAAGAAGAGGCCCAAC GTCTGAGTGAAGTGAAGTCTG CAACTTACAACAAAGAATCACAG GGTATCAGTACAAGAGGCAG CGATTTGACAGATCTGTTGAG GCCTATGTGTTGTCCCTTCG CTCCAGGATGGCATTGGCAG ATTTGTTTTATGGTTGGAGG CTGCTCTGGCAGATTTCAAAC AATGCAGGATTTGGAACAGAGGCGTCC TTGAAAGAATTCAGAATCAGTGGGATG GACCTCCGCCAGTGGCAGAC GGTGAAATTGAAGCTCACAC GAGGCCACGGATGAGCTGG CAGGGAGGATCCGTGTCCTG atgATCAGAGTGAGTAATCGGTTGG

Sequences

3’)

Products

for STSs

in Library

Primer

2 (5’ -,

Screening

CCTGTCACTCCATCATGCC GTCCTCTACTTCTTCCCACC CTTAGAAAATTGTGCATTTAC CCCTGTCAGGCCTTCGAGGAG CAGGATCGAGTAGTTTCTC CTTTAGGTGGCCTTGGCAAC CATGCTAGCTACCCTGAGGC CTCAATAAGAGTTGGATTCATTC CtgatcaggaTCCAGTAACGGAAAGTGC TTGGAAAATGTCAAGTTAGCC CTGAGTGTTAAGTTCTTTGAG GGCCTCTTGTGCTACAGGTGG CAAAGCTGTTACTCTTTCATC CTTGAGAGCATTATGTTTTGTC CCTTTCATCTCTGGGCTCAG GCATGTTCCCAATTCTCAGG CATTCATGGTGAATCTCAAGAC CTGTCTGACAGCTGTTTGCAG GCTTTTCTTTTAGTTGCTGC GTCACCCACCATCACCCTCTG TTCGATCCGTAATGATTGTTCTAGCCTC CTTGGTTTCTGTGATTTTCTTTTGGATTG GAATGCTTCTCCAAGAGGC GTAACAGGACTGCATCATCG GGTGATCTTGGAGAGAGTC GTCTTCCAAATGTGCTTTAC atatcgatCTAGCAGCAGGAAGCTGAATG

Used

1

3’)

and Characterization

(bp) 95 223 60 81 109 117 166 400 226 130 113 113 113 91 95 125 287 164 83 98 113 212 136 100 103 68 82/78

Size

of YAC

Clones

: b b b b b

ii b b b b f b b b

b b b b b d e d

;

A

Ref.’

h

C

C

c

c

e

C

c

c

B

Note. The asterisks indicate STSs used to identify YAC clones from the libraries. Sequences for STSs R32-43 are available upon request (Roberts et al., in preparation). ‘Refs. in column A, source of sequence used for primer design; column B, source of primer. When only one reference is given, primers were designed for this work only. The key to references is as follows: (a) Nude1 et al., 1989; (b) Koenig et al., 1988, (c) Roberts et al., 1991; (d) R.G.R., unpublished; (e) Roberts et al., 1990; (f) Love et al., 1990; (g) Beggs et al., 1990; (h) Abbs et al., 1991; (i) Roberts et af., 198913.

R24’ (brain promoter) R22* (Exon 1) R12 (Exon 2) R13 (Exon 3) Ri’* (Exon 7) R2 (Exon 8) R14 (Exon 11) R27 (87-l) R3* (87-15) R30 (Exon 21) R21* (Exon 25) R25* (Exon 27) R16* (Exon 33) R31 (Exon 39) R8* (Exon 40) R17* (Exon 44) R23* (~20 intron) R18 (Exon 45) R4* (Exon 46) R9 (Exon 51) R28 (Exon 52) R29 (Exon 53) R19* (Exon 54) R20* (Exon 56) RlO* (Exon 59) Rll* (Exon 66) R5* (Exon 79)

Primers

Primer

TABLE

F

2

3

g

h&CL 4-l

a-1 5-5 &W-

5-41-1 --__I

FIG. 1. The dystrophin gene. Exons are marked in the horizontal box representing the dystrophin gene at top as bold vertical lines where mapping data are available and faint lines where the exact location is not known. Reference probes and SfiI sites (A-J) are marked on the line below. The dotted line marked S is the SfiI site referred to in Boyce et al. (1991), which is partially cleaved in their study. The short vertical bars below the solid line numbered R2-R43 are the STSs. The YAC clones are drawn below the STSs and are named by the STS used in their isolation. Upward vertical bars on each YAC clone represent the STSs, and the downward vertical bars the exons detected in each clone. The thick lines denote the extent of mapping data confirmed between landmarks, and the thin lines show the upper limits of the extent of each clone based on its known length and mapping constraints. A wavy line at the end of some YAC clones denotes these clones as chimeric.

3-1

478

COFFEY

RI2 R13

60bF,

-

81bp

R7

109bp

R2

117bp

RI4

166bp

R27

400bp

R3

226bp

R21

113bp

R25

99bp

RI6

113bp

FIG. 2. Determination of the STS content of a selection of YAC clones. The clones are marked along the top; the STSs and sizes of products are marked down the sides. Products were electrophoresed on a 2.5% agarose minigel and made visible by ethidium bromide staining.

presence of bands representing Hind111 fragments of 10.5 kb (containing exons 10 and 11) and 4.0 kb (containing exon 12) in both clones. The results of this analysis confirmed the integrity of the cloned inserts between the landmarks used in the analysis and extended the information provided by the STS data. Closure of the Map by Alu-PCR Fingerprinting Vectorette PCR

and

Intron 1 (between the muscle transcription start site and exon 2) at approximately 280 kb (Boyce et al., 1991) is one of the largest known introns in the dystrophin gene. Although YACs containing each of the flanking exons were isolated, no overlap was detected on the basis of the STS or cDNA hybridization analysis. As no sequence information was available within intron 1, it was necessary to use an alternative approach to detect overlaps. The use of colony Alu-PCR fingerprinting as a rapid procedure for identifying overlaps was evaluated by analysis of the dystrophin YACs. To maximize the information content of each clone fingerprint, primers that directed DNA synthesis from either end of the AZu repeat sequence were used (ALE1 and ALE3; Cole et al., 1991). On average, each YAC produced 10 bands visible on agarose or polyacrylamide minigels. Overlap between clones was defined by the presence of a number of shared bands. Figure 4 shows the results of colony Alu-PCR fingerprinting of clones 24-1, 24-2, 22-1, 22-2, 7-1, 7-3, and 7-2. At least five shared bands were observed between clones 22-2 and 7-l. Clone 22-2 is known to contain exon 1, and clone 7-2 is known to contain exon 2 on the basis of the STS data. The shared Alu-PCR bands indicate that these two clones have a significant overlap, and thus the contig spans intron 1. Additional overlaps between other clones were also confirmed by the results of the Alu-PCR analysis. For example, three bands were seen in common in clones 24-l and 22-2. These clones

ET

AL.

were previously shown to overlap from STS data, as they were both positive for R24 (brain promoter exon 1). To confirm the continuity across intron 1, probes were made from each end of clone 22-l using a modified vectorette system as described under Materials and Methods. Figure 5 shows the results of hybridization of probes derived from insert DNA directly adjacent to either the “left” vector arm of YAC clone 22-1 (which contains the CEN4 sequences) or the “right” vector arm of YAC clone 22-l (which contains the URA3 sequences) to Southern blots of HindIII-digested DNA of clones 24-1, 24-2, 22-1, 22-2, 7-1, 7-2, and 7-3. The analysis also included blots of HindIII-digested DNA from a human genomic sample and a somatic cell hybrid, C12D, which contains the human X chromosome (Goss and Harris, 1977) (not shown). The “left” end probe (VPlL, seen as an open rectangle in Fig. 1) detected a band of 7 kb in clone 22-l and a band of 12 kb in clones 22-2, 7-1, and 7-2 but not 7-3. This result orients the YAC as shown in Fig. 1 and confirms the overlap indicated by the AluPCR fingerprint. The “right” end probe (VPlR) from 22-l detected a Hind111 fragment of 7 kb in clone 22-l and one of 5.4 kb in clones 24-l and 22-2. This confirms the orientation of the YAC and shows that clone 22-l is entirely contained within clone 22-2. The constraints placed on the furthest possible points of clones 22-2 and 7-l together with the hybridization data from VPlL allow the positioning of VPlL. R24 (brain promoter exon 1) is 46 kb proximal to SfiI site B (data from Boyce et al., 1991). Clone 22-2, which is positive for both R24 and R22 (exon l), is 390 kb in length and therefore stretches at most 390 kb distal from R24. Clone 7-l is 360 kb long and is positive for STSs R12 (exon 2), R13 (exon 3), and R7 (exon 7). From the cDNA analysis, clone 7-l does not contain exon 8; this constrains the position of the distal end of the clone and therefore the proximal end to stretch a maximum of 360 kb from R7. VPlL is positioned within the overlap between clones 7-l and 22-2 as shown in Fig. 1. Clone 7-2 is also positive for VPlL and hence the dystrophin-containing portion of this clone extends at least as far as this probe as shown in Fig. 1. Clone 22-l is 200 kb long and so VPlR can be placed on this basis approximately 35 kb distal of SfiI site B as shown in Fig. 1. Refinement of the Genomic Map To compare the existing genomic SfiI restriction map (for schematic representation, seeFig. 6k) (den Dunnen et al., 1987a, 1989b; Kenwrick et al., 1987; van Ommen et aZ., 1987; Burmeister et al., 1988; Meitinger et al., 1988) wit,h that of the YACs, Southern blots of SfiI-digested clones were hybridized with probes chosen to lie within particular SfiI fragments. A control lane of human genomic DNA was included in each Southern blot. The results obtained from characterization of the YAC clones (Fig. 6; see also Fig. 1) agreed with previously published data of the detailed map of the dystrophin gene (Monaco et al., 1986,1987,1988; Koenig et al., 1987,1989; Wapen-

2.6-Mb

YAC

CONTIG

ACROSS

THE

TABLE Data

YAC

Size (kb)

24-1 24-2 22-l 22-2 7-l 7-3 7-2

200 200 390 360 280 910

3-3 3-2 3-1 21-1

260 250 250 145

25-1

200

8-1

360

16-3 17-l 23-l 23-2 23-3 23-4 4-l 19-4 19-2 19-3 19-l

290 360 200 200 200 ND 290 350 150 150 460

20-l

440

20-2 10-2 10-l

200 360 570

5-5

700

5-4 5-3

250 450

5-2 5-l 11-l

250 280 390

390

Obtained

STS content R24 R24 R22 R24, R22 R12, R13, R7 R13, R7 R12, R13, R7 R2, R14, R27 R14, R27, R3 R14, R27, R3 R27, R3 R27, R3, R30 R21 R30, R21, R25 R16, R31, R8 R16, R31, R8 R17 R16, R31, IX.8 R17 R23, R18 R23, R18 R23 R17, R23, R18 R4, R9, R28 R28, R29, R19 R29, R19 R29, R19 R28, R29, R19 R20, RIO R28, R29, R19 R20, RlO R20, RlO, R32 R20, RlO R20, RlO R32-R43 Rll, R5 R34-R43 Rll, R5 R37-R43, R5 R33-R43 Rll, R5 R37-R43, R5 R37-R43, R5 R33-R43 Rll, R5

a HindIII fragments detected by * Letters denote sites found, ’ Exon numbering is provisional; between exon number and Hind111 d 5-5 is not positive for exon 61

from

DYSTROPHIN

2

Characterization

Exon content

of the YAC

Clones

Hind111 fragments”

%I sites*

ND ND ND ND 2-7 3-7 Z-10

A, B A, B

10-17 10-17 13-17 13-25

9-14 9-14 11-14 ND

-

21-40

Brain Brain

1 1

479

GENE

Comments

of Anand of Anand

et al. et al.

ND

Chimeric Chimeric Chimeric From the library

of Anand

et al.

ND

ND

From

the library

of Anand

et al.

28-44 29-43 44 45 45 ND 44-45 46-52 52-54 54-55 53-55 52-59

21-32 22-31 ND ND ND ND ND 34-41 41-44 44-45 42-45 41-48

E’, E E’, E ND ND ND ND ND F -

Chimeric From the library Chimeric

of Anand

et al.

of Anand

et al.

G

Chimeric

52-59

41-48

G

Chimeric

56-60 56-59 56-79’

46-49 46-48 46-65

G H, I

Chimeric

63-7gd

52-65

K 1

Chimeric

68-79

56-65 53-65

H, I

Brain 1, 1 2-7 3-7 2-12

61-79

68-79 68-79 61-79

56-65 56-65 53-65

ND ND ND ND s, c

From From

the library the library

Chimeric

Chimeric From the library Chimeric

-

H, I

cDNA probes in genomic DNA, numbered as in den Dunnen et al. (1989). denotes no sites detected; ND denotes not determined. at least 79 exons based on detailed analysis of YAC 10-l (Roberts et al., manuscript in prep.) Correspondence fragment number is provisional after exon 60. on STS data but contains Hind111 fragments 52 and 53, one of which must contain exon 61.

aar et al., 1988; Zubrzycka-Gaarn et al., 1988; den Dunnen et al., 1989; Klamut et al, 1989,199O; Blonden et al, 1989; Boyce et al., 1991) and led to the following further conclusions regarding the positions of exons within the gene: Clones 24-l and 24-2 are 390 and 200 kb long, respectively. A probe from brain exon 1 hybridizes to a 140-kb fragment in an SfiI digest of clones 24-l and 24-2 (Fig. 6a). This indicates the presence of SfiI fragment AB in these clones and confirms its size.

Clone 7-2 is 910 kb long. The cDNA clone 30-2 (probes 2b-3, comprising exons lo-17), which recognizes SfiI fragment CD, hybridizes strongly to a 60-kb fragment and weakly to a 440-kb fragment in an SfiI digest of clone 7-2 (Fig. 6b). This suggests that site C has been partially digested by SfiI in clone 7-2. The strongest signal observed is that of the 60-kb fragment, and this is the portion of clone 7-2 found in SfiI fragment CD. The 440kb band is presumed to result from digestion at a site 440 kb from the 3’ end of clone 7-2, which corresponds to the

480

COFFEY

ET

AL. br--,-wmw II/l tr.r-r-IMP-!

am b

ITI

N bbrni-4

r--I I

Ii

N

10.5 (Exons __

10.5

kb

(Exons

10

+

-6.6 -6.0

II)

__

4.0

kb 10 +

kb kb

(Exon (Exon

13) 16)

kb

(Exon

12)

2.7 (Exons

~

3.1

kb

(Exon

5)

-1.7 *Sk

11)

kb 14

kb

(Exon

+

15)

17)

“(

FIG. 3. Autoradiographs showing hybridization of cDNA clones (a) 9-7 and (b) 30-2 to a Southern blot of HindIII-digested YAC clones (marked along the top). A genomic control was included but is not shown. Sizes of the Hind111 fragments detected and the exons contained therein are marked.

position of the weakly digesting SfiI site reported by Boyce et al. (1991) and which is marked “S” in Fig. 1. Clone 8-l is 360 kb long and contains exons 28-44. A probe containing exons 43-46, which recognizes SfiI fragment EF, detects a 240-kb fragment on hybridization to an SfiI digest of clone 8-l (Fig. 6~). The cDNA clone 47-4 (probes 5b-7, comprising exons 31-46), which recognizes both SF-1fragments DE and EF, detects three fragments on hybridization to an SfiI digest of clone 8-l: a 240-kb fragment (the same size fragment detected by the probe for exons 43-46), a 140-kb fragment and a lo-kb fragment (Fig. 6d). The lo-kb fragment is also seen in clone 16-3. Clone 16-3 is 290 kb long and contains exons 29-43. A probe containing exons 43-46 (as described above) detects a 60-kb fragment on hybridization to an SfiI digest of clone 16-3 (Fig. 6~). The cDNA clone 47-4 detects three fragments on hybridization to an SfiI digest of clone 16-3: a 180-kb fragment, a 60-kb fragment (assumed to be the same fragment detected by

FIG. 4. Ethidium bromide-stained 10% polyacrylamide vertical minigel containing 10% glycerol of colony Alu-PCR fingerprinting (YAC clones marked on the top) using both ALE1 and ALE3 as primers. Negative controls, containing total yeast DNA and no DNA, respectively, were included.

the probe for exons 43-46), and a lo-kb fragment (assumed to be the same fragment seen in clone 8-l with this probe). This is due to cleavage of an SfiI site E’, 10 kb proximal to SfiI site E (Fig. 6d). The 240-kb fragment detected by the probe for exons 43-46 in clone 8-l suggests that exon 44 is at most 240 kb distal to SfiI site E. The 140-kb fragment detected by cDNA clone 47-4 limits the position of exon 28 to within 140 kb proximal to SfiI site E’ and exon 27 to being greater than 140 kb proximal to SfiI site E’. The 60-kb fragment detected by the probe for exons 43-46 in clone 16-3 limits the position of exon 43 to within 60 kb distal to SfiI site E. The 180-kb fragment detected by cDNA clone 47-4 must represent the portion of the clone 16-3 found in SfiI fragment DE. However, the size of fragment DE is only 130 kb (den Dunnen et al., 1989) and hence this YAC is chimerit. Clone 4-l contains exons 46-52 and is 270 kb long. A probe containing exons 50-54, which recognizes SfiI fragment FG, detects a 170-kb fragment on hybridization to an SfiI digest of clone 4-l (Fig. 6e). The cDNA probe 47-4 detects both a lOO-kb fragment and a 170-kb fragment of equal intensity (Fig. 6f). These data suggest that clone 4-l contains SfiI site F and limit the position of exon 52 to within 170 kb of site F. Clone 10-l is 560 kb long and contains exons 56-79. The genomic probe J66 (van Ommen et al., 1986), which recognizes SfiI fragment GH, detects a 180-kb fragment on hybridization to an SfiI digest of clone 10-l (Fig. 6g). Exon 60 is 20 kb proximal to J66, which is approximately 140 kb proximal to SfiI site H (den Dunnen et al., 1989a). On the basis of this result, exons 56-59 therefore lie close to exon 60. A fragment of the cDNA clone 63-1, comprising part of the last exon and corresponding to nucleotides 12,272-13,900, which recognizes SfiI fragment IJ, detects a 320-kb fragment on hybridization to an SfiI digest of clone 10-l (Fig. 6h). Hybridization of total human DNA to clone 10-l detects three bands: a

2.6-Mb

YAC

CONTIG

__

ACROSS

THE

DYSTROPHIN

12kb t

_

FIG. 5. Autoradiographs showing hybridizatopn the top). Sizes of the fragments detected are marked. vector cross-hybridization.

481

GENE

__

7kb

~

5.4kb

7kb

of (a) VPlL and (b) VPlR to a Southern The additional band seen at a different

320-kb band (the same band detected by the fragment of clone 63-l), a 180-kb band (the same band detected by J66), and a 60-kb band (Fig. 6i). The 60-kb band is pre,sumed to represent the S/i1 fragment HI. Clone 11-l is 390 kb long and contains exons 61-79. A fragment of the cDNA clone 63-l corresponding to nucleotides 12,272-13,900 (as described above) detects a 340-kb fragment on hybridization to an SfiI digest of clone 11-l (Fig. 6j). From this result, exons 61-63 (which have previously been localized between sites G and I) must be localized within 50 kb proximal to site I. For 12 of the 28 YAC clones (approximately 42%) isolated from the library from Washington University (marked in Table 2 and Fig. 1), the limits placed on the extents of clones based on the presence or absence of landmarks were found to be inconsistent with the apparent size of the clone. These clones are presumed to be chimeric, i.e., with inserts derived from more than one region of the genome that arose as a result of either co-ligation of two EcoRI fragments or recombination following co-transformation as proposed by Green and Olson (1991). DISCUSSION

A single contig of 2.6 Mb between confirmed landmarks (with a maximum possible size of 3.1 Mb from the furthest possible extents of each YAC at the ends of the contig) spanning the human dystrophin gene has been constructed by defining continuity between landmarks based on STSs, exon data, and SfiI sites. A minimum of 12 YACs represent the gene. At the outset of the project, the only method available to screen ordered YAC libraries was PCR (Green and Olson, 1990a; Anand et al., 1991). In this study, sufficient STSs were generated from available cDNA and genomic probe sequence data to isolate all the clones and to detect all but one overlap purely by analysis of YAC colonies. Colony PCR analysis thus represents the fastest and most convenient way to generate such data. A similar approach was adopted by Green and Olson (199Ob) to map the CFTR gene region where STSs were generated from cDNA, genomic probes, and subclones of the ends of YACs. To apply the

blot of HindUI-digested position in each lane

YAC clones presumed

(b) is

(marked on to be due to

STS approach to other regions of the genome where little or no sequence data are available, it is necessary to have an alternative method to generate large numbers of STSs de nouo. Alu-PCR (Nelson et al., 1989) of somatic cell hybrid DNA has been demonstrated to be an efficient method for generating STSs from discrete chromosomal regions (Cole et aZ., 1991). Microdissection (Ltidecke et al., 1989) has also been used to generate a high density of region-specific cloned fragments suitable for conversion into STSs, but the proportion of clones that can be successfully converted into usable sequence has been found to be lower than that for the Alu-PCR products. The generation of chromosome 7-specific STSs from hybrid cell lines and flow-sorted chromosomes has also been used (Green et al., 199la). The use of internal landmarks to determine the colinearity between clones is a very rapid approach and is not hampered by cloning artifacts giving rise to chimeric clones. The use of internal landmarks may not detect short overlaps, however, and in such cases it is necessary to resort to other methods to determine continuity. The overlap between clones in intron 1 of the dystrophin gene was detected by Alu-PCR of YAC colonies. This technique generates a characteristic fingerprint of each clone without the need for preparation of YAC DNA and, in contrast to analysis using an individual STS, assays multiple specific sites in each clone. This method is a rapid, reproducible, and universal method for comparative analysis (fingerprinting) of YACs that can be applied to overlapping clones in the absence of any prior information about the region under study. The value of random fingerprinting has been demonstrated in the approach taken to overlap cosmids in mapping the genome of the nematode Caenorhabditis elegant (Coulson et al., 1986). The other approach used to detect the overlap in intron 1 in this study was to rescue the ends of a YAC by vectorette PCR, a method originally applied to a walking strategy used to construct a YAC contig in the CFTR region (Anand et al., 1991). This approach would be impeded by the occurrence of chimeric clones. The parameters affecting the ability to obtain continuity in YAC clones across a region are the density of available probes, the sizes of the inserts in the YAC clones,

482

COFFEY

ET

AL.

b

-

390

kb

I

200

kb

--

140

kb

-

440

kb

:

-

e

-

f

h

9

*\

60ko

*I

36C 290 240 180 140

kb kb kb kb kb

-

60 kb

-

:Okb

i

u3 44

ee

-

270

kb

-

170

hb

-

100

kb

-

560

kb

-

320

kb

-

180

kb

-

k

60 kb

-

390

ib

-

340

kb

6.. MP J-3

CEN

A

B

/

1

I

I 140

s

C

D

E’E

F

G

HI

J

I

I /I 1301

I

I

II

I

TEL 325

375

230

t-700+

FIG. 6. (a-j) Autoradiographs showing hybridization sample). Sizes of the fragments detected are marked. (a) 2b-3, comprising exons 10-17) hybridized to YAC clone (probes 5b-7, comprising exons 31-46) hybridized to YAC 47-4 hybridized to YAC clone 4-l. (g) Genomic probe J66 nucleotides 12,272-13,900 hybridized to YAC clone 10-l. 63-l corresponding to nucleotides 12,272-13,900 hybridized map of the dystrophin gene. S/Z sites are marked (A-J). (1991). The sizes of fragments are marked below the line arrows marked BP and MP, respectively.

470

10

270

280

680 60

of probes to a Southern blot of SfiI-digested YAC clones (C, cut sample; U, uncut Brain exon 1 hybridized to YAC clones 24-l and 24-2. (b) cDNA clone 30-2 (probes 7-2. (c) Exons 43-46 hybridized to YAC clones 8-1 and 16-3. (d) cDNA clone 47-4 clones 8-l and 16-3. (e) Exons 50-54 hybridized to YAC clone 4-1. (f) cDNA clone hybridized to YAC clone 10-l. (h) A fragment of cDNA clone 63-l corresponding to (i) Total human DNA hybridized to YAC clone 10-l. (j) A fragment of cDNA clone to YAC clone 11-l. (k) Schematic representation of the genomic SfiI restriction The dotted line marked S is the partially cleaved S/II site referred to in Boyce et al. in kilobases. The positions of the brain promoter and muscle promoter are shown as

and the complexity of the libraries screened. Isolation of clones to form the dystrophin contig from the library from Washington University (made from 46,XY DNA, with an average insert size of 250 kb, representing two and a half X-chromosome equivalents) using STSs spaced at approximately one per 150 kb resulted in 95% coverage of the gene in three contigs. Closure was achieved by isolating clones from the library of Anand et al. (made from 48,XXXX DNA, with an average insert size of 370 kb, representing seven X-chromosome equiva-

lents). Construction of the dystrophin YAC contig has proved a good model system with which to evaluate the STS approach to mapping a large region of the X chromosome. It has demonstrated the need for a high density of STSs, YAC clones with large inserts, high-complexity libraries, and development of independent methods for overlap detection. The availability of YACs spanning the dystrophin gene has provided the basis for detailed mapping and sequence analysis of exons within the gene (Roberts et al., manuscript in preparation). In addition,

2.6-Mb

YAC

CONTIG

ACROSS

the use of these YACs in combination with those described in another study (Monaco et aZ., in press) has enabled an attempt to reconstruct the entire gene in a single artificial chromosome in a directed manner for reintroduction into mammalian cells and study of gene expression (den Dunnen et aZ., manuscript in preparation). ACKNOWLEDGMENTS We are grateful to Drs. Anthony Monaco, Johan den Dunnen, and Michel Koenig for useful discussions; to Dr. Ian Dunham for critical review of the manuscript; to Stephen Abbs for gift of primers and critical review of the manuscript; to Dr. Chris Todd, John Collins, and Sheila Hassock for help in screening libraries; to the HGMP Resource Centre at Northwick Park for help in isolating a clone; and to Miss Adrienne Knight for secretarial assistance. This work was supported in part by the Medical Research Council, the Muscular Dystrophy Group of Great Britain and Northern Ireland, the Spastics Society, and the Generation Trust. E.D.G. is a Lucille P. Markey Scholar, and this work was supported in part by a grant from the Lucille P. Markey Charitable Trust.

REFERENCES Abbs, S., Yau, S. C., Clark, S., Mathew, C. G., and Bobrow, M. (1991). A convenient multiplex PCR system for the detection of dystrophin deletions: A comparative analysis with cDNA hybridisation shows mistyping.9 by both methods. J. Med. Genet. 28: 304-311. Anand, R., Villasante, A., and Tyler-Smith, C. (1989). Construction of yeast artificial chromosome libraries with large inserts using fractionation by pulsed-field gel electrophoresis. Nucleic Acids Res. 17: 3425-3433. Anand, R., Ogilvie, D. J., Butler, R., Riley, J. H., Finniear, R. S., Powell, S. J., Smith, J. C., and Markham, A. F. (1991). A yeast artificial chromosome contig encompassing the cystic fibrosis locus. Gerwmics 9: 124-130. Beggs, A. H., Koenig, M., Boyce, F. M., and Kunkel, L. M. (1990). Detection of 98% of DMD/BMD deletions by polymerase chain reaction. Hum. Genet. 86: 45-48. Blonden, L. A., den Dunnen, J. T., van Passen, H. M. B., Wapenaar, M. C., Grootscholten, P. M., Ginjaar, H. B., Bakker, E., Pearson, L. P., and van Ommen, G. J. B. (1989). High resolution deletion breakpoint mapping in the DMD gene by whole cosmid hybridisation. Nucleic Acids Res. 17: 5611-5621. Boyce, F. M., Beggs, A. H., Feener, C., and Kunkel, L. M. (1991). Dystrophin is transcribed in brain from a distant upstream promoter. Proc. Natl. Acad. Sci. USA 88: 1276-1280. Brown&sin, B. H., Silverman, G. A., Little, R. D., Burke, D. T., Korsmeyer, S. J., Schlessinger, D., and Olson, M. V. (1989). Isolation of single-copy human genes from a library of yeast artificial chromosome clones. Science 244: 1348-1351. Burke, D. T., Carle, G. F., and Olson, M. V. (1987). Cloning of large segments of exogenous DNA into yeast by means of artificial chromosome vectors. Science 236: 806812. Burke, D. T., and Olson, M. V. (1991). Preparation of clone libraries in yeast artificial chromosome vectors. In “Methods in Enzymology” (C. Guthrie and G. R. Fink, Eds.), Vol. 194, pp. 251-2’70, Academic Press, San Diego. Burmeister, M., Monaco, A. P., Gillard, E. F., van Ommen, G. J. B., Affara, N. A., Ferguson-Smith, M. A., Kunkel, L. M., and Lehrach, H. (1988). A lo-megabase physical map of human Xp21, including the Duchenne muscular dystrophy gene. Genomics 2: 189-202. Cole, C. G., Goodfellow, P. N., Bobrow, M., and Bentley, D. R. (1991). Generation of novel sequence tagged sites (STSs) from discrete chromosomal regions using Alu-PCR. Genomics 10: 816-826. Coulson, A., Sulston, J., Brenner, S., and Karn, J. (1986). Toward a

THE

DYSTROPHIN

GENE

483

physical map of the genome of the nematode Cuenorhabditis elegans. Proc. Natl. Acad. Sci. USA 83: 7821-7825. den Dunnen, J. T., Bakker, E., Klein Breteler, E. G., Pearson, L. P., and van Ommen, G. J. B. (1987). Direct detection of more than 50% of the Duchenne muscular dystrophy mutations by field inversion gels. Nature (London) 329: 640-642. den Dunnen, J. T., Grootscholten, P. M., Bakker, E., Blonden, L. A. J., Ginjaar, H. B., Wapenaar, M. C., van Passen, H. M. B., Van Broeckhoven, C., Pearson, P., and van Ommen, G. J. B. (1989a). Topography of the Duchenne muscular dystrophy (DMD) gene: FIGE and cDNA analysis of 194 cases reveals 115 deletions and 13 duplications. Am. J. Hum. Genet. 46: 835-847. den Dunnen, J. T., Bakker, E., van Ommen, G. J. B., and Pearson, L. P. (1989b). The DMD gene analysed by field inversion gel electrophoresis. Br. Med. Bull. 45: 644-658. Feinberg, A. P., and Vogelstein, B. (1983). A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 132: 6-13. Goss, S. J., and Harris, H. (1977). Gene transfer by means of cell fusion. J. Cell. Sci. 25: 17-37. Green, E. D., and Olson, M. V. (1990a). Systematic screening of yeast artificial-chromosome libraries using the polymerase chain reaction. Proc. Natl. Acad. Sci. USA 87: 1213-1217. Green, E. D., and Olson, M. V. (1990b). Chromosomal region of the cystic fibrosis gene in yeast artificial chromosomes: A model for human genome mapping. Science 250: 94-98. Green, E. D., Mohr, R. M., Idol, J. R., Jones, M., Buckingham, J. M., Deaven, L. L., Moyzis, R. K., and Olson, M. V. (1991a) Systematic generation of sequence-tagged sites for physical mapping of human chromosomes: Application to the mapping of human chromosome 7 using yeast artificial chromosomes. Genomics 11: 548-564. Green, E. D., Riethman, H. C., Dutchik, J. E., and Olson, M. V. (1991b). Detection and characterization of chimeric yeast artificialchromosome clones. Genomics 11: 658-669. Hu, X., Ray, P. N., Gordon Murphy, E., Thompson, M. W., and Worton, R. G. (1990). Duplicational mutation at the Duchenne muscular dystrophy locus: Its frequency, distribution, origin and phenotype-genotype correlation. Am. J. Hum. Genet. 46: 682-695. Huxley, C., Green, E. D., and Dunham, I. (1990). Rapid assessment of S. cereuisiae mating type by PCR. Trends Genet. 6: 236. Kenwrick, S., Patterson, M., Speer, A., Fishbeck, K., and Davies, K. (1987). Molecular analysis of the Duchenne muscular dystrophy region using pulsed field gel electrophoresis. Cell 48: 351-357. Klamut, H. J., Gangopadhyay, S. B., Worton, R. G., and Ray, P. N. (1990). Molecular and functional analysis of the muscle-specific promoter region of the Duchenne muscular dystrophy gene. Mol. Cell. Biol. 10: 193-205. Klamut, H. J., Zubrzycka-Gaarn, E. E., Bulman, D. E., Malhotra, S. B., Bodrug, S. E., Worton, R. G., and Ray, P. N. (1989). Myogenic regulation of dystrophin gene expression. Br. Med. Bull. 45: 681702. Koenig, M., Hoffman, E. P., Bertelson, C. J., Monaco, A. P., Feener, C., and Kunkel, L. M. (1987). Complete cloning of the Duchenne muscular dystrophy (DMD) cDNA and preliminary genomic organization of the DMD gene in normal and affected individuals. Cell 50: 509-517. Koenig, M., Monaco, A. P., and Kunkel, L. M. (1988). The complete sequence of dystrophin predicts a rod-shaped cytoskeletal protein. Cell 53: 219-228. Koenig, M., Beggs, A. H., Moyer, M., Scherpf, S., Heindrich, K., Bettecken, T., Meng, G., Muller, C. R., Lindlof, M., Kaariainen, H., de la Chapelle, A., Kiuru, A., Savontaus, M.-L., Gilgenkrantz, H., Recan, D., Chelly, J., Kaplan, J.-C., Covone, A. E., Archidiacono, N., Romeo, G., Liechti-Gallati, S., Schneider, V., Braga, S., Moser, H., Darras, B. T., Murphy, P., Francke, U., Chen, J. D., Morgan, G., Denton, M., Greenberg, C. R., Wrogemann, K., Blonden, L. A. J., van Paassen, H. M. B., van Ommen, G. J. B., and Kunkel, L. M. (1989). The molecular basis for Duchenne versus Becker muscular dystrophy: Correlation of severity with type of deletion. Am. J. Hum. Genet. 45: 498-506. Love, D. R., Bloomfield, J. F., Kenwrick, S. J., Yates, J. R. W., and

484

COFFEY

Davies, K. E. (1990). Physical mapping distal to the DMD locus. Genomics 8: 106-112. Liidecke, H. J., Senger, G., Claussen, U., and Horsthemke, B. (1989). Cloning defined regions of the human genome by microdissection of banded chromosomes and enzymatic amplification. Nature (London) 338: 348-350. Malhotra, S. B., Hart, K. A., Klamut, H. J., Thomas, N. S. T., Bodrug, S. E., Burghes, A. H. M., Bobrow, M., Harper, P. S., Thomson, M. W., Ray, P. N., and Worton, R. G. (1988). Frame-shift deletions in patients with Duchenne and Becker muscular dystrophy. Science 242: 756-759. Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982). “Molecular Cloning: A Laboratory Manual,” Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. Meitinger, T., Boyd, Y., Anand, R., and Craig, I. W. (1988). Mapping of Xp21 translocation breakpoints in and around the DMD gene by pulsed field gel electrophoresis. Genomics 3: 315-322. Monaco, A. P., Neve, R. L., Colleti-Feener, C., Bertelson, C. J., Kurnit, D. M., and Kunkel, L. M. (1986). Isolation of candidate cDNAs for portions of the Duchenne muscular dystrophy gene. Nature 323: 646-650. Monaco, A. P., Bertelson, C. J., Colletti-Feener, C., and Kunkel, L. M. (1987). Localization and cloning of Xp21 deletion breakpoints involved in muscular dystrophy. Hum. Genet. 75: 221-227. Monaco, A. P., Bertelson, C. J., Liechti-Gallati, S., Moser, H., and Kunkel, L. M. (1988). An explanation for the phenotypic differences between patients bearing partial deletions of the DMD locus. Genomics 2: 90-95. Nelson, D. L., Ledbetter, S. A., Corbo, L., Victoria, M. F., Ramirez-Solis, R., Webster, T. D., Ledbetter, D. H., and Caskey, C. T. (1989). Alu polymerase chain reaction: A method for rapid isolation of human-specific sequences from complex DNA sources. PFOC. Natl. Acad. Sci. USA 86: 6686-6690. Nudel, U., Zuk, D., Einat, P., Zeelon, E., Levy, Z., Neuman, S., and Yaffe, D. (1989). Duchenne muscular dystrophy gene product is not identical in muscle and brain. Nature 337: 76-77. Olson, M., Hood, L., Cantor, C., and Botstein, D. (1989). A common language for physical mapping of the human genome. Science 245: 1434-1435. Ragoussis, J., Monaco, A., Mockridge, I., Kendall, E., Campbell, R. D., and Trowsdale, J. (1991). Cloning of the HLA class II region in yeast artificial chromosomes. Proc. Natl. Acad. Sci. USA 88: 37533757. Riley, J., Butler, R., Ogilvie, D., Finniear, R., Jenner, D., Powell, S., Anand, R., Smith, J. C., and Markham, A. F. (1990). A novel, rapid method for the isolation of terminal sequences from yeast artificial chromosome (YAC) clones. Nucleic Acids Res. 18: 2887-2890. Roberts, R. G., Cole, C. G., Hart, K. A., Bobrow, M., and Bentley, D. R. (1989a). Rapid carrier and prenatal diagnosis of Duchenne and Becker muscular dystrophy. Nucleic Acids Res. 17: 811.

ET

AL.

Roberts, R. G., Montandon, A. J., Bobrow, M., and Bentley, D. R. (198913). Detection of novel genetic markers by mismatch analysis. Nucleic Acids Res. 17: 5961-5971. Roberts, R. G., Bobrow, M., and Bentley, D. R. (1990). A Mae111 polymorphism near the dystrophin gene promoter by restriction of amplified DNA. Nucleic Acids Rex 18: 1315. Roberts, R. G., Barby, T. F. M., Manners, E., Bobrow, M., and Bentley, D. R. (1991). Direct detection of dystrophin gene rearrangements by analysis of dystrophin mRNA in peripheral blood lymphocytes. Am. J. Hum. Genet. 49: 298-310. Saiki, R. K., Gelfand, D. H., Stoffel, S., Sharf, S. J., Higuchi, R., Horn, G. T., Mullis, K. B., and Erlich, H. A. (1988). Primer-directed enzymatic amplification of cDNA with a thermostable DNA polymerase. Science 239: 487-491. Sealey, P. G., Whittaker, P. A., and Southern, E. W. (1985). Removal of repeated sequences from hybridisation probes. Nucleic Acids Res. 13: 1905-1922. Silverman, G. A., Jockel, J. I., Domer, P. H., Mohr, R. M., TaillonMiller, P., and Korsmeyer, S. J. (1991). Yeast artificial chromosome cloning of a two-megabase-size contig within chromosomal band 18q21 establishes physical linkage between BCL2 and plasminogen activator inhibitor type-2. Genomics 9: 219-228. Southern, E. M. (1975). Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98: 503517. Southern, E. M., Anand, R., Brown, W. R. A., and Fletcher, D. S. (1987). A model for the separation of large DNA molecules by crossed field gel electrophoresis. Nucleic Acids Res. 17: 5925-5943. van Ommen, G. J. B., Verkerk, J. M. H., Hofker, M. H., Monaco, A. P., Kunkel, L. M., Ray, P., Worton, R., Wieringa, B., Bakker, E., and Pearson, P. L. (1986). A physical map of 4 million bp around the Duchenne muscular dystrophy gene on the human X-chromosome. Cell 47: 499-504. van Ommen, G. J. B., Bertelson, C., Ginjaar, J. T., den Dunnen, J. T., Bakker, E., Chelly, J., Matton, M., van Essen, A. J., Bartley, J., Kunkel, L. M., and Pearson, P. L. (1987). Long-range genomic map of the Duchenne muscular dystrophy (DMD) gene: Isolation and use of J66 (DXS268), a distal intragenic marker. Genomics 1: 329336. Wapenaar, M. C., Kievits, T., Hart, K. A., Abbs, S., Blonden, L. A. J., den Dunnen, J. T., Grootscholten, P. M., Bakker, E., Verellen-Dumoulin, C., Bobrow, M., van Ommen, G. J. B., and Pearson, P. L. (1988). A deletion hot spot in the Duchenne muscular dystrophy gene. Genomics 2: 101-108. Zubrzycka-Gaarn, E. E., Bulman, D. E., Karpati, G., Burghes, A. H. M., Belfall, B., Klamut, H. J., Talbot, J., Hodges, R. S., Ray, P. N., and Worton, R. G. (1988). The Duchenne muscular dystrophy gene product is localized in sarcolemma of human skeletal muscle. Nature 333: 466-469.