G Model
ARTICLE IN PRESS
VIRUS 96219 1–8
Virus Research xxx (2014) xxx–xxx
Contents lists available at ScienceDirect
Virus Research journal homepage: www.elsevier.com/locate/virusres
Construction and characterization of a recombinant human adenovirus type 3 vector containing two foreign neutralizing epitopes in hexon
1
2
3
4 5 6 7
Q1
Chunyan Xue a,1 , Xingui Tian a,1 , Xiao Li a , Zhichao Zhou a , Xiaobo Su b,∗ , Rong Zhou a,∗∗ a State Key Laboratory of Respiratory Disease, Guangzhou Institute of Respiratory Disease, The First Affiliated Hospital of Guangzhou Medical University, Guangzhou Medical University, Guangzhou 510120 , China b Department of Medical Genetics and Cell Biology, School of Basic Science, Guangzhou Medical University, Guangzhou 510120, China
8
9 22
a r t i c l e
i n f o
a b s t r a c t
10 11 12 13 14 15
Article history: Received 13 December 2013 Received in revised form 25 January 2014 Accepted 31 January 2014 Available online xxx
16
21
Keywords: Ad vector Hypervariable region Epitope display Immune response
23
1. Introduction
17 18 19 20
24 25 26 27 28 29 30
The “antigen capsid-incorporation” strategy has been developed for adenovirus-based vaccines in the context of several diseases. Exogenous antigenic peptides incorporated into the adenovirus capsid structure can induce a robust and boosted antigen-specific immune response. Recently, we sought to generate a multivalent adenovirus type 3 (Ad3) vaccine vector by incorporating multiple epitopes into the major adenovirus capsid protein, hexon. In the present study, a multivalent recombinant Ad3 vaccine (R1R2A3) was constructed by homologous recombination, displaying two neutralizing epitopes from enterovirus type 71 (EV71) in hexon. The recombinant virus was confirmed by PCR, immunoblotting, and enzymelinked immunosorbent assay, and injected into mice to analyze the epitope-specific humoral response. No differences were found between the viruses with two epitopes incorporated into the hypervariable regions (HVR1 and HVR2) of hexon and Ad3EGFP, based on thermostability and growth kinetic tests. Both the epitopes are thought to be exposed on the hexon-modified intact virion surface. The repeated administration of the modified adenovirus R1R2A3 to BALB/c mice boosted the humoral immune response against both epitopes. Immunization with recombinant virus R1R2A3 elicited higher IgG titers and higher neutralization titers against EV71 in vitro than immunization with the modified adenovirus with only one epitope incorporated into HVR1. In this study, the recombinant R1R2A3 virus expressing two exogenous neutralizing epitopes in hexon HVR1 and HVR2 induced specific immune responses to both foreign epitopes. Our study contributes to a better understanding of hexon-modified Ad vector as a multiple-epitope delivery vehicle. © 2014 Published by Elsevier B.V.
Adenoviral vectors have been widely used for vaccination against cancer and infectious diseases. However, traditional adenoviral vaccines, designed to express antigens that are encoded as transgenes, have yielded suboptimal clinical results, attributed in part to the preexisting immunity of the recipient to adenovirus type 5 (Ad5), arising from natural adenoviral infection or previously administered Ad5 vectors (Nabs; Schagen et al., 2004; Zaiss
∗ Corresponding author. Tel.: +862034281614; fax: +8620 34281614. ∗ ∗ Corresponding author at: State Key Laboratory of Respiratory Disease, The First Affiliated Hospital of Guangzhou Medical University, 151 Yan Jiang Road, Guangzhou 510120, China. Tel.: +862034281614; fax: +8620 34281614. E-mail addresses: [email protected] (C. Xue), [email protected] (X. Tian), [email protected] (X. Li), [email protected] (Z. Zhou), [email protected] (X. Su), [email protected] (R. Zhou). 1 These authors contributed equally to this work.
et al., 2009; Pandey et al., 2012). For this reason, the “antigen capsid-incorporation” strategy has been developed for adenovirusbased vaccines in the context of many diseases, and involves the incorporation of antigenic peptides within the capsid structure of adenovirus. Incorporating exogenous immunogenic peptides into the adenovirus capsid offers potential advantages, including a potent humoral response similar to the response generated by native adenoviral capsid proteins, and immune responses that can be boosted against antigenic epitopes with repeated administration (Matthews, 2010; Shiratsuchi et al., 2010; Roberts et al., 2006). The adenoviral capsid is composed of three major proteins: hexon, fiber, and penton base. Hexon is the largest and most abundant capsid protein, with 720 copies per virion. Analysis of the protein sequences of different hexon proteins has revealed that there are seven discrete hypervariable regions (HVRs), which form the most exposed surface of the virion and are found to be the major targets of serotype-specific neutralizing antibodies (Crawford-Miksza and Schnurr, 1996; Gall et al., 1998; Rux et al.,
0168-1702/$ – see front matter © 2014 Published by Elsevier B.V. http://dx.doi.org/10.1016/j.virusres.2014.01.027
Please cite this article in press as: Xue, C., et al., Construction and characterization of a recombinant human adenovirus type 3 vector containing two foreign neutralizing epitopes in hexon. Virus Res. (2014), http://dx.doi.org/10.1016/j.virusres.2014.01.027
31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48
G Model VIRUS 96219 1–8
ARTICLE IN PRESS C. Xue et al. / Virus Research xxx (2014) xxx–xxx
2
2003). The major capsid protein, hexon, has been used for antigen capsid-incorporation strategies because hexon plays a natural 51 role in the generation of the anti-adenovirus immune response, 52Q2 and it is numerously represented within the adenoviral virion 53 (Shiratsuchi et al., 2010; Krause and McConnell, 2006). Previous 54 studies have verified that short heterologous peptides derived from 55 poliovirus, Pseudomonas aeruginosa, Bacillus anthracis, and HIV, as 56 well as model epitopes, can be incorporated into the adenoviral 57 hexon HVRs without compromising viral viability (Worgall et al., 58 2007; Matthews et al., 2010; Crompton et al., 1994). For exam59 ple, the replacement of HVR1 with a malarial B-cell epitope has 60 been shown to induce a substantially increased level of protective 61 humoral immunity against malaria and circumvents any preexis62 ting immunity to adenovirus (Shiratsuchi et al., 2010). 63 The immune response against an epitope inserted into hexon is 64 dependent on the incorporation site and the size of the incorpo65 rated epitope (McConnell et al., 2006; Wu et al., 2005). Published 66 studies have focused on the incorporation of single epitopes or 67 antigens into single HVRs. Recently, we sought to generate a 68 multivalent vaccine Ad3 vector by incorporating epitopes in Ad3 69 hexon. However, our previous study showed that the antiserum 70 was induced against the new epitope but not against the multiple 71 epitopes that were simultaneously incorporated into single HVRs 72 (Zhong et al., 2012). Therefore, the replacement of several HVRs 73 with antigens might be a promising alternative way to generate 74 multivalent adenoviral vectors. Our previous study confirmed that 75 HVR1 and HVR2 of Ad3 are potential incorporation sites for vac76 cine development (Tian et al., 2012). The present study focuses on 77 the creation of multivalent vaccine vectors displaying two different 78 epitopes in several HVRs of Ad3. 49
2.2. Recombinant hexon-modified plasmid construction
98
50
79
2. Materials and methods
80
2.1. Cells, virus strains, and plasmids
81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97
Sublines of HEp-2 cells, AD293 cells, and Vero cells were kept in our laboratory and cultured in Dulbecco’s modified Eagle’s medium (DMEM; Gibco, Grand Island, USA) supplemented with penicillin (100 IU/ml), streptomycin (100 g/ml), and 10% fetal calf serum (Tian et al., 2012). The following plasmids and viruses used in this study were obtained as previously described or are maintained in our laboratory (Tian et al., 2012; Zhang et al., 2009): the E3-defective adenovirus type 3 replication-competent plasmid pBRAdV3dE3egfp (pAd3egf), which expresses the reporter molecule enhanced green fluorescent protein (EGFP) and the corresponding virus Ad3EGFP; hexon shuttle vector pBRHexonL/R; the plasmid pAd3egf-SP70 with the SP70 epitope in hexon HVR1 and the corresponding virus R1SP70A3 (R1A3); and the EV71-08-02 strain of the EV71 C4 genotype (GenBank accession no. FJ360545). The EV71 viral titer was determined as the TCID50 in Vero cells, based on the typical cytopathic effect (CPE) produced by viral infection.
To generate constructs containing SP70 epitope in HVR1 and SP55 epitope in HVR2, HVR4, or HVR5, the SP55 and SP70 epitopes were genetically incorporated into the HVRs at the positions marked in Fig. 1. To achieve these genetic modifications, we first generated the hexon fragments containing the sequences encoding the SP70 and SP55 genes in different HVRs using an overlapping PCR method, as described previously by Tian et al. in 2012 (Tian et al., 2012). The corresponding primers are shown in Table 1. The hexon fragments containing the SP70 and SP55 genes were purified and cloned into the Ad3 hexon shuttle vector pBRHexonL/R with ClaI and BamHI restriction enzymes. To create recombinant Ad3 vectors containing the SP70 and SP55 sequences in the HVRs of hexon, the three shuttle vectors were digested with EcoRI and SalI, and then used to cotransform Escherichia coli BJ5183 cells with the AvrII- and PacI-linearized human adenovirus type 3 (HAdV3) plasmid pBRAdV3dE3egfp (pAd3egf). The resultant clones, which contained both SP70 and SP55, were obtained by homologous recombination, and the constructs were then selected with PCR using primers HexonF/sp55r or HexonF/sp70r (shown in Table 1) and confirmed by restriction digestion and sequence analysis. 2.3. Generation of recombinant virus To rescue the recombinant virus, these modified plasmids were linearized with AsiSI. AD293 cells were transfected with 4 g of each purified DNA using the NanoJuice Transfection Kit (Novagen, USA) and grown in dishes of 30 mm diameter. After the plaques formed, the viruses were processed for large-scale propagation in AD293 cells and then purified with CsCl gradient centrifugation (Wu et al., 2002). The purified viral DNA was confirmed with PCR and sequence analysis. The viral particle (VP) titers were determined with spectrophotometry using a conversion factor of 1.1 × 1012 VPs per absorbance unit at 260 nm. 2.4. Thermostability assay and growth characteristics To test the heat stability of the hexon-modified adenovirus, the virus was incubated in DMEM containing 2% FBS at 45 ◦ C for 0, 5, 10, 20, 40, or 60 min before it was used to infect HEp-2 cells. Fluorescence was then measured 48 h after infection with a Varioskan Flash Multimode Reader (Thermo Scientific), with excitation at 488 nm and recording the light emitted at 570 nm. Background fluorescence was normalized to wells containing cells only. Growth curves were generated by infecting HEp-2 cells with adenovirus at five VPs/cell and the infected cells were collected every 12 h for 72 h. The harvested cells were suspended in DMEM containing 2% FBS, subjected to three freeze–thaw cycles, and centrifuged at 10,000 × g for 30 min at 4 ◦ C to remove the cell debris. The viral suspension was then diluted with DMEM containing 2% FBS in a 10-fold dilution series and each dilution was used to infect HEp-2 cells cultured in 24-well plates. The number of infectious
Fig. 1. Diagram of the SP55 and SP70 epitope incorporation sites in Ad3 hexon. (A) Amino acid residues of the SP70 and SP55 epitopes that were incorporated into the HVRs of Ad3 hexon. (B) R1R2A3, R1R4A3, or R1R5A3 corresponding to the hypervariable region (HVR) sites that were modified with the SP55 and SP70 epitopes. The underlined amino acid residues marked in HVR1 were replaced with the SP70 epitope, and the ones in the rectangles in regions 2, 4, and 5 were replaced with the SP55 epitope. The numbers show the positions of the amino acid residues in Ad3 hexon.
Please cite this article in press as: Xue, C., et al., Construction and characterization of a recombinant human adenovirus type 3 vector containing two foreign neutralizing epitopes in hexon. Virus Res. (2014), http://dx.doi.org/10.1016/j.virusres.2014.01.027
99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118
119
120 121 122 123 124 125 126 127 128 129
130
131 132 133 134 135 136 137 138 139 140 141 142 143 144 145
G Model VIRUS 96219 1–8
ARTICLE IN PRESS C. Xue et al. / Virus Research xxx (2014) xxx–xxx
3
Table 1 Primers used to incorporate the SP55 epitope into the HVRs of the Ad3 hexon and for PCR identification. Primer
Sequencea
HexonF HexonR A3-h2-sp55U
5 -AGGCTGAGTTGCTTTCAAGATGGCCACC-3 5 -CATGGGATCCACCTCAAAGTCATGTCCAGC-3 5 -GACATTACCCCAGATTCCAGGGAATCCCTTGCATGGCAAACTGCCACCAACCCC AAGCCCATTTATGCCGATAAAAC-3 5 -AATGGGCTTGGGGTTGGTGGCAGTTTGCCATGCAAGGGATTCCCTGGAATCTGG GGTAATGTCTTTCCCAATTTGCA-3 5 -AACCAACACCAGATTCCAGGGAATCCCTTGCATGGCAAACTGCCACCAACCCC GAAGGAGGGGTTGAAACTGAGG-3 5 -CCTCCTTCGGGGTTGGTGGCAGTTTGCCATGCAAGGGATTCCCTGGAATCTGG TGTTGGTTTTACTTTTCTGTTTT-3 5 -GGGATGCTCCAGATTCCAGGGAATCCCTTGCATGGCAAACTGCCACCAACCCC GCAGGAGCTTTAGCGCCTGAAAT-3 5 -CTCCTGCGGGGTTGGTGGCAGTTTGCCATGCAAGGGATTCCCTGGAATCTGG AGCATCCCTACCATCGAAAAATTC-3 5 -GGTGGCAGTTTGCCATGCAAGG-3 5 -GATCTTTCTCCTGTTTGTGTTCTCC-3
A3-h2-sp55R A3-h4-sp55U A3-h4-sp55R A3-h5-sp55U A3-h5-sp55R sp55r sp70r a
146 147 148
149
The underlined letters represent the sequences encoding the SP55 epitope.
particles at each time point was determined by the measurement of fluorescence counting 48 h after infection, as described by Zhong et al. in 2012 (Zhong et al., 2012). 2.5. Production of recombinant SP55 and SP70 fusion peptides
156
A pGEX-4T-3 vector was used to produce the SP55 peptide and SP70 peptide with an N-terminal glutathione S-transferase (GST) tag (SP70–GST and SP55–GST, respectively). The GST fusion peptides were purified by affinity chromatography using GST-Bind Resin (Novagen) under native conditions and stored as aliquots at −80 ◦ C to avoid repetitive freeze–thaw cycles. The recombinant VP1 protein was prepared previously (Wang et al., 2013).
157
2.6. Mouse immunization
150 151 152 153 154 155
158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173
174
175 176 177 178 179 180 181 182 183 184
Groups of 4–6-week-old female BALB/c mice were used for immunization. Groups of five mice were analyzed in each experiment or at each time point. The mice were vaccinated by intraperitoneal injection with 1 × 1010 VPs of recombinant viruses R1A3, R1R2A3, Ad3EGFP, heat-inactivated EV71 strain (10 g of total protein), 50 g of SP70–GST, 50 g of SP55–GST, or 50 g of GST protein with complete adjuvant. Three boosters were given at 2, 4, and 6 weeks, with the same dose of the same vectors or peptide, by intraperitoneal injection. Blood was collected from the tail vein before each immunization. The sera were separated from the blood cells and kept for serum analysis. The blood was collected via a retroorbital eye bleed 10 days after the final injection. The sera were separated from the blood cells and stored at −80 ◦ C for analysis of the anti-VP1 antibody response and the in vitro neutralization of EV71. All animal procedures were approved by the First Affiliated Hospital of Guangzhou Medical University Ethics Committee. 2.7. In vitro neutralization To determine whether anti-SP70–GST and anti-SP55–GST antibodies neutralized the hexon-modified recombinant virus R1R2A3 and whether the hexon-modified recombinants could escape neutralization by anti-Ad3EGFP, the serum samples were heatinactivated for 45 min at 56 ◦ C and then diluted 2-fold in DMEM in 96-well plates. A viral suspension with a titer of 100 TCID50 in 50 l was added to each serum sample and incubated at 37 ◦ C for 1 h. AD293 cells were then added to each well and incubated for 3–5 days. Serum, virus, and cell controls were included in this test. The plates were monitored for CPEs with light microscopy.
2.8. Immunoblotting analysis An immunoblotting analysis was performed to detect the recombinant adenovirus R1R2A3. Purified EV71 virions, Ad3EGFP, and recombinant adenovirus R1R2A3 cultures were fractionated on a 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) gel, and blotted onto polyvinylidene difluoride (PVDF) membrane. The membrane was exposed to blocking solution (5% fat-free milk) in phosphate-buffered saline containing 0.05% Tween 20 (PBST) at room temperature for 1 h. It was then incubated with a 1:250 dilution of anti-SP55–GST or anti-SP70–GST antibody for 1 h, followed by a horseradish peroxidase (HRP)-labeled goat antimouse IgG secondary antibody diluted 1:10,000 (Bio-Rad). The signals were detected with a chemiluminescent peroxidase substrate (ECL Plus, Millipore). To analyze whether the mice that received R1R2A3 produced antibodies directed against SP70 or SP55, 8-week sera from R1R2A3-immunized mice were used for an immunoblotting analysis. EV71-infected cell lysate, SP70–GST, and SP55–GST were separated on a 10% SDS-PAGE gel and transferred to PVDF membrane. Anti-R1R2A3 serum was diluted 1:500 and used as the primary antibody, and serum from Ad3EGFP-immunized mice was used as the control. The signal was amplified with a 1:9000 dilution of secondary antibody. The signal was detected as described above using ECL Plus. 2.9. Indirect ELISA analysis An enzyme-linked immunosorbent assay (ELISA) was used to determine whether the SP70 or SP55 epitope was presented on the surface of the recombinant virion. Carbonate buffer (pH 9.6) containing 109 VP/100 l of recombinant adenovirus R1R2A3 was immobilized in a 96-well plate overnight at 4 ◦ C. The plate was then blocked with 2% bovine serum albumin (BSA) in PBST at 37 ◦ C for 2 h. Serially diluted anti-SP55GST antibody, anti-SP70GST antibody, or anti-GST antibody was then added to each well and the plates incubated for 1.5 h at 37 ◦ C. The wells were washed three times and incubated with a 1:8000 dilution of HRP-conjugated goat anti-mouse IgG secondary antibody for 1 h. After the plates was washed four times, the reactions were developed with tetramethylbenzidine (TMB) substrate, stopped with 2 M sulfuric acid, and the absorbance (optical density) at 450 nm (OD450 ) measured with a microplate reader (Thermo Scientific Multiskan MK3). To test the anti-SP70 and anti-SP55 antibody responses in immunized mice, ELISA plates were coated with 50 mM carbonate buffer (pH 9.6) containing 1 g/ml SP70–GST or SP55–GST protein overnight at 4 ◦ C. The wells were washed twice with PBST and
Please cite this article in press as: Xue, C., et al., Construction and characterization of a recombinant human adenovirus type 3 vector containing two foreign neutralizing epitopes in hexon. Virus Res. (2014), http://dx.doi.org/10.1016/j.virusres.2014.01.027
185
186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208
209
210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228
G Model VIRUS 96219 1–8
ARTICLE IN PRESS C. Xue et al. / Virus Research xxx (2014) xxx–xxx
4
250
blocked with 2% BSA/PBST at 37 ◦ C for 2 h. After three washes with PBST, serially diluted R1R2A3 sera that had been collected at different time points were added to each well and incubated at 37 ◦ C for 1.5 h. The plates were washed four times with PBST and incubated for 1 h at 37 ◦ C with a 1:9000 dilution of HRP-conjugated goat anti-mouse IgG secondary antibody. The signals were developed with TMB substrate. The OD450 was read on a microplate reader. The endpoint titer was defined as the highest dilution at which the OD450 was at least 0.1 higher than that of wells that received no serum. Serum derived from uninfected mice was used as the negative control. To determine the anti-VP1 humoral responses, ELISA plates were coated with 0.1 g of recombinant VP1 protein in 100 l of 50 mM carbonate buffer (pH 9.6) per well. After the wells were blocked with 2% BSA/PBST, they were washed three times and incubated with 8-week immunized sera from R1A3-, R1R2A3, SP55–GST-, SP70–GST-, Ad3EGFP-, or GST-injected mice at 37 ◦ C for 1.5 h, followed by incubation with HRP-conjugated goat anti-mouse IgG antibody. ELISAs were then performed as described above. Each assay was performed independently at least three times and with at least two parallel reactions for each well.
251
2.10. Neutralization of EV71 in vitro
229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249
266
The titers of NAbs against EV71 were measured in a microneutralization test in vitro. The antisera from different antigen-injected mice were collected 10 days after the fourth injection, according to the immunization schedule. The final immunized serum samples were inactivated at 56 ± 0.5 ◦ C for 30 min, and 50 l of each serially diluted sample was mixed with an equal volume of 100 TCID50 of the EV71-08-02 strain and incubated at 37 ◦ C for 1 h. The mixtures were then adsorbed onto a 96-well microtiter plate containing Vero cells (1 × 105 cell/ml) seeded the previous day. Each assay set included a cell control, a virus control, and antiserum from heat-inactivated EV71 virus, which was used as a positive control. The plates were placed in a CO2 incubator at 37 ◦ C for 5 days, after which the CPEs were observed with microscopy. The NAb titer was defined as the highest dilution of serum capable of inhibiting viral growth.
267
2.11. Statistical analysis
252 253 254 255 256 257 258 259 260 261 262 263 264 265
271
The data are presented as means ±standard errors. Comparisons among groups were made with analysis of variance and Bonferroni’s test to account for multiple comparisons. Statistical significance was defined as p < 0.05.
272
3. Results
268 269 270
273 274
275 276 277 278 279 280 281 282 283 284 285 286
Fig. 2. PCR amplification of the SP55 and SP70 epitope insertions from recombinant adenovirus plasmids. PCR products were analyzed by 0.8% agarose gel electrophoresis. M: marker DL5,000 (Takara); lanes 1, 3, and 5 are pR1R2A3, pR1R4A3, and pR1R5A3, respectively, amplified with primers HexonF/sp55r. Lanes 2, 4, and 6 are pR1R2A3, pR1R4A3, and pR1R5A3, respectively, amplified with primers HexonF/sp70r. Lanes 7 and 8 are the negative control pAd3egf, amplified with primers HexonF/sp55r and HexonF/sp70r, respectively.
To determine whether R1R2A3 expressed the SP55 and SP70 epitopes in the hexon region, purified EV71 and recombinant adenovirus R1R2A3 or Ad3EGFP were subjected to immunoblotting analysis with anti-SP55–GST and anti-SP70–GST antibodies. The detection of a hexon fusion protein band of the expected size (about 110 kDa) suggested that the SP70 and SP55 epitopes were successfully incorporated into the hexon capsid protein (Fig. 3B, lane 2, lane 5). A band was visible for EV71 consistent with the expected size (33 kDa) of the EV71 VP1 peptide (Fig. 3B, lane 1, lane 6), and no band was found in the Ad3EGFP control (Fig. 3B, lane 3 and lane 4). Because hexon is the most abundant protein in the adenovirus capsid, changing its structural components may lead to virion instability compared with that of its wild-type counterpart. To test whether the incorporation of exogenous peptides SP55 and
3.1. Generation of hexon-modified Ad3 containing both SP55 and SP70 The recombinant plasmids pR1R2A3, pR1R4A3, and pR1R5A3 encoding the 15 amino acids each of SP55 and SP70 were obtained by homologous recombination in E. coli and identified by PCR (Fig. 2), and confirmed by restriction enzyme digestion and full-length hexon sequencing analysis (data not shown). In cells transfected with pR1R4A3 or pR1R5A3, no evidence of viral growth was seen, even 2 weeks after infection, and repeated attempts to package the virus failed. However, in cells transfected with pR1R2A3, the fluorescent signal from individual cells was detectable 7 days after transfection, indicating that the R1R2A3 virus had been rescued. After amplification on AD293 cells, the rescued R1R2A3 virus was confirmed by PCR (Fig. 3A) and sequencing.
Fig. 3. SP70 and SP55 epitopes incorporated into hexon HVR1 and HVR2. (A) Rescued virus was amplified and viral DNA was used to confirm that SP70 and SP55 were correctly incorporated into hexon hypervariable region (HVR) 1 and HVR2, respectively. M: DNA marker DL15,000 (Takara, China); lanes 1, 2, and 3 are rescued virus R1R2A3, amplified with primers HexonF/HexonR, HexonF/sp55r, and HexonF/sp70r, respectively; lanes 4, 5, and 6 are the negative control Ad3EGFP amplified with the primers HexonF/HexonR, HexonF/sp55r, and HexonF/sp70r, respectively. (B) Immunoblotting analysis of the SP70 and SP55 epitopes in the hexon protein. Purified EV71 virions (lanes 1, 6), the 33-kDa band represents the VP1 protein; recombinant virus R1R2A3 (lanes 2, 5), the 110-kDa band represents the hexon fusion protein; unmodified control Ad3EGFP (lanes 3, 4).
Please cite this article in press as: Xue, C., et al., Construction and characterization of a recombinant human adenovirus type 3 vector containing two foreign neutralizing epitopes in hexon. Virus Res. (2014), http://dx.doi.org/10.1016/j.virusres.2014.01.027
287 288 289 290 291 292 293 294 295 296 297 298 299 300 301
G Model VIRUS 96219 1–8
ARTICLE IN PRESS C. Xue et al. / Virus Research xxx (2014) xxx–xxx
Fig. 4. Thermostability and growth kinetics of R1R2A3 expressing two epitopes in hexon. (A) Thermostability assay of R1R2A3. Hexon-modified R1R2A3 and unmodified Ad3EGFP were incubated at 45 ◦ C for 0, 5, 10, 20, 40, or 60 min before they were used to infect HEp-2 cells. Fluorescence was measured with a Varioskan Flash Multimode Reader (Thermo Scientific). Relative infectivity is expressed as a percentage of the fluorescence of infectious particles remaining in each sample with that in the sample without incubating at 45 ◦ C. (B) Growth curve of recombinant R1R2A3. The cells were infected with R1R2A3 or Ad3EGFP at 5 VPs/cell and harvested every 12 h for 72 h. The number of infectious particles (i.p.) was determined with the fluorescent counting method. i.p./ml = n × fold dilution.
302 303 304 305 306 307 308 309 310 311
312 313
314 315 316 317 318
SP70 into the capsid hexon molecules affected viral thermostability, R1R2A3 and Ad3EGFP were incubated at 45 ◦ C for different time intervals before they were used to infect HEp-2 cells. The growth characteristics of R1R2A3 and Ad3EGFP were also compared to evaluate whether the insertion of the peptides had any effect on virus assembly. Hexon-modified R1R2A3 showed similar stability to that of unmodified Ad3EGFP (Fig. 4A), and there was no difference in the viral yields of R1R2A3 and Ad3EGFP (Fig. 4B). These data suggest that the incorporation of heterologous peptides within the hexon HVRs does not affect virion stability or growth kinetics.
5
Fig. 5. ELISA analysis of SP55 and SP70 epitopes exposed on recombinant R1R2A3 virion surfaces. Recombinant R1R2A3 or control Ad3EGFP, at final concentrations of 109 VP/ml, were immobilized on ELISA plates and incubated with 4-fold serial dilutions of (A) anti-SP55–GST antiserum, (B) anti-SP70–GST antiserum, or (C) control anti-GST antiserum. Binding was detected with an HRP-conjugated goat anti-mouse IgG secondary antibody. These results suggest that the SP55 and SP70 epitopes incorporated into hexon were accessible to anti-SP55–GST and anti-SP70–GST antibodies at the virion level, indicating that the epitopes were exposed on the virion surface.
anti-SP55–GST and anti-SP70–GST antibodies, whereas the control Ad3EGFP containing the wild-type hexon was not recognized by any of these antibodies (Fig. 5A and B). This indicates that the SP55 and SP70 epitopes were exposed on the surfaces of the viral particles when incorporated within the hexon HVRs.
3.2. Presentation of both SP70 and SP55 epitopes on the virion surface
3.3. Incorporation of SP55 and SP70 within HVRs partly circumvents the neutralization of Ad3EGFP antiserum
To analyze the presentation of these two epitopes on the surface of the virion, purified virions or Ad3EGFP was immobilized on ELISA plates and incubated with anti-SP55–GST antibody (Fig. 5A), anti-SP70–GST antibody (Fig. 5B), and control anti-GST antibody (Fig. 5C). R1R2A3 was recognized by the corresponding
The SP55–GST and SP70–GST-peptide-immunized sera showed the same neutralizing antibody titers against recombinant R1R2A3 (Table 2). The neutralization titer of anti-Ad3EGFP serum against hexon-modified R1R2A3 was significantly lower than that against Ad3EGFP, which indicates that the replacement of HVR1 and HVR2
Please cite this article in press as: Xue, C., et al., Construction and characterization of a recombinant human adenovirus type 3 vector containing two foreign neutralizing epitopes in hexon. Virus Res. (2014), http://dx.doi.org/10.1016/j.virusres.2014.01.027
319 320 321 322 323
324 325
326 327 328 329 330
G Model
ARTICLE IN PRESS
VIRUS 96219 1–8
C. Xue et al. / Virus Research xxx (2014) xxx–xxx
6
Fig. 6. SP55 and SP70 epitopes incorporated within HVRs elicit IgG immune responses. (A) An immunization time line showing when the immunizations were performed; arrows show each injection time. Primary and postimmunization sera were collected before each immunization for the analysis of the antibody response in vaccinated mice. (B) EV71-infected cell lysate (lane 1), SP55–GST fusion protein (lane 2), SP70–GST fusion protein (lane 3), and GST (lane 4) were fractioned on an SDS-PAGE gel and then transferred to PVDF membrane. The membrane was immunoblotted with antiserum from R1R2A3-injected mice. An HRP-linked antibody was used to detect the mouse antibodies and the signal was amplified with ECL reagent. (C) 1 g/ml SP55–GST and SP70–GST were bound to ELISA plates and incubated with R1R2A3-immunized sera collected before the first injection (0 w) and at 2, 4, 6, and 8 weeks. Binding was detected with IgG-specific HRP-conjugated goat anti-mouse IgG secondary antibody. (D) Anti-VP1 IgG levels in sera collected at 8 weeks were quantified with an indirect ELISA. The OD450 reflects the levels of serum antibodies. Data are the means ±SD for each group of mice. Error bars represent the standard error of the means for each group. ∗∗ p < 0.05, when antiserum from R1R2A3 was compared with antiserum from R1A3, SP55–GST, or SP70–GST.
331 332
333 334
335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350
with exogenous epitopes made R1R2A3 partly resistant to antiAd3EGFP serum. 3.4. Both SP55-specific and SP70-specific antibodies were induced in mice after immunization To determine whether immunized mice produced antibodies against the SP55 and SP70 epitopes, mice were immunized with R1A3, R1R2A3, SP70–GST, SP55–GST, Ad3EGFP, or GST. The injections were performed at 0, 2, 4, and 6 weeks and the sera were collected before each injection (Fig. 6A). EV71infected cell lysate, SP55–GST protein, and SP70–GST protein were subjected to immunoblotting analysis with antiserum from R1R2A3-immunized mice, and anti-Ad3EGFP serum was used as the control. Serum from mice vaccinated with R1R2A3 recognized the EV71 antigen in the lysate showing a protein band of approximately 33 kDa, consistent with the EV71 VP1 protein, and reacted with the SP55–GST and SP70-GST proteins (Fig. 6B). No protein band was detected with antiserum from mice immunized with the control Ad3EGFP (data not shown). These results indicate that a humoral immune response had been elicited against these two epitopes inserted into hexon. Table 2 In vitro neutralization (mean ±SD, n = 5). Antiserum
Virus neutralization titer
Anti-SP55-GST Anti-SP70-GST Anti-GST Anti-Ad3EGFP
R1R2A3 800 ± 240 800 ± 240
ARTICLE IN PRESS
VIRUS 96219 1–8
Virus Research xxx (2014) xxx–xxx
Contents lists available at ScienceDirect
Virus Research journal homepage: www.elsevier.com/locate/virusres
Construction and characterization of a recombinant human adenovirus type 3 vector containing two foreign neutralizing epitopes in hexon
1
2
3
4 5 6 7
Q1
Chunyan Xue a,1 , Xingui Tian a,1 , Xiao Li a , Zhichao Zhou a , Xiaobo Su b,∗ , Rong Zhou a,∗∗ a State Key Laboratory of Respiratory Disease, Guangzhou Institute of Respiratory Disease, The First Affiliated Hospital of Guangzhou Medical University, Guangzhou Medical University, Guangzhou 510120 , China b Department of Medical Genetics and Cell Biology, School of Basic Science, Guangzhou Medical University, Guangzhou 510120, China
8
9 22
a r t i c l e
i n f o
a b s t r a c t
10 11 12 13 14 15
Article history: Received 13 December 2013 Received in revised form 25 January 2014 Accepted 31 January 2014 Available online xxx
16
21
Keywords: Ad vector Hypervariable region Epitope display Immune response
23
1. Introduction
17 18 19 20
24 25 26 27 28 29 30
The “antigen capsid-incorporation” strategy has been developed for adenovirus-based vaccines in the context of several diseases. Exogenous antigenic peptides incorporated into the adenovirus capsid structure can induce a robust and boosted antigen-specific immune response. Recently, we sought to generate a multivalent adenovirus type 3 (Ad3) vaccine vector by incorporating multiple epitopes into the major adenovirus capsid protein, hexon. In the present study, a multivalent recombinant Ad3 vaccine (R1R2A3) was constructed by homologous recombination, displaying two neutralizing epitopes from enterovirus type 71 (EV71) in hexon. The recombinant virus was confirmed by PCR, immunoblotting, and enzymelinked immunosorbent assay, and injected into mice to analyze the epitope-specific humoral response. No differences were found between the viruses with two epitopes incorporated into the hypervariable regions (HVR1 and HVR2) of hexon and Ad3EGFP, based on thermostability and growth kinetic tests. Both the epitopes are thought to be exposed on the hexon-modified intact virion surface. The repeated administration of the modified adenovirus R1R2A3 to BALB/c mice boosted the humoral immune response against both epitopes. Immunization with recombinant virus R1R2A3 elicited higher IgG titers and higher neutralization titers against EV71 in vitro than immunization with the modified adenovirus with only one epitope incorporated into HVR1. In this study, the recombinant R1R2A3 virus expressing two exogenous neutralizing epitopes in hexon HVR1 and HVR2 induced specific immune responses to both foreign epitopes. Our study contributes to a better understanding of hexon-modified Ad vector as a multiple-epitope delivery vehicle. © 2014 Published by Elsevier B.V.
Adenoviral vectors have been widely used for vaccination against cancer and infectious diseases. However, traditional adenoviral vaccines, designed to express antigens that are encoded as transgenes, have yielded suboptimal clinical results, attributed in part to the preexisting immunity of the recipient to adenovirus type 5 (Ad5), arising from natural adenoviral infection or previously administered Ad5 vectors (Nabs; Schagen et al., 2004; Zaiss
∗ Corresponding author. Tel.: +862034281614; fax: +8620 34281614. ∗ ∗ Corresponding author at: State Key Laboratory of Respiratory Disease, The First Affiliated Hospital of Guangzhou Medical University, 151 Yan Jiang Road, Guangzhou 510120, China. Tel.: +862034281614; fax: +8620 34281614. E-mail addresses: [email protected] (C. Xue), [email protected] (X. Tian), [email protected] (X. Li), [email protected] (Z. Zhou), [email protected] (X. Su), [email protected] (R. Zhou). 1 These authors contributed equally to this work.
et al., 2009; Pandey et al., 2012). For this reason, the “antigen capsid-incorporation” strategy has been developed for adenovirusbased vaccines in the context of many diseases, and involves the incorporation of antigenic peptides within the capsid structure of adenovirus. Incorporating exogenous immunogenic peptides into the adenovirus capsid offers potential advantages, including a potent humoral response similar to the response generated by native adenoviral capsid proteins, and immune responses that can be boosted against antigenic epitopes with repeated administration (Matthews, 2010; Shiratsuchi et al., 2010; Roberts et al., 2006). The adenoviral capsid is composed of three major proteins: hexon, fiber, and penton base. Hexon is the largest and most abundant capsid protein, with 720 copies per virion. Analysis of the protein sequences of different hexon proteins has revealed that there are seven discrete hypervariable regions (HVRs), which form the most exposed surface of the virion and are found to be the major targets of serotype-specific neutralizing antibodies (Crawford-Miksza and Schnurr, 1996; Gall et al., 1998; Rux et al.,
0168-1702/$ – see front matter © 2014 Published by Elsevier B.V. http://dx.doi.org/10.1016/j.virusres.2014.01.027
Please cite this article in press as: Xue, C., et al., Construction and characterization of a recombinant human adenovirus type 3 vector containing two foreign neutralizing epitopes in hexon. Virus Res. (2014), http://dx.doi.org/10.1016/j.virusres.2014.01.027
31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48
G Model VIRUS 96219 1–8
ARTICLE IN PRESS C. Xue et al. / Virus Research xxx (2014) xxx–xxx
2
2003). The major capsid protein, hexon, has been used for antigen capsid-incorporation strategies because hexon plays a natural 51 role in the generation of the anti-adenovirus immune response, 52Q2 and it is numerously represented within the adenoviral virion 53 (Shiratsuchi et al., 2010; Krause and McConnell, 2006). Previous 54 studies have verified that short heterologous peptides derived from 55 poliovirus, Pseudomonas aeruginosa, Bacillus anthracis, and HIV, as 56 well as model epitopes, can be incorporated into the adenoviral 57 hexon HVRs without compromising viral viability (Worgall et al., 58 2007; Matthews et al., 2010; Crompton et al., 1994). For exam59 ple, the replacement of HVR1 with a malarial B-cell epitope has 60 been shown to induce a substantially increased level of protective 61 humoral immunity against malaria and circumvents any preexis62 ting immunity to adenovirus (Shiratsuchi et al., 2010). 63 The immune response against an epitope inserted into hexon is 64 dependent on the incorporation site and the size of the incorpo65 rated epitope (McConnell et al., 2006; Wu et al., 2005). Published 66 studies have focused on the incorporation of single epitopes or 67 antigens into single HVRs. Recently, we sought to generate a 68 multivalent vaccine Ad3 vector by incorporating epitopes in Ad3 69 hexon. However, our previous study showed that the antiserum 70 was induced against the new epitope but not against the multiple 71 epitopes that were simultaneously incorporated into single HVRs 72 (Zhong et al., 2012). Therefore, the replacement of several HVRs 73 with antigens might be a promising alternative way to generate 74 multivalent adenoviral vectors. Our previous study confirmed that 75 HVR1 and HVR2 of Ad3 are potential incorporation sites for vac76 cine development (Tian et al., 2012). The present study focuses on 77 the creation of multivalent vaccine vectors displaying two different 78 epitopes in several HVRs of Ad3. 49
2.2. Recombinant hexon-modified plasmid construction
98
50
79
2. Materials and methods
80
2.1. Cells, virus strains, and plasmids
81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97
Sublines of HEp-2 cells, AD293 cells, and Vero cells were kept in our laboratory and cultured in Dulbecco’s modified Eagle’s medium (DMEM; Gibco, Grand Island, USA) supplemented with penicillin (100 IU/ml), streptomycin (100 g/ml), and 10% fetal calf serum (Tian et al., 2012). The following plasmids and viruses used in this study were obtained as previously described or are maintained in our laboratory (Tian et al., 2012; Zhang et al., 2009): the E3-defective adenovirus type 3 replication-competent plasmid pBRAdV3dE3egfp (pAd3egf), which expresses the reporter molecule enhanced green fluorescent protein (EGFP) and the corresponding virus Ad3EGFP; hexon shuttle vector pBRHexonL/R; the plasmid pAd3egf-SP70 with the SP70 epitope in hexon HVR1 and the corresponding virus R1SP70A3 (R1A3); and the EV71-08-02 strain of the EV71 C4 genotype (GenBank accession no. FJ360545). The EV71 viral titer was determined as the TCID50 in Vero cells, based on the typical cytopathic effect (CPE) produced by viral infection.
To generate constructs containing SP70 epitope in HVR1 and SP55 epitope in HVR2, HVR4, or HVR5, the SP55 and SP70 epitopes were genetically incorporated into the HVRs at the positions marked in Fig. 1. To achieve these genetic modifications, we first generated the hexon fragments containing the sequences encoding the SP70 and SP55 genes in different HVRs using an overlapping PCR method, as described previously by Tian et al. in 2012 (Tian et al., 2012). The corresponding primers are shown in Table 1. The hexon fragments containing the SP70 and SP55 genes were purified and cloned into the Ad3 hexon shuttle vector pBRHexonL/R with ClaI and BamHI restriction enzymes. To create recombinant Ad3 vectors containing the SP70 and SP55 sequences in the HVRs of hexon, the three shuttle vectors were digested with EcoRI and SalI, and then used to cotransform Escherichia coli BJ5183 cells with the AvrII- and PacI-linearized human adenovirus type 3 (HAdV3) plasmid pBRAdV3dE3egfp (pAd3egf). The resultant clones, which contained both SP70 and SP55, were obtained by homologous recombination, and the constructs were then selected with PCR using primers HexonF/sp55r or HexonF/sp70r (shown in Table 1) and confirmed by restriction digestion and sequence analysis. 2.3. Generation of recombinant virus To rescue the recombinant virus, these modified plasmids were linearized with AsiSI. AD293 cells were transfected with 4 g of each purified DNA using the NanoJuice Transfection Kit (Novagen, USA) and grown in dishes of 30 mm diameter. After the plaques formed, the viruses were processed for large-scale propagation in AD293 cells and then purified with CsCl gradient centrifugation (Wu et al., 2002). The purified viral DNA was confirmed with PCR and sequence analysis. The viral particle (VP) titers were determined with spectrophotometry using a conversion factor of 1.1 × 1012 VPs per absorbance unit at 260 nm. 2.4. Thermostability assay and growth characteristics To test the heat stability of the hexon-modified adenovirus, the virus was incubated in DMEM containing 2% FBS at 45 ◦ C for 0, 5, 10, 20, 40, or 60 min before it was used to infect HEp-2 cells. Fluorescence was then measured 48 h after infection with a Varioskan Flash Multimode Reader (Thermo Scientific), with excitation at 488 nm and recording the light emitted at 570 nm. Background fluorescence was normalized to wells containing cells only. Growth curves were generated by infecting HEp-2 cells with adenovirus at five VPs/cell and the infected cells were collected every 12 h for 72 h. The harvested cells were suspended in DMEM containing 2% FBS, subjected to three freeze–thaw cycles, and centrifuged at 10,000 × g for 30 min at 4 ◦ C to remove the cell debris. The viral suspension was then diluted with DMEM containing 2% FBS in a 10-fold dilution series and each dilution was used to infect HEp-2 cells cultured in 24-well plates. The number of infectious
Fig. 1. Diagram of the SP55 and SP70 epitope incorporation sites in Ad3 hexon. (A) Amino acid residues of the SP70 and SP55 epitopes that were incorporated into the HVRs of Ad3 hexon. (B) R1R2A3, R1R4A3, or R1R5A3 corresponding to the hypervariable region (HVR) sites that were modified with the SP55 and SP70 epitopes. The underlined amino acid residues marked in HVR1 were replaced with the SP70 epitope, and the ones in the rectangles in regions 2, 4, and 5 were replaced with the SP55 epitope. The numbers show the positions of the amino acid residues in Ad3 hexon.
Please cite this article in press as: Xue, C., et al., Construction and characterization of a recombinant human adenovirus type 3 vector containing two foreign neutralizing epitopes in hexon. Virus Res. (2014), http://dx.doi.org/10.1016/j.virusres.2014.01.027
99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118
119
120 121 122 123 124 125 126 127 128 129
130
131 132 133 134 135 136 137 138 139 140 141 142 143 144 145
G Model VIRUS 96219 1–8
ARTICLE IN PRESS C. Xue et al. / Virus Research xxx (2014) xxx–xxx
3
Table 1 Primers used to incorporate the SP55 epitope into the HVRs of the Ad3 hexon and for PCR identification. Primer
Sequencea
HexonF HexonR A3-h2-sp55U
5 -AGGCTGAGTTGCTTTCAAGATGGCCACC-3 5 -CATGGGATCCACCTCAAAGTCATGTCCAGC-3 5 -GACATTACCCCAGATTCCAGGGAATCCCTTGCATGGCAAACTGCCACCAACCCC AAGCCCATTTATGCCGATAAAAC-3 5 -AATGGGCTTGGGGTTGGTGGCAGTTTGCCATGCAAGGGATTCCCTGGAATCTGG GGTAATGTCTTTCCCAATTTGCA-3 5 -AACCAACACCAGATTCCAGGGAATCCCTTGCATGGCAAACTGCCACCAACCCC GAAGGAGGGGTTGAAACTGAGG-3 5 -CCTCCTTCGGGGTTGGTGGCAGTTTGCCATGCAAGGGATTCCCTGGAATCTGG TGTTGGTTTTACTTTTCTGTTTT-3 5 -GGGATGCTCCAGATTCCAGGGAATCCCTTGCATGGCAAACTGCCACCAACCCC GCAGGAGCTTTAGCGCCTGAAAT-3 5 -CTCCTGCGGGGTTGGTGGCAGTTTGCCATGCAAGGGATTCCCTGGAATCTGG AGCATCCCTACCATCGAAAAATTC-3 5 -GGTGGCAGTTTGCCATGCAAGG-3 5 -GATCTTTCTCCTGTTTGTGTTCTCC-3
A3-h2-sp55R A3-h4-sp55U A3-h4-sp55R A3-h5-sp55U A3-h5-sp55R sp55r sp70r a
146 147 148
149
The underlined letters represent the sequences encoding the SP55 epitope.
particles at each time point was determined by the measurement of fluorescence counting 48 h after infection, as described by Zhong et al. in 2012 (Zhong et al., 2012). 2.5. Production of recombinant SP55 and SP70 fusion peptides
156
A pGEX-4T-3 vector was used to produce the SP55 peptide and SP70 peptide with an N-terminal glutathione S-transferase (GST) tag (SP70–GST and SP55–GST, respectively). The GST fusion peptides were purified by affinity chromatography using GST-Bind Resin (Novagen) under native conditions and stored as aliquots at −80 ◦ C to avoid repetitive freeze–thaw cycles. The recombinant VP1 protein was prepared previously (Wang et al., 2013).
157
2.6. Mouse immunization
150 151 152 153 154 155
158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173
174
175 176 177 178 179 180 181 182 183 184
Groups of 4–6-week-old female BALB/c mice were used for immunization. Groups of five mice were analyzed in each experiment or at each time point. The mice were vaccinated by intraperitoneal injection with 1 × 1010 VPs of recombinant viruses R1A3, R1R2A3, Ad3EGFP, heat-inactivated EV71 strain (10 g of total protein), 50 g of SP70–GST, 50 g of SP55–GST, or 50 g of GST protein with complete adjuvant. Three boosters were given at 2, 4, and 6 weeks, with the same dose of the same vectors or peptide, by intraperitoneal injection. Blood was collected from the tail vein before each immunization. The sera were separated from the blood cells and kept for serum analysis. The blood was collected via a retroorbital eye bleed 10 days after the final injection. The sera were separated from the blood cells and stored at −80 ◦ C for analysis of the anti-VP1 antibody response and the in vitro neutralization of EV71. All animal procedures were approved by the First Affiliated Hospital of Guangzhou Medical University Ethics Committee. 2.7. In vitro neutralization To determine whether anti-SP70–GST and anti-SP55–GST antibodies neutralized the hexon-modified recombinant virus R1R2A3 and whether the hexon-modified recombinants could escape neutralization by anti-Ad3EGFP, the serum samples were heatinactivated for 45 min at 56 ◦ C and then diluted 2-fold in DMEM in 96-well plates. A viral suspension with a titer of 100 TCID50 in 50 l was added to each serum sample and incubated at 37 ◦ C for 1 h. AD293 cells were then added to each well and incubated for 3–5 days. Serum, virus, and cell controls were included in this test. The plates were monitored for CPEs with light microscopy.
2.8. Immunoblotting analysis An immunoblotting analysis was performed to detect the recombinant adenovirus R1R2A3. Purified EV71 virions, Ad3EGFP, and recombinant adenovirus R1R2A3 cultures were fractionated on a 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) gel, and blotted onto polyvinylidene difluoride (PVDF) membrane. The membrane was exposed to blocking solution (5% fat-free milk) in phosphate-buffered saline containing 0.05% Tween 20 (PBST) at room temperature for 1 h. It was then incubated with a 1:250 dilution of anti-SP55–GST or anti-SP70–GST antibody for 1 h, followed by a horseradish peroxidase (HRP)-labeled goat antimouse IgG secondary antibody diluted 1:10,000 (Bio-Rad). The signals were detected with a chemiluminescent peroxidase substrate (ECL Plus, Millipore). To analyze whether the mice that received R1R2A3 produced antibodies directed against SP70 or SP55, 8-week sera from R1R2A3-immunized mice were used for an immunoblotting analysis. EV71-infected cell lysate, SP70–GST, and SP55–GST were separated on a 10% SDS-PAGE gel and transferred to PVDF membrane. Anti-R1R2A3 serum was diluted 1:500 and used as the primary antibody, and serum from Ad3EGFP-immunized mice was used as the control. The signal was amplified with a 1:9000 dilution of secondary antibody. The signal was detected as described above using ECL Plus. 2.9. Indirect ELISA analysis An enzyme-linked immunosorbent assay (ELISA) was used to determine whether the SP70 or SP55 epitope was presented on the surface of the recombinant virion. Carbonate buffer (pH 9.6) containing 109 VP/100 l of recombinant adenovirus R1R2A3 was immobilized in a 96-well plate overnight at 4 ◦ C. The plate was then blocked with 2% bovine serum albumin (BSA) in PBST at 37 ◦ C for 2 h. Serially diluted anti-SP55GST antibody, anti-SP70GST antibody, or anti-GST antibody was then added to each well and the plates incubated for 1.5 h at 37 ◦ C. The wells were washed three times and incubated with a 1:8000 dilution of HRP-conjugated goat anti-mouse IgG secondary antibody for 1 h. After the plates was washed four times, the reactions were developed with tetramethylbenzidine (TMB) substrate, stopped with 2 M sulfuric acid, and the absorbance (optical density) at 450 nm (OD450 ) measured with a microplate reader (Thermo Scientific Multiskan MK3). To test the anti-SP70 and anti-SP55 antibody responses in immunized mice, ELISA plates were coated with 50 mM carbonate buffer (pH 9.6) containing 1 g/ml SP70–GST or SP55–GST protein overnight at 4 ◦ C. The wells were washed twice with PBST and
Please cite this article in press as: Xue, C., et al., Construction and characterization of a recombinant human adenovirus type 3 vector containing two foreign neutralizing epitopes in hexon. Virus Res. (2014), http://dx.doi.org/10.1016/j.virusres.2014.01.027
185
186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208
209
210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228
G Model VIRUS 96219 1–8
ARTICLE IN PRESS C. Xue et al. / Virus Research xxx (2014) xxx–xxx
4
250
blocked with 2% BSA/PBST at 37 ◦ C for 2 h. After three washes with PBST, serially diluted R1R2A3 sera that had been collected at different time points were added to each well and incubated at 37 ◦ C for 1.5 h. The plates were washed four times with PBST and incubated for 1 h at 37 ◦ C with a 1:9000 dilution of HRP-conjugated goat anti-mouse IgG secondary antibody. The signals were developed with TMB substrate. The OD450 was read on a microplate reader. The endpoint titer was defined as the highest dilution at which the OD450 was at least 0.1 higher than that of wells that received no serum. Serum derived from uninfected mice was used as the negative control. To determine the anti-VP1 humoral responses, ELISA plates were coated with 0.1 g of recombinant VP1 protein in 100 l of 50 mM carbonate buffer (pH 9.6) per well. After the wells were blocked with 2% BSA/PBST, they were washed three times and incubated with 8-week immunized sera from R1A3-, R1R2A3, SP55–GST-, SP70–GST-, Ad3EGFP-, or GST-injected mice at 37 ◦ C for 1.5 h, followed by incubation with HRP-conjugated goat anti-mouse IgG antibody. ELISAs were then performed as described above. Each assay was performed independently at least three times and with at least two parallel reactions for each well.
251
2.10. Neutralization of EV71 in vitro
229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249
266
The titers of NAbs against EV71 were measured in a microneutralization test in vitro. The antisera from different antigen-injected mice were collected 10 days after the fourth injection, according to the immunization schedule. The final immunized serum samples were inactivated at 56 ± 0.5 ◦ C for 30 min, and 50 l of each serially diluted sample was mixed with an equal volume of 100 TCID50 of the EV71-08-02 strain and incubated at 37 ◦ C for 1 h. The mixtures were then adsorbed onto a 96-well microtiter plate containing Vero cells (1 × 105 cell/ml) seeded the previous day. Each assay set included a cell control, a virus control, and antiserum from heat-inactivated EV71 virus, which was used as a positive control. The plates were placed in a CO2 incubator at 37 ◦ C for 5 days, after which the CPEs were observed with microscopy. The NAb titer was defined as the highest dilution of serum capable of inhibiting viral growth.
267
2.11. Statistical analysis
252 253 254 255 256 257 258 259 260 261 262 263 264 265
271
The data are presented as means ±standard errors. Comparisons among groups were made with analysis of variance and Bonferroni’s test to account for multiple comparisons. Statistical significance was defined as p < 0.05.
272
3. Results
268 269 270
273 274
275 276 277 278 279 280 281 282 283 284 285 286
Fig. 2. PCR amplification of the SP55 and SP70 epitope insertions from recombinant adenovirus plasmids. PCR products were analyzed by 0.8% agarose gel electrophoresis. M: marker DL5,000 (Takara); lanes 1, 3, and 5 are pR1R2A3, pR1R4A3, and pR1R5A3, respectively, amplified with primers HexonF/sp55r. Lanes 2, 4, and 6 are pR1R2A3, pR1R4A3, and pR1R5A3, respectively, amplified with primers HexonF/sp70r. Lanes 7 and 8 are the negative control pAd3egf, amplified with primers HexonF/sp55r and HexonF/sp70r, respectively.
To determine whether R1R2A3 expressed the SP55 and SP70 epitopes in the hexon region, purified EV71 and recombinant adenovirus R1R2A3 or Ad3EGFP were subjected to immunoblotting analysis with anti-SP55–GST and anti-SP70–GST antibodies. The detection of a hexon fusion protein band of the expected size (about 110 kDa) suggested that the SP70 and SP55 epitopes were successfully incorporated into the hexon capsid protein (Fig. 3B, lane 2, lane 5). A band was visible for EV71 consistent with the expected size (33 kDa) of the EV71 VP1 peptide (Fig. 3B, lane 1, lane 6), and no band was found in the Ad3EGFP control (Fig. 3B, lane 3 and lane 4). Because hexon is the most abundant protein in the adenovirus capsid, changing its structural components may lead to virion instability compared with that of its wild-type counterpart. To test whether the incorporation of exogenous peptides SP55 and
3.1. Generation of hexon-modified Ad3 containing both SP55 and SP70 The recombinant plasmids pR1R2A3, pR1R4A3, and pR1R5A3 encoding the 15 amino acids each of SP55 and SP70 were obtained by homologous recombination in E. coli and identified by PCR (Fig. 2), and confirmed by restriction enzyme digestion and full-length hexon sequencing analysis (data not shown). In cells transfected with pR1R4A3 or pR1R5A3, no evidence of viral growth was seen, even 2 weeks after infection, and repeated attempts to package the virus failed. However, in cells transfected with pR1R2A3, the fluorescent signal from individual cells was detectable 7 days after transfection, indicating that the R1R2A3 virus had been rescued. After amplification on AD293 cells, the rescued R1R2A3 virus was confirmed by PCR (Fig. 3A) and sequencing.
Fig. 3. SP70 and SP55 epitopes incorporated into hexon HVR1 and HVR2. (A) Rescued virus was amplified and viral DNA was used to confirm that SP70 and SP55 were correctly incorporated into hexon hypervariable region (HVR) 1 and HVR2, respectively. M: DNA marker DL15,000 (Takara, China); lanes 1, 2, and 3 are rescued virus R1R2A3, amplified with primers HexonF/HexonR, HexonF/sp55r, and HexonF/sp70r, respectively; lanes 4, 5, and 6 are the negative control Ad3EGFP amplified with the primers HexonF/HexonR, HexonF/sp55r, and HexonF/sp70r, respectively. (B) Immunoblotting analysis of the SP70 and SP55 epitopes in the hexon protein. Purified EV71 virions (lanes 1, 6), the 33-kDa band represents the VP1 protein; recombinant virus R1R2A3 (lanes 2, 5), the 110-kDa band represents the hexon fusion protein; unmodified control Ad3EGFP (lanes 3, 4).
Please cite this article in press as: Xue, C., et al., Construction and characterization of a recombinant human adenovirus type 3 vector containing two foreign neutralizing epitopes in hexon. Virus Res. (2014), http://dx.doi.org/10.1016/j.virusres.2014.01.027
287 288 289 290 291 292 293 294 295 296 297 298 299 300 301
G Model VIRUS 96219 1–8
ARTICLE IN PRESS C. Xue et al. / Virus Research xxx (2014) xxx–xxx
Fig. 4. Thermostability and growth kinetics of R1R2A3 expressing two epitopes in hexon. (A) Thermostability assay of R1R2A3. Hexon-modified R1R2A3 and unmodified Ad3EGFP were incubated at 45 ◦ C for 0, 5, 10, 20, 40, or 60 min before they were used to infect HEp-2 cells. Fluorescence was measured with a Varioskan Flash Multimode Reader (Thermo Scientific). Relative infectivity is expressed as a percentage of the fluorescence of infectious particles remaining in each sample with that in the sample without incubating at 45 ◦ C. (B) Growth curve of recombinant R1R2A3. The cells were infected with R1R2A3 or Ad3EGFP at 5 VPs/cell and harvested every 12 h for 72 h. The number of infectious particles (i.p.) was determined with the fluorescent counting method. i.p./ml = n × fold dilution.
302 303 304 305 306 307 308 309 310 311
312 313
314 315 316 317 318
SP70 into the capsid hexon molecules affected viral thermostability, R1R2A3 and Ad3EGFP were incubated at 45 ◦ C for different time intervals before they were used to infect HEp-2 cells. The growth characteristics of R1R2A3 and Ad3EGFP were also compared to evaluate whether the insertion of the peptides had any effect on virus assembly. Hexon-modified R1R2A3 showed similar stability to that of unmodified Ad3EGFP (Fig. 4A), and there was no difference in the viral yields of R1R2A3 and Ad3EGFP (Fig. 4B). These data suggest that the incorporation of heterologous peptides within the hexon HVRs does not affect virion stability or growth kinetics.
5
Fig. 5. ELISA analysis of SP55 and SP70 epitopes exposed on recombinant R1R2A3 virion surfaces. Recombinant R1R2A3 or control Ad3EGFP, at final concentrations of 109 VP/ml, were immobilized on ELISA plates and incubated with 4-fold serial dilutions of (A) anti-SP55–GST antiserum, (B) anti-SP70–GST antiserum, or (C) control anti-GST antiserum. Binding was detected with an HRP-conjugated goat anti-mouse IgG secondary antibody. These results suggest that the SP55 and SP70 epitopes incorporated into hexon were accessible to anti-SP55–GST and anti-SP70–GST antibodies at the virion level, indicating that the epitopes were exposed on the virion surface.
anti-SP55–GST and anti-SP70–GST antibodies, whereas the control Ad3EGFP containing the wild-type hexon was not recognized by any of these antibodies (Fig. 5A and B). This indicates that the SP55 and SP70 epitopes were exposed on the surfaces of the viral particles when incorporated within the hexon HVRs.
3.2. Presentation of both SP70 and SP55 epitopes on the virion surface
3.3. Incorporation of SP55 and SP70 within HVRs partly circumvents the neutralization of Ad3EGFP antiserum
To analyze the presentation of these two epitopes on the surface of the virion, purified virions or Ad3EGFP was immobilized on ELISA plates and incubated with anti-SP55–GST antibody (Fig. 5A), anti-SP70–GST antibody (Fig. 5B), and control anti-GST antibody (Fig. 5C). R1R2A3 was recognized by the corresponding
The SP55–GST and SP70–GST-peptide-immunized sera showed the same neutralizing antibody titers against recombinant R1R2A3 (Table 2). The neutralization titer of anti-Ad3EGFP serum against hexon-modified R1R2A3 was significantly lower than that against Ad3EGFP, which indicates that the replacement of HVR1 and HVR2
Please cite this article in press as: Xue, C., et al., Construction and characterization of a recombinant human adenovirus type 3 vector containing two foreign neutralizing epitopes in hexon. Virus Res. (2014), http://dx.doi.org/10.1016/j.virusres.2014.01.027
319 320 321 322 323
324 325
326 327 328 329 330
G Model
ARTICLE IN PRESS
VIRUS 96219 1–8
C. Xue et al. / Virus Research xxx (2014) xxx–xxx
6
Fig. 6. SP55 and SP70 epitopes incorporated within HVRs elicit IgG immune responses. (A) An immunization time line showing when the immunizations were performed; arrows show each injection time. Primary and postimmunization sera were collected before each immunization for the analysis of the antibody response in vaccinated mice. (B) EV71-infected cell lysate (lane 1), SP55–GST fusion protein (lane 2), SP70–GST fusion protein (lane 3), and GST (lane 4) were fractioned on an SDS-PAGE gel and then transferred to PVDF membrane. The membrane was immunoblotted with antiserum from R1R2A3-injected mice. An HRP-linked antibody was used to detect the mouse antibodies and the signal was amplified with ECL reagent. (C) 1 g/ml SP55–GST and SP70–GST were bound to ELISA plates and incubated with R1R2A3-immunized sera collected before the first injection (0 w) and at 2, 4, 6, and 8 weeks. Binding was detected with IgG-specific HRP-conjugated goat anti-mouse IgG secondary antibody. (D) Anti-VP1 IgG levels in sera collected at 8 weeks were quantified with an indirect ELISA. The OD450 reflects the levels of serum antibodies. Data are the means ±SD for each group of mice. Error bars represent the standard error of the means for each group. ∗∗ p < 0.05, when antiserum from R1R2A3 was compared with antiserum from R1A3, SP55–GST, or SP70–GST.
331 332
333 334
335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350
with exogenous epitopes made R1R2A3 partly resistant to antiAd3EGFP serum. 3.4. Both SP55-specific and SP70-specific antibodies were induced in mice after immunization To determine whether immunized mice produced antibodies against the SP55 and SP70 epitopes, mice were immunized with R1A3, R1R2A3, SP70–GST, SP55–GST, Ad3EGFP, or GST. The injections were performed at 0, 2, 4, and 6 weeks and the sera were collected before each injection (Fig. 6A). EV71infected cell lysate, SP55–GST protein, and SP70–GST protein were subjected to immunoblotting analysis with antiserum from R1R2A3-immunized mice, and anti-Ad3EGFP serum was used as the control. Serum from mice vaccinated with R1R2A3 recognized the EV71 antigen in the lysate showing a protein band of approximately 33 kDa, consistent with the EV71 VP1 protein, and reacted with the SP55–GST and SP70-GST proteins (Fig. 6B). No protein band was detected with antiserum from mice immunized with the control Ad3EGFP (data not shown). These results indicate that a humoral immune response had been elicited against these two epitopes inserted into hexon. Table 2 In vitro neutralization (mean ±SD, n = 5). Antiserum
Virus neutralization titer
Anti-SP55-GST Anti-SP70-GST Anti-GST Anti-Ad3EGFP
R1R2A3 800 ± 240 800 ± 240
