Chapter 13 Construction and Application of Site-Specific Artificial Nucleases for Targeted Gene Editing Fatma O. Kok, Ankit Gupta, Nathan D. Lawson, and Scot A. Wolfe Abstract Artificial nucleases have developed into powerful tools for introducing precise genome modifications in a wide variety of species. In this chapter the authors provide detailed protocols for rapidly constructing zinc finger nucleases (ZFNs) and TALE nucleases (TALENs) and evaluating their activity for the targeted generation of InDels within the zebrafish genome. Key words Zinc finger nucleases, ZFNs, TALE nucleases, TALENs, Zebrafish, Modular assembly, Golden gate assembly

1

Introduction The utility of a model organism for studying biological processes can be closely tied to its amenability to targeted genome manipulation. Until recently, targeted genome editing in most organisms including zebrafish was not feasible, which stymied their broad implementation as a model system to study many of the biological processes. The development of artificial endonucleases, namely zinc finger nucleases (ZFNs) and TAL effector nucleases (TALENs) that can create double-strand breaks at desired sites in a genome has provided a universal platform for targeted genome modification. Both ZFNs and TALENs have now been successfully employed for gene editing in a variety of organisms and cell lines [1]. Both ZFNs and TALENs are composed of the nuclease domain from the FokI endonuclease fused to a tandem array of DNA-binding domains that can be engineered to recognize desired sequences in the genome. Since the FokI endonuclease domain requires dimerization for activity, two ZFN or TALEN monomers are required for activity where each monomer includes either homodimeric or obligate

Fatma O. Kok and Ankit Gupta contributed equally to this work. Michael F. Ochs (ed.), Gene Function Analysis, Methods in Molecular Biology, vol. 1101, DOI 10.1007/978-1-62703-721-1_13, © Springer Science+Business Media, LLC 2014

267

268

Fatma O. Kok et al.

heterodimeric versions of the FokI cleavage domain [2–4]. Each ZFN monomer contains an array of 3- to 6-C2H2-zinc finger DNAbinding domains each recognizing 3 bp per finger, whereas each TALEN monomer contains an array of 15- to 20-TALE DNAbinding modules each recognizing one base pair per monomer. In this chapter, we provide detailed methods to assemble ZFNs and TALENs and to employ them to create lesions at desired sites in the zebrafish genome (Fig. 1). For constructing zinc finger arrays (ZFAs) for ZFNs, we utilize an archive of single finger modules (1F-modules) and two-finger modules (2F-modules) that have provided high success rates when utilized for gene targeting [5, 6]. These ZFAs can be generated by gene synthesis or assembled by overlapping PCRs and then cloned into desired vectors containing the FokI endonuclease domain. For constructing TALENs, we utilize the TALE modules published by Cermak et al. [7] and employ the GoldenGate-based approach described by the Voytas lab with some modifications [7]. Both of these approaches yield nucleases that produce lesions the majority of the time.

2

Materials

2.1 Molecular Biology Reagents

Golden Gate TALEN and TAL Effector Kit (TALEN Kit #1000000016, Addgene). Joung Lab REAL Assembly TALEN Kit (TALEN kit #1000000017, Addgene). QIAprep Spin Miniprep Kit (27104, Qiagen). QIAquick Gel Extraction Kit (28704, Qiagen). QIAquick PCR purification Kit (28004, Qiagen). UltraPure™ Agarose. UltraPure™ Agarose-1000 (16550100, Invitrogen). mMESSAGE mMACHINE® SP6 Kit (AM1340, Ambion). mMESSAGE mMACHINE® T7 ULTRA Kit (AM1345, Ambion). pGEM®-T Vector System I (A3600, Promega). SURVEYOR® Mutation Detection Kit (706020, Transgenomic). T4 DNA Ligase. Phusion High fidelity DNA polymerase (M0530S, NEB). 2-Log DNA Ladder (0.1–10.0 kb). BamHI. Acc65I. NotI-HF™ (R3189S, NEB). BsaI-HF™ (R3535S, NEB). XbaI. AflII. PmeI.

Site-Specific Artificial Nucleases

269

Identify the ZFN / TALEN target site Assemble and clone ZFNs/TALENs in appropriate vectors (~2 weeks) SP6 T7

ZFN TALEN

FokI

SP6 T7

ZFN TALEN

FokI

In vitro transcribe mRNA ZFN TALEN

FokI AAAAAAA

ZFN TALEN

FokI AAAAAAA

Cross zebrafish with the desired genotype X

inject ZFN / TALEN mRNAs in single cell-stage zebrafish embryos

24 hpf grow to adulthood (10-12 weeks)

Putative founders

Detect ZFN/TALEN activity using the RFLP analysis or Cel1 surveyor nuclease assay and characterize lesions (1 week) +/m1 X Outcross the identified founder to the desired zebrafish line and raise progeny (6-8 weeks) Fin clip and genotype to identify hetrozygotes

Identify founders by genotyping the progeny and characterize mutant alleles (2 weeks)

Fig. 1 Overview of targeted gene disruption using ZFNs or TALENs in zebrafish. Two monomers of ZFNs or TALENs are generated. In vitro transcribed mRNAs are injected in zebrafish embryos at single cell stage and the induction of lesions is assayed using RFLP analysis or surveyor nuclease assay. If active, ZFN- or TALENinjected embryos are grown to adulthood and founder animals transmitting mutant alleles are identified again using RFLP analysis or surveyor nuclease assay. Once confirmed, the founder animal can be crossed to desired zebrafish lines to generate animals heterozygous for the desired mutation

Proteinase K. Esp3I (ER0451, Fermentas). Plasmid-Safe™ ATP-Dependent DNase (E3101K, Epicentre). HotMaster Taq DNA Polymerase (2200310, 5Prime). Phenol:Chloroform:Isoamyl Alcohol 25:24:1. Chloroform. Pure Ethanol 200 Proof.

270

Fatma O. Kok et al.

Ampicillin sodium salt: 100 mg/mL stock; 100 μg/mL final. Spectinomycin dihydrochloride pentahydrate: 10 mg/mL stock; 50 μg/mL final. X-Gal (5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside) with 40 μg/mL final concentration. 2.2

Equipment

Pneumatic PicoPump (# SYS-PV820, World Precision Instruments). Thin wall glass capillaries (TW100-4, World Precision Instruments). PTC-225 Peltier thermal cycler. P-87 Flaming/brown micropipette puller (Sutter Instrument Co.). Nanodrop (Thermo Scientific).

2.3

Solutions

Lysis buffer: 10 mM Tris–HCl pH 8, 1 mM EDTA, 0.3% Tween-20, 0.3% NP40.

2.4

Primers

For ZFA assembly primers, refer to Table 1. pCR8_F1: TTGATGCCTGGCAGTTCCCT pCR8_R1: CGAACCGAACAGGCTTATGT JDS_screen_F: CTGCTGAAGATCGCGAAGA JDS_screen_R: GACCCTTTTTGACTGCATCG SP6 primer: ATTTAGGTGACACTATAG T7 primer: AATACGACTCACTATAG T3 primer: ATTAACCCTCACTAAAG SP6long: GCTTGATTTAGGTGACACTATAGAATACAAGC PCS2Fok1Rev: GAAGTTCAGATTTCTTCTCCTC

3

Methods

3.1 ZFNs Assembly Overview

The most critical step in ZFN-mediated gene targeting is choosing the target site in the desired gene. We developed a ZFN site identification tool. http://pgfe.umassmed.edu/ZFPmodularsearchV2.html. That searches for target sites for 3- or 4-finger ZFNs that can be assembled using combinations of our 1F-modules and 2F-modules and scores the ZFN sites based on the quality of the incorporated modules. These ZFNs are designed to target sequences with 5, 6, or 7 bp gaps (spacer) between the monomer recognition sequences, where each ZFN monomer can contain three or four fingers. In our experience ZFNs targeting sites with a 7 bp gap have lower activity, so we would recommend placing higher priority on ZFNs targeting 5- or 6-bp gaps (or TALENs). ZFNs with higher scores output by our identification tool are more likely to be active, where the 2F-modules are scored based on their DNA-binding specificity as determined in the B1H system and 1F-modules are scored based

CCCAGTCACGACGTTGTAAAACGGTACCAAGCCCTATAAATGTCCTGAATG

ACACGCGTATGGCTTCTCACCGGTGTGCGTA

TGAGAAGCCATACGCGTGTCCTGTCGAGTCCTGT

GCATTGAAACGGTTTTTGCCCTGTGTGAATC

GCAAAAACCGTTTCAATGCCGCATCTGCATG

ACAGGCGAAGGGCTTTTCTCCTGTGTGGGTG

AGAAAAGCCCTTCGCCTGTGACATCTGCGG

AGCGGATAACAATTTCACACAGGATCCACGGAGGTGGATCTTGGTGTG

CCCAGTCACGACGTTGTAAAACGGTACCCGCCCATATGCTTGCCC

CCCAGTCACGACGTTGTAAAACGGTACCAAACCGTATGCTTGCCCTGTC

GCATTGAAACGGTTTTTGCCCTGTGTGGGTCCTGATGTG

TGAGAAGCCATACGCGTGTCCTGTCGAGTCCTGTGAC

ACAGGCGAAGGGCTTTTCTCCTGTGTGGGTCCTGATGTG

GCAAAAACCGTTTCAATGCCCTGTCGAGTCCTGCGAC

AGCGGATAACAATTTCACACAGGATCCACGGAGGTGGGTCCTGATGTG

CCCAGTCACGACGTTGTAAAACGGTACCAAACCGTATGCTTGCCCTG

CCGTATGCTTGCCCTGTCGAGTCCTGCGACCGCCGCTTCTCCcagcgcggcXXXCT

TGAGAAGCCATACGCGTGTCCTGTCGAGTCCTGTGACCGCCGCTTCTCCcagcgcggcXXXCT

GCAAAAACCGTTTCAATGCCCTGTCGAGTCCTGCGACCGCCGCTTCTCCcagcgcggcXXXCT

TTGTAAAACGGTACCAAACCGTATGCTTGCCCTGTCGAGTCCTGCGACCGCCGCTTCTCCcagcgcggcXXXCT

F0Fn

F0Rn

F1Fn

F1Rn

F2Fn

F2Rn

F3Fn

F3RnLRGS

F1(noF0)Fn

2FM-F0Fn

2FM-F1Rn

2FM-F1Fn

2FM-F2Rn

2FM-F2Fn

2FM-F3RnLRGS

2FM-F1(noF0)Fn

2FM-F0-QRG(Y)Fn

2FM-F1-QRG(Y)Fn

2FM-F2-QRG(Y)Fn

2FM-F1(noF0)-QRG(Y)Fn

(continued)

Sequence (5′–3′)

Primer name

Table 1 Sequences for primers employed in ZFA assembly

Site-Specific Artificial Nucleases 271

CGTTGTAAAACGGTACCAAACCTTATGCTTGCCCTGTC

ACGTTGTAAAACGGTACCAAACCT

AACAATTTCACACAGGATCCACG

cgCACACAGGATCCCGCGGCACCcGGACCGGTGTGGATCTTGGTGTG

cgCACACAGGATCCCGCGGCACCcGGACCGGTGTGGGTCCTGATGTG

cgCACACAGGATCCCGCGGC

2FM-NT-in-Fn

2FM-NT-out-Fn

2FM-CT-out-Rn

F3Rn(8aa)

pF3Rn AG/AR module (8aa)

2FM-CT-out-Rn(8aa)

Note: For QRG(Y) primers in place of XXX; Use ACN if Y is Thr; Use AAY if Y is Asn; Use CAC if Y is His Where Y is the amino acid at position 3 in the recognition helix of the N-terminal finger of the 2F-module

Sequence (5′–3′)

Primer name

Table 1 (continued)

272 Fatma O. Kok et al.

Site-Specific Artificial Nucleases

273

on the number of guanines in their binding site. ZFNs containing 2F-modules are readily identified in the output from the website by the presence of lowercase triplet sequences in the site breakdown, and by the presence of “2FM-#” in the output Module ID information. This site also provides the protein and DNA sequences for each ZFA that can be used for reference during the assembly process or for direct gene synthesis if so desired. Since each ZFN functions as a dimer, two 3- or 4-finger ZFAs are assembled, one that binds to the 5p-half-site (5pZFA) and other that binds to the 3p-half-site (3pZFA). Once the desired target sites are chosen, identify the 1F- and/or 2F-modules that are required for building the ZFNs and the type of assembly involved (for example: ZFA with all 1F-modules or ZFA with a 2F-module at finger-2 and finger-3 position. See Table 2 for nomenclature describing all possible finger combinations for ZFA assembly). ZFNs with 2F-modules targeting GRN-NNA sequences instead of GNN-NNG sequences require alternate primer sets (see Tables 2 and 3) due to the replacement of the RSD cap with the QRG-cap in the N-terminal finger of the 2F-module [6]. Consequently, the assembly methods for different combinations of fingers though similar, involve different primer sets (Tables 2 and 3), where individual 1F- and 2F-modules are PCR amplified followed by assembly using overlapping PCR and finally cloning the assembled products into the vectors containing the desired FokI variant (Fig. 2). Finally, if the ZFN target site contains a 7-bp spacer between the two half-sites, a primer encoding an eight amino acid linker between the ZFA and the FokI nuclease domain is used for final amplification instead of a primer encoding a four amino acid linker used for 5- and 6-bp spacer. 3.1.1 ZFA Assembly

The DNA sequences provided in the output from our target identification tool can be utilized for generating ZFAs directly through gene synthesis. Synthesized ZFAs should be obtained as clones flanked by Acc65I and BamHI restriction sites (these are present in each ZFA sequence output from our website), which can be directly subcloned into the desired FokI expression vectors (see Subheading 3.1.2). Otherwise, ZFAs can be assembled from individual modules as described below. Once a ZFN target site has been chosen, start the ZFA assembly process by identifying the constituent 1F- and 2F-modules. Each 1F-module binds to a 3 bp sequence indicated in capital letters and each 2F-module binds to two 3 bp sequences indicated in small letters. Note that the ZFA binds in an antiparallel orientation to the DNA, i.e., the C-terminal finger-3 binds to the 5′ triplet, whereas the N-terminal finger-1 (in a 3-finger ZFA) or finger-0 (in a 4-finger ZFA) binds to the 3′ triplet. For example, in the ZFA site GGAGGGgacacg, GGA, GGG are bound by two 1F-modules at finger-3 and finger-2 positions, respectively, whereas gacacg is bound

274

Fatma O. Kok et al.

Table 2 Types of ZFA assemblies based on constituent zinc finger modules Name of the ZFA assembly method Zinc finger modules included in the ZFA

Binding site type

Type 1

3-Finger ZFA; 1F-modules at finger-1, finger-2 and finger-3 positions

NNN-NNN-NNN

Type 2

3-finger ZFA; 1F-module at finger-1 and 2F-module at finger-2_ finger-3 position

nnn-nng-NNN

Type 3

3-finger ZFA; 2F-module at finger-1_finger-2 positions and 1F-module at finger-3 position

NNN-nnn-nng

Type 4

3-finger ZFA; 1F-module at finger-1 position and 2F-moduleQRG cap at finger-2_finger-3 position

nnn-nna-NNN

Type 5

3-finger ZFA; 2F-module-QRG cap at finger-1_finger-2 position and 1F-module at finger-3 position

NNN-nnn-nna

Type 6

4-finger ZFA; 1F-modules at finger-0, finger-1, finger-2 and finger-3 positions

NNN-NNNNNN-NNN

Type 7

4-finger ZFA; 1F-modules at finger-0 and finger-1 positions, and 2F-module at finger2_finger-3 position

nnn-nng-NNNNNN

Type 8

4-finger ZFA; 1F-module at finger-0 position, 2F-module at finger-1_finger-2 position and finger-3 position

NNN-nnn-nngNNN

Type 9

4-finger ZFA; 2F-module at finger-0_finger-1 position, and 1F-modules at finger-2 and finger-3 positions

NNN-NNNnnn-nng

Type 10

4-finger ZFA; N-terminal-2F-module at finger-0_finger-1 position nnn-nng-nnnand C-terminal-2F-module at finger-2_finger3 position nng

Type 11

4-finger ZFA; 1F-modules at finger-0 and finger-1 positions and 2F-module-QRG at finger-2_finger-3 position

Type 12

4-finger ZFA; 1F-module at position finger-0, 2F-module-QRG at NNN-nnn-nnafinger-1_finger-2 position and 1F-module at finger-3 position NNN

Type 13

4-finger ZFA; 2F-module-QRG at finger-0_finger-1 position and 1F-modules at finger-2 and finger-3 positions

Type 14

4-finger ZFA; N-terminal-2F-module-QRG at finger-0_finger-1 nnn-nng-nnnposition and C-terminal-2F-module at finger-2_finger-3 position nna

Type 15

4-finger ZFA; N-terminal-2F-module at finger-0_finger-1 position nnn-nna-nnnand C-terminal-2F-module-QRG at finger-2_finger-3 position nng

Type 16

4-finger ZFA; N-terminal-2F-module-QRG at finger-0_finger-1 position and C-terminal-2F-module-QRG at finger-2_finger-3 position

nnn-nna-NNNNNN

NNN-NNNnnn-nna

nnn-nna-nnn-nna

Each 1F-module binds to a 3 bp DNA sequence shown in capital letters (NNN) and each 2F-module binds to two 3 bp DNA elements shown in small letters (nnn-nng). The 2F-modules that recognize nnn-nna type of sequences require a QRG cap instead of a RSD cap

Finger-1_Finger-2(QRG): 2FM-F1Fn; 2FM-F2Rn Finger-3: F3Fn; F3RnLRGS

Finger-0: F0Fn; F0Rn Finger-1: F1Fn; F1Rn Finger-2: F2Fn; F2Rn Finger-3: F3Fn; F3RnLRGS

Type 5

Type 6

2FM-F1(noF0)-QRG(Y)Fn; 2FM-F2Rn

Finger-1: F1(noF0)Fn and F1Rn Finger-2_Finger-3(QRG): 2FM-F1Fn; 2FM-F2Rn

Type 4

2FM-F2-QRG(Y)Fn; 2FM-F3RnLRGS

Finger-1_Finger-2: 2FM-F1(noF0)Fn; 2FM-F2Rn Finger-3: F3Fn; F3RnLRGS

Type 3

F0Fn; F3RnLRGS

2FMF1(noF0)Fn; F3RnLRGS

F1(noF0)Fn; 2FM-F3RnLRGS

2FM-F1(noF0)Fn; F3RnLRGS

F1(noF0)Fn; 2FM-F3RnLRGS

Finger-1: F1(noF0)Fn; F1Rn Finger-2_Finger-3: 2FM-F2Fn; 2FMF3RnLRGS

Type 2

Primer pair for step 4 F1(noF0)Fn; F3RnLRGS

Primer pair for step 3 (only when 2F-modules require a QRG cap)

Finger-1: F1(noF0)Fn; F1Rn Finger-2: F2Fn; F2Rn Finger-3: F3Fn; F3RnLRGS

Primer pairs for step 1 (one pair for each module)

Type 1

Assembly type

F0Fn, F3Rn(8aa)

(continued)

2FMF1(noF0)Fn; F3Rn(8aa)

F1(noF0)Fn; 2FM-F3Rn(8aa)

2FM-F1(noF0)Fn; F3Rn(8aa)

F1(noF0)Fn; 2FM-F3Rn(8aa)

F1(noF0)Fn; F3Rn(8aa)

Primer pair for step 6 (only for ZFNs with a 7-bp spacer)

Table 3 Primer combinations employed in different steps of ZFA assembly. Steps 3 and 6 are performed in selected assemblies only

Site-Specific Artificial Nucleases 275

2FM-F0Fn; F3RnLRGS

Finger-0_finger-1: 2FM-F0Fn; 2FM-F1Rn Finger-2: F2Fn; F2Rn Finger-3: F3Fn; F3RnLRGS

Finger-0_Finger-1: 2FM-NTin-Fn; 2FM-F1Rn Finger-2_Finger-3: 2FM-F2Fn; 2FM-F3RnLRGS

Type 9

Type 10

2FM-NT-out-Fn; 2FM-CT-out-Rn

F0Fn; F3RnLRGS

Finger-0: F0Fn; F0Rn Finger-1_Finger-2: 2FM-F1Fn; 2FM-F2Rn Finger-3: F3Fn; F3RnLRGS

Type 8

Primer pair for step 4 F0Fn; 2FM-F3RnLRGS

Primer pair for step 3 (only when 2F-modules require a QRG cap)

Finger-0: F0Fn; F0Rn Finger-1: F1Fn; F1Rn Finger-2_Finger-3: 2FM-F2Fn; 2FM-F3RnLRGS

Primer pairs for step 1 (one pair for each module)

Type 7

Assembly type

Table 3 (continued)

Note: if the ZFN target site has a 7-bp spacer, replace the primer 2FM-F3RnLRGS with 2FM-F3Rn(8aa) for step 1 PCR and replace primer 2FM-CT-out-Rn with 2FM-CT-out-Rn(8aa) for the step 4 PCR

2FM-F0Fn; F3Rn(8aa)

F0Fn; F3Rn(8aa)

F0Fn; 2FM-F3Rn(8aa)

Primer pair for step 6 (only for ZFNs with a 7-bp spacer)

276 Fatma O. Kok et al.

Finger-0: F0Fn; F0Rn Finger-1: F1Fn; F1Rn Finger-2_Finger-3(QRG): 2FM-F1Fn; 2FM-F2Rn

Finger-0: F0Fn; F0Rn Finger-1_Finger-2(QRG): 2FM-F1Fn; 2FM-F2Rn Finger-3: F3Fn; F3RnLRGS

Finger-0_Finger-1(QRG): 2FM-F1Fn; 2FM-F2Rn Finger-2: F2Fn; F2Rn Finger-3: F3Fn; F3RnLRGS

Finger-0_Finger-1(QRG): 2FM-F1Fn; 2FM-F2Rn Finger-2_Finger-3: 2FM-F2Fn; 2FM-F3RnLRGS

Type 12

Type 13

Type 14

Primer pairs for step 1 (one pair for each module)

Type 11

Assembly type

Note: Following gel extraction, repeat step 3 on this product using 2FM-NT-in-Fn and 2FM-F1Rn primers

2FM-F0-QRG(Y)Fn; 2FM-F1Rn

2FM-F0-QRG(Y)Fn; 2FMF1Rn

2FM-F1-QRG(Y)Fn; 2FM-F2Rn

2FM-F2-QRG(Y)Fn; 2FM-F3RnLRGS

Primer pair for step 3 (only when 2F-modules require a QRG cap)

2FM-NT-out-Fn; 2FM-CT-out-Rn

2FM-F0Fn; F3RnLRGS

F0Fn; F3RnLRGS

F0Fn; 2FM-F3RnLRGS

Primer pair for step 4

(continued)

Note: if the ZFN target site has a 7-bp spacer, replace the primer 2FM-F3RnLRGS in step 1 with 2FM-F3Rn(8aa) and replace primer 2FM-CTout-Rn in step 4 with 2FM-CT-out-Rn(8aa)

2FM-F0Fn; F3Rn(8aa)

F0Fn; F3Rn(8aa)

F0Fn; 2FM-F3Rn(8aa)

Primer pair for step 6 (only for ZFNs with a 7-bp spacer)

Site-Specific Artificial Nucleases 277

2FM-NT-out-Fn; 2FM-CT-out-Rn

Primer pair for step 4

Amplification of 1F-modules should yield a product of approximately 90–100 bp Amplification of 2F-modules should yield a product of approximately 180–200 bp Assembled 3-finger ZFAs should be approximately 270 bp Assembled 4-finger ZFAs should be approximately 360 bp

Finger-0_finger-1(QRG): 2FM-F0- 2FM-NT-out-Fn; QRG(Y)Fn; 2FM-F1Rn 2FM-CT-out-Rn primers Note: following gel purification, repeat step 3 on this product with 2FM-NT-in-Fn and 2FM-F1Rn primers Finger-2_Finger-3(QRG): 2FM-F2QRG(Y)Fn; 2FM-F3RnLRGS

Finger-0_finger-1(QRG): 2FM-F1Fn; 2FM-F2Rn Finger-2_Finger-3(QRG): 2FM-F1Fn; 2FM-F2Rn

Type 16

Primer pair for step 3 (only when 2F-modules require a QRG cap)

Finger-0_finger-1: 2FM-NT- 2FM-F2-QRG(Y)Fn; in-Fn; 2FM-F1Rn 2FM-F3RnLRGS Finger-2_Finger-3(QRG): 2FM-F1Fn and 2FM-F2Rn

Primer pairs for step 1 (one pair for each module)

Type 15

Assembly type

Table 3 (continued)

Note: if the ZFN target site has a 7-bp spacer, replace the primer 2FM-F3RnLRGS in step 1 with 2FM-F3Rn(8aa) and replace primer 2FM-CTout-Rn in step 4 with 2FM-CT-out-Rn(8aa)

Note: if the ZFN target site has a 7-bp spacer, replace the primer 2FM-F3RnLRGS in step 1 with 2FM-F3Rn(8aa) and replace primer 2FM-CTout-Rn in step 4 with 2FM-CT-out-Rn(8aa)

Primer pair for step 6 (only for ZFNs with a 7-bp spacer)

278 Fatma O. Kok et al.

Site-Specific Artificial Nucleases

279

a Schematic of a zinc finger nuclease 3

3pZFA 1

2

0

kI Fo kI

0

1

2 5pZFA

Fo

3

-1 1 2 3 4 5 6 (F/Y)-X-C-X2−5-C-X3-(F/Y)-X-X-X-X-X-L-X-X-H-X3−5-HTG(Q/E)KP

b

ZFA assembly Identification of the assembly method and the zinc finger modules required for assembly

1F-module Finger-0

1F-module Finger-1

2F-module Finger-2_ Finger-3

PCR amplification of Individual modules Finger-0

Finger-2

Finger-1

Finger-3

Assembly of ZFA using overlapping PCR

Finger-0

Finger-1

Finger-2

Finger-3

Fig. 2 Schematic of a Zinc Finger Nuclease and overview of the Zinc Finger Array assembly protocol. (a) Each monomer of a zinc finger nuclease contains a FokI endonuclease domain and an array of zinc fingers (5pZFA or 3pZFA) where each zinc finger (represented by a rectangle with finger position) binds to a 3 bp DNA element. The consensus sequence of a zinc finger motif is shown where the residues typically involved in base-specific DNA recognition are indicated in bold and numbered to indicate their position relative to the start of the α-helix. Binding of two ZFN monomers to their respective binding sites (bold) separated by a 5, 6 or a 7 bp spacer in the optimal orientation creates a double-strand break in the spacer. (b) Constituent 1F-modules and 2F-modules are PCR amplified from template plasmids and assembled via PCR using the overlapping ends appended to the amplified zinc finger modules

by a 2F-module at finger-1_finger-0 position. Moreover, when the 2F-module binds to nnnnna type of sequences (Table 2), the RSD cap on the 2F-module is replaced by a QRG cap using special primers and additional assembly steps (see below and Table 3). 1. Amplify individual modules: depending on the type of assembly involved (Table 2), use appropriate primers (Table 3) for amplifying individual modules as follows:

280

Fatma O. Kok et al.

PCR conditions

Cycling

1F- or 2F-module template plasmid 10 ng 5× Phusion Buffer 5 μL 10 mM dNTPs 0.5 μL

98 °C for 3 min

50 μM Forward Primer 0.5 μL

98 °C for 15 s

50 μM Reverse Primer 0.5 μL

50 °C for 15 s. 6 Repeats

Phusion enzyme (2 U/μL) 0.25 μL

72 °C for 30 s

Add water to make volume to 25 μL

98 °C for 15 s 56 °C for 15 s. 24 Repeats 72 °C for 15 s 72 °C for 5 min Hold at 4 °C

2. Following amplification, run PCR products on 2% agarose gel. Slice the gel to recover the amplicons of the desired sizes (Table 3) and extract DNA using Qiagen Gel Extraction kit. 3. Applicable only for ZFAs containing 2F-modules with a QRG cap (see Tables 2 and 3): The RSD cap is replaced with a QRG cap on the desired 2F-modules with one or two additional amplification steps. Use 1–5 ng of the gel-purified 2F-module (from step 2) and perform PCR as in step 1 using the primers described in Table 3. Then gel-extract the amplified DNA as in step 2 and proceed to the next step. Repeat this step for the assemblies that require two amplification steps. 4. ZFA assembly via overlapping PCR: Following gel extraction of each individual module, use the desired primers (Table 3) and perform overlapping PCR to assemble each ZFA as follows: PCR conditions

Cycling

Each 1F-module, PCR amplified 5 ng

98 °C for 3 min

Each 2F-module, PCR amplified 10 ng

98 °C for 15 s

5× Phusion Buffer 5 μL

50 °C for 15 s. 6 Repeats

10 mM dNTPs 0.5 μL

72 °C for 30 s (without primers)

50 μM Forward Primer 0.5 μL

72 °C for 5 min

50 μM Reverse Primer 0.5 μL

Add forward and reverse primers

Phusion enzyme (2 U/μL) 0.25 μL

98 °C for 3 min

Add water to make volume to 25 μL

98 °C for 15 s (continued)

Site-Specific Artificial Nucleases

PCR conditions

281

Cycling 56 °C for 15 s. 25 Repeats 72 °C for 30 s 72 °C for 5 min Hold at 4 °C

5. Following PCR, run products on 2% agarose gel. Slice the gel to recover the amplicons of the desired size (~270 bp for 3F-ZFA and ~360 bp for 4F-ZFA), extract DNA using Qiagen Gel Extraction kit, elute with 30 μL elution buffer and quantify either using a UV spectrophotometer or by running on a 2% agarose gel alongside a standard DNA ladder. 6. Applicable only for ZFNs containing a 7-bp spacer between the two ZFA half-sites: Re-amplify the gel-extracted PCR product with the primers described in Table 3. PCR conditions

Cycling

Assembled ZFA from step 8 10 ng 5× Phusion Buffer 5 μL 10 mM dNTPs 0.5 μL

98 °C for 3 min

50 μM Forward Primer 0.5 μL 50 μM Reverse Primer 0.5 μL Phusion enzyme (2 U/μL) 0.25 μL

98 °C for 15 s 50 °C for 15 s. 6 Repeats 72 °C for 30 s

Add water to make volume to 25 μL

98 °C for 15 s 56 °C for 15 s. 24 Repeats 72 °C for 15 s 72 °C for 5 min Hold at 4 °C

Following PCR, run products on 2% agarose gel. Slice the gel to recover the amplicons of the desired size (~270 bp for 3F-ZFA and ~360 bp for 4F-ZFA), extract DNA using Qiagen Gel Extraction kit and elute with 30 μL elution buffer and quantify either using a UV spectrophotometer or by running on a 2% agarose gel alongside a standard DNA ladder. 7. Digest the assembled ZFAs with Acc65I and BamHI enzymes: DNA (250–500 ng): 30 μL. 10× NEBuffer 3: 5 μL. 10× BSA: 5 μL. BamHI enzyme (20 U/μL): 1 μL. Acc65I enzyme (10 U/μL): 2 μL.

282

Fatma O. Kok et al.

Water: 7 μL. Incubate the reaction for 1 h at 37 °C. 8. Purify the digestion reaction using Qiaquick PCR purification kit and elute in 30 μL elution buffer. Quantify DNA either using a UV spectrophotometer or by running on a 2% agarose gel alongside a standard DNA ladder. 3.1.2 Cloning ZFAs into Desired Backbone

The backbone for cloning ZFAs should be chosen based on the intended use of ZFNs. For use in zebrafish, we employ a modified pCS2 backbone containing the obligate heterodimeric versions (DD and RR) of the FokI nuclease domain (available from Addgene) [2–4] (see Note 1). 1. Prep the two plasmids (Addgene plasmid 18755: pCS2-FlagTTGZFP-FokI-DD and Addgene plasmid 18754: pCS2-HAGAAZFP-FokI-RR) containing the nuclease domains and digest 2 μg of each plasmid with Acc65I and BamHI. Plasmid DNA (2 µg): x µL. 10× NEBuffer 3: 5 µL. 10× BSA: 5 µL. BamHI enzyme (20 U/µL): 1 µL. Acc65I enzyme (10 U/µL): 2 µL. Total (with ddH2O): 50 µL. Incubate the reaction for 2 h at 37 °C. 2. Run products on 1% agarose gel. Slice the gel to recover cut backbone of the desired size (4,758 bp for the DD version and 4,788 bp for the RR version) and extract DNA using the Qiagen Gel Extraction kit, elute with 50 μL elution buffer and quantify either using a UV spectrophotometer or by running on a 2% agarose gel alongside a standard DNA ladder. 3. Ligate the assembled ZFAs into the backbone. To simplify cataloging each ZFN pair, we always clone the 5pZFA into the DD version of the backbone and the 3pZFA into the RR version. Acc65I/BamHI cut Backbone (DD or RR) (20 ng): x µL. Acc65I/BamHI cut ZFA PCR product (5p or 3p) (20 ng): yµL. 10× T4 DNA Ligase buffer: 1 µL. T4 DNA ligase enzyme (400 U/µL): 0.5 µL. Total (with ddH2O): 10 μL. Incubate at room temperature (22 °C) for 30 min. Note: if ZFAs (cloned in generic vectors) are obtained through gene synthesis, perform step 1 on the ZFA plasmids and in step 2 gel-extract ZFAs (270 bp for 3-finger ZFA and 360 bp for 4-figner ZFAs). Perform ligations where the gel-extracted ZFAs replace the PCR amplified ZFAs.

Site-Specific Artificial Nucleases

283

4. Transform the ligation mix into 50 μL chemically competent or electro-competent XL1-blue E. coli cells or any other bacterial strain preferably lacking endA1 and recA1 genes. Following heat shock or electroporation, recover cells in 200 μL SOC medium for 1 h at 37 °C. After recovery, plate 100 μL cells on 2xYT (or LB) plate containing 50 μg/mL ampicillin and incubate 12–14 h at 37 °C. Note: perform a “no insert” ligation control (without the ZFA insert) for each backbone to estimate the background due to vector re-closure. 5. Next day, perform colony PCR with SP6long forward primer and PCS2Fok1Rev reverse primer as follows: PCR conditions

Cycling

Transformant Colony 10× Taq ThermoPol Buffer 2 μL 10 mM dNTPs 0.4 μL

95 °C for 3 min

50 μM SP6long Primer 0.2 μL 50 μM PCS2Fok1Rev Primer 0.2 μL Taq Polymerase (5 U/μL) 0.2 μL

94 °C for 15 s 56 °C for 15 s. 34 Repeats

Add water to make volume to 20 μL

72 °C for 30 s 72 °C for 5 min Hold at 4 °C

Run 3 μL of the PCR reaction on a 2% agarose gel. Expected sizes: 3-finger ZFA: 494 bp. 4-finger ZFA: 580 bp. Self-ligation due to single enzyme digest or failure of enzyme digestion: 494 bp. Note: After using the bacterial colony for the PCR, streak the colony on a fresh 2xYT (or LB) plate containing 50 μg/mL ampicillin to regrow the transformants (keep track of which colony was used as a template for each PCR reaction). 6. Grow 2–8 positive transformants overnight in 2xYT medium with ampicillin. Isolate plasmid the next day and sequence using the SP6long primer to confirm the positive clones containing the desired ZFNs. Typically we get 2–3 positive clones out of every four transformants screened, but the success rate may vary for different assemblies. 3.1.3 Preparing ZFN mRNA for Injection into Zebrafish Embryos

We use the mMessage mMachine SP6 kit (Life Technologies/ Ambion) for transcribing mRNA in vitro. Since the pCS2 vectors contain a polyadenylation signal, poly-A tailing the mRNA is not necessary. When generating mRNA, we perform “half reactions”

284

Fatma O. Kok et al.

with the mMessage mMachine kit that provides ~10–15 μg mRNA which is sufficient for routine ZFN injections for gene disruption. Note: When preparing mRNA, make sure all the reagents and surfaces are RNase free. 1. Digest the two ZFN monomer containing plasmids with NotI-HF enzyme. Confirm that the ZFN sequence lacks a NotI restriction site if any modifications have been made to our standard assembly system. DNA (4 μg): x µL. 10× NEBuffer 4: 5 µL. 10× BSA: 5 µL. NotI-HF enzyme (20 U/µL): 2 µL. Total (with ddH2O): 50 μL. Incubate the reaction for 3 h at 37 °C. 2. Run 2 μL of the digestion reaction on 1% agarose gel to confirm complete linearization of the plasmid. 3. Add 62 μL nuclease-free water to the remaining 38 μL digestion reaction. Add an equal volume (100 μL) of phenol/chloroform/isoamyl alcohol mixture (25:24:1), vortex for 10 s. (WARNING: use proper safety precautions when handling phenol-containing solutions.) Centrifuge for 3 min at 20,000 × g and collect the aqueous layer containing the DNA to another tube. To the extracted DNA, add 10% volume of 3 M sodium acetate solution (pH 5.2) and 2.5 volumes of 100% ethanol and place the mixture at −20 °C for 1 h (see Note 2). Centrifuge the DNA for 20 min at 20,000 × g, remove ethanol, and wash the DNA pellet with ice-cold 70% ethanol. Air dry the DNA pellet. Resuspend the precipitated DNA in 12 μL water, quantify the DNA concentration using a UV spectrophotometer and run 1 μL on 1% agarose gel alongside a DNA ladder to confirm the DNA quantity. 4. Set up the in vitro transcription reactions with 500–700 ng of NotI cut plasmid and half the volumes suggested by the mMessage mMachine kit. DNA (500–700 ng): x µL. 10× SP6 Reaction Buffer: 1 µL. 2× NTP/CAP: 5 µL. SP6 enzyme: 1 µL. Total (with RNase-free ddH2O): 10 μL. Incubate the reaction for 2.5 h at 37 °C. 5. Add 0.5 μL TURBO DNase included in the kit to the transcription reaction, mix and incubate at 37 °C for 15 min.

Site-Specific Artificial Nucleases

285

6. Stop the reaction by adding 10 μL ammonium acetate stop solution provided with the kit. 7. Add 85 μL nuclease-free water and save 5 μL for running on agarose gel. 8. To the remaining 100 μL of mRNA reaction, add 100 μL of phenol/chloroform/isoamyl alcohol mixture (25:24:1), vortex for 10 s, centrifuge for 3 min at 20,000 × g, and separate the aqueous layer. To the extracted mRNA, add equal volume (roughly 100 μL) of 100% isopropanol and mix well. Chill the mixture for 1 h (can be kept longer if needed) at −20 °C, then centrifuge for 15 min at 20,000 × g. Remove the isopropanol and wash with 70% ethanol. Air dry the pellet and resuspend in 25 μL nuclease-free water. 9. Run 1 μL of the resuspended mRNA on a 1.5% agarose gel. Also run the 5 μL of the mRNA retained prior to the phenol/ chloroform extraction. The length of mRNA is approximately 1,260 bases and runs on an agarose gel with a mobility of approximately 750 bp relative to a DNA ladder. High-quality RNA should run predominantly as a band, whereas degraded RNA runs as a smear on gel and should not be used for injections. Dilute RNA to 250 ng/μL and store RNA at −80 °C. For simplicity, 5pZFA and 3pZFA RNAs can be mixed at the desired ratio (typically 1:1) and aliquoted at the concentrations desired for injections and stored at −80 °C. Note: for routine mRNA quality analysis, we do not run a denaturing gel but this can be done if needed. 3.2 Assembling TALE Nucleases Using Golden Gate Assembly Method

Similar to ZFNs, TALENs with novel DNA-binding specificity can be constructed by creating an array of specific repeat modules in a sequential order according to the target sequence. Although modules can be put together with sequential ligation steps or FLASH (fast ligation-based automatable solid-phase highthroughput) system [8–11], the Golden Gate assembly method, as pioneered by the Voytas and Marillonnet laboratories [7, 12–15] provides a more rapid and straightforward construction approach for small-scale construction efforts. The following protocol describes the generation of TALE arrays using the Voytas lab modules (available thru Addgene) and construction approach, along with a modified vector we have constructed to improve the efficiency of the TALEN activity in zebrafish.

3.2.1 Assembly of Repeat Modules into Site-Specific TALEN Constructs Using Golden Gate Assembly Method

In a typical TAL effector structure, DNA recognition is mediated by the central domain, which consists of repeating 33–35 amino acidlong units [16]. The number of those repeating units can vary from 1.5 to 33.5, last module being a truncated half-repeat [17, 18]. In each unit, two adjacent residues at positions 12 and 13, called “repeat-variable di-residue” (RVD) [19], determine the target

286

Fatma O. Kok et al.

preference of the unit. Typically, the four most common RVDs, NN, NI, NG, and HD, selectively bind guanine, adenine, thymine, and cytosine, respectively [19, 20]. Since each repeating unit recognizes one target nucleotide, permutation of repeating units can be generated to target any specific sequence in the genome. X-ray crystallographic examination of TAL effector-DNA complexes reveals very regular DNA-binding interactions by RVDs implying modularity [21, 22]. The extent to which adjacent modules influence the recognition of their neighbors is unknown, but is likely to be modest in most instances. Presence of a flanking 5′-T by the first target nucleotide is the only criteria for a TALEN binding “half-site” as reflected by naturally occurring TAL effector binding sites [7, 19, 20]. Golden Gate (GG) assembly is a novel digestion–ligation method used to combine several DNA fragments simultaneously in a systematic manner in one tube [13–15]. The Golden Gate TALEN and TAL Effector Kit [7] (Addgene) rely on digestion by type IIS restriction enzymes to generate unique four nucleotide overhangs for each module and the subsequent ordered ligation of each module into specific arrays. Since each coupled digestion– ligation reaction produce “dead-end” products that lack an enzyme recognition site, the appropriately assembled product is resistant to cleavage by the endonucleases, and consequently the whole assembly can be performed in one tube. The assembly of TALENs is accomplished in two consecutive steps. First, individual modules are assembled into two (or three) intermediate vectors. Then, these “sub-arrays” are joined into final expression vectors to form fully functioning TALEN arrays. Assembly of Individual Modules into Intermediate Vectors

1. Identify potential TALEN target sites for gene of interest. There are several useful search tools for TALEN target site selection. Two of the widely used programs are as follows: (a) TAL Effector-Nucleotide Targeter Tool [7, 23]: https://boglab.plp.iastate.edu/ With this tool, all potential targets are listed against a maximum of 5,000 bp of interest. A number of constraints can be applied on targeting site architecture. (b) ZiFiT Targeter [9]: http://zifit.partners.org/ZiFiT This simple tool allows users to design TALENs to target a specific nucleotide in the gene of interest. Follow the guidelines described below to identify a good TALEN target site: ●

Each target site must be preceded by a 5′-T, but this base should not be considered as part of the monomers that are assembled for DNA recognition, as specificity for the 5′-T

Site-Specific Artificial Nucleases

287

is mediated by domains in the constant N-terminal sequence of the TALE framework [21, 22]. ●

Although several groups reported different optimum target site architecture [7, 16, 24, 25], we have found that 15–19 residue-long “half-sites” flanking a 15–18 residuelong spacer can be successfully targeted by TALENs with minimal toxicity.

●

Targeting TALENs to the 5′ half of the gene maximizes the possibility of generating a null allele by inducing nonsense lesions.

●

If possible, select a target site with a robust restriction enzyme recognition site in its spacer that is unique within the local 200 bp region (see Subheading 3.3).

2. Determine the RVD array corresponding to the target “halfsite” nucleotide sequence. 3. Separate each RVD array into blocks of 10 units (see Note 3). 4. Determine the module plasmids that encode the RVD unit for each position in each array. In Golden Gate TALEN and TAL Effector Kit, there are 50 individual modules encoding five different RVDs NN, NI, NG, NK, and HD, selectively binding to G, A, T, G/A, and C, respectively, for ten different positions. Although modules encoding NK usually associate with G, in many contexts TALENs containing these modules display poor activity [16, 26]. Therefore, the NK module should not be used in the assembly. Instead, NN modules should be used when targeting G. The number followed by the RVD name indicates the position of the module that can be used in the assembly. Choose each individual module plasmid according to its encoding RVD first, then the position. For example, if the first RVD in the set is NN, choose pNN1; if the second RVD in the set is HD, choose pHD2, etc. The similar approach should be applied to other sets. The 11th residue, the first residue of the second set, should be targeted by the “module plasmid 1”, say pNG1; 12th residue should be targeted by “module plasmid 2”, etc. 5. Determine which intermediate vectors should be used for the first part of the assembly. If there are two arrays of RVDs (i.e., if “half-site” is ≤21 residues). First set should be assembled into pFUS_A. Second set should be assembled into pFUS_B. There are ten different pFUS_B plasmids, numbered 1–10. The number of modules present in the second set of TALEs define which pFUS_B

288

Fatma O. Kok et al.

vector will be used. For example, if there are six RVDs in the second set, the pFUS_B6 intermediate vector should be used. If there are three arrays of RVDs (i.e., if the “half-site” is >21 residues). First set should be assembled into pFUS_A30A. Second set should be assembled into pFUS_A30B. Third set should be assembled into pFUS_B. Again, the number of the RVDs present in the third set determine which pFUS_B vector should be selected. For example, if there are five RVDs in the third set, pFUS_B5 intermediate vector should be used. 6. Mix first Golden Gate (GG) reaction for each set in a PCR compatible tube: (a) 150 ng of each module vector. (b) 150 ng of pFUS intermediate vector. (c) 2 µL 10× DNA ligase buffer. (d) 1 µL T4 DNA ligase (400 U). (e) 1 µL BsaI-HF™ (20 U). (f) Final volume to 20 µL. 7. In a thermocycler run ten cycles alternating reaction temperature (37 °C for 5 min; 16 °C for 10 min). Digest the leftover vectors which still contain BsaI site at 50 °C for 5 min and then inactivate the enzymes at 80 °C for 5 min. 8. Add to each GG reaction: (a) 1 µL 25 mM ATP. (b) 1 µL plasmid safe nuclease (10 U). (c) Incubate at 37 °C for 1 h. This step is extremely important to eliminate the incomplete ligation reactions and partial arrays before transformation. Otherwise these products can be recombined into the intermediate vector in vivo by E. coli repair machinery creating a background of improperly assembled products. 9. Transform 5 µL of the GG reaction into 50 µL of chemically competent TOP10 cells. 10. Plate on LB/Agar plates containing 50 µg/mL spectinomycin with X-Gal (40 µg/mL) for blue-white screen to identify plasmids containing the desired insert (see Note 4). 11. Incubate plates in dark at 37 °C for 12–14 h. 12. Next day, perform colony-based PCR screening for the desired insert with primers pCR8_F1 and pCR8_R1 to identify positive pFUS clones.

Site-Specific Artificial Nucleases

289

(a) With a sterile pipet tip, pick 3–5 white colonies from each plate and resuspend each individually in 15 µL sterile water in a 12-well strip tube. Store the tubes at 4 °C. (b) Prepare PCR mastermix solution: ●

15.6 μL H2O.

●

2 μL 10× reaction buffer.

●

0.4 μL 10 mM dNTP mix.

●

0.4 μL primer pCR8_F1.

●

0.4 μL primer pCR8_R1.

●

0.1 μL HotMaster Taq (0.5 U).

(c) Add 1 μL colony suspension to 19 μL PCR mastermix. (d) Use the following PCR cycling condition. a. 98 °C for 5 min. b. 96 °C for 30 s. c. 55 °C for 30 s. d. 72 °C for 90 s. e. Cycle steps b–d 35×. f.

72 °C for 10 min.

13. Run the entire PCR reaction on a 1.5% agarose gel. Identify the size of the amplicons carefully relative to an appropriate ladder such as 2-Log DNA ladder. Determine the colonies that amplify fragments with expected size (see Table 4 and Note 5). Since amplified fragments consist of highly repetitive modules, during PCR, incompletely extended products in each cycle can act as primers in the subsequent amplification at a different array position. Thus, besides correctly sized amplicon, there will be “laddering” of bands every ~100 bp starting from ~200 bp. Presence of “laddering” is usually the indication of a correct clone (Fig. 3a). 14. Grow 3–5 μL of the suspended bacteria (from step 12a), which potentially contains the correctly assembled arrays, in 2 mL LB + 50 μg/mL spectinomycin at 37 °C for 12–14 h. 15. Miniprep pFUS_A (or pFUS_A30A, pFUS_A30B) and pFUS_B plasmids containing TALE arrays using QIAprep Spin Miniprep Kit (Qiagen). 16. Cut ~1 μg of candidate intermediate vectors with AflII and XbaI. (a) 2 μL 10× Buffer 4. (b) 0.2 µL 100× BSA. (c) 0.2 µL XbaI (4 U). (d) 0.2 µL AflII (4 U).

290

Fatma O. Kok et al.

Table 4 Expected fragment sizes for TALENs with different number of repeats Expected colony PCR fragment size

Vector pFUS_A, pFUS_A30A, pFUS_A30B (empty)

773

pFUS_A, pFUS_A30A, pFUS_A30B + 10 repeats

1,284

Expected AflII and XbaI restriction digest 572 1,083

pFUS_B (empty)

738

530–590

pFUS_B1 + 1 repeat

376

176

pFUS_B2 + 2 repeat

473

273

pFUS_B3 + 3 repeat

570

370

pFUS_B4 + 4 repeat

667

467

pFUS_B5 + 5 repeat

764

567

pFUS_B6 + 6 repeat

861

661

pFUS_B7 + 7 repeat

958

758

pFUS_B8 + 8 repeat

1,055

855

pFUS_B9 + 9 repeat

1,152

952

pFUS_B10 + 10 repeat

1,249

1,049

GG JDS70, JDS71, JDS74, JDS78 (empty)

272

GG JDS + 15 repeat

1,696

GG JDS + 16 repeat

1,793

GG JDS + 17 repeat

1,890

GG JDS + 18 repeat

1,987

GG JDS + 19 repeat

2,084

Expected fragment sizes for pFUS_A (pFUS_A30A, pFUS_A30B) and pFUS_B intermediate vector colony screen using pCR8_F1 and pCR8_R1 primers (column 2, rows 2–14) Expected fragment sizes for GG JDS70, 71, 74, 78 final destination vector upon colony PCR screening using GG_JDS_screen_F and GG_JDS_screen_R primers (column 2, rows 15–20) Expected fragment sized for pFUS_A (pFUS_A30A, pFUS_A30B) and pFUS_B intermediate vector restriction enzyme analysis with AflII and XbaI (column 3, rows 2–14). All sizes are approximate

(e) 1 µg candidate vector. (f) Final volume to 20 µL. (g) Incubate at 37 °C for 1 h. 17. Run whole restriction enzyme reaction on a 1.5% agarose gel. XbaI and AflII will cleave out the repeat array from the vector. A correct pFUS_A clone will display a 1,048 bp band, while the correct pFUS_B clone will display a size that is dependent

Site-Specific Artificial Nucleases

291

Fig. 3 Colony PCR screen of (a) intermediate vectors pFUS_A and pFUS_B; (b) final destination vector GG JDS. (a) Lanes 1–4 are PCR products from pFUS_A-containing colonies from and lanes 6–9 are from pFUS_B7-containing colonies. Lane 1 represents a empty pFUS_A vector. All other lanes represent clones of the correct size. Lane 5 is NEB 2-Log ladder. (b) Lanes 2–3 and 4–5 are colonies from final destination vector GG JDS70 and GG JDS78, respectively. Both vectors contain 16.5 repeating modules. All lanes represent of the correct size. Lane 1 is NEB 2-Log ladder. Smearing and laddering is evident in amplification products in correctly assembled arrays

on the number of the modules used to assemble the repeating arrays (Table 4). 18. (Optional) In addition to colony screen and restriction enzyme analysis, intermediate vectors with the repeating arrays can be sequence confirmed using primers pCR8_F1 and pCR8_R1. Colony PCR/restriction enzyme/sequence confirmed intermediate vectors are used in the final construct assembly into the destination vectors described in the next section. Assembly of Intermediate Arrays into Final Expression Vector

There are several useful final destination vectors in Golden Gate TALEN and TAL Effector Kit [7]. These vectors allow researchers to assemble the final repeating arrays into TALENs (or TAL effectors), which can then be expressed in different organisms. These backbones, specifically pTAL3 and pTAL4, can be used as sub-cloning vectors to transfer TALENs into widely used zebrafish expression vector pCS2+. However, in our experience, overall activity of the TALENs in zebrafish was extremely low, although the same TALEN architecture is shown to induce mutations in plant and human genes [7]. Other laboratories [9–11, 16, 27–29] demonstrated that TALENs with slightly different backbone architectures (shorter C-terminal linker/effector) have increased activity. Thus, we changed the overall architecture of the final backbone of the Golden Gate system. Since JDS vectors [9] from Joung Lab REAL Assembly TALEN Kit (Addgene) were highly active in zebrafish, we utilized the architecture from JDS vectors. To make JDS vectors compatible with the Voytas lab Golden Gate kit, the overhangs generated by Esp3I cleavage sites in the JDS vectors were adjusted to GGGA/

292

Fatma O. Kok et al.

CTAT to ensure proper complementarity between intermediate vectors and the final vector. Moreover, since JDS vectors already have the last half repeat incorporated into the backbone (there are four different vectors, one for each base), we modified each JDS vector to match the reading frame of the Golden Gate assembled intermediate arrays. These vectors contain the wild-type FokI nuclease domain. We have used these Golden Gate compatible JDS vectors many times to make TALENs and they are extremely active in zebrafish. Golden Gate compatible JDS vectors are now available through Addgene (#44713, #44714, #44715, #44716). 1. Determine the appropriate Golden Gate compatible JDS vector that should be used for final assembly. There are four alternative clones to choose from and selection should be based on the last RVD of the target “half-site.” If the last repeat is “NI,” use GG JDS70 (Addgene #44713). If the last repeat is “HD,” use GG JDS71 (Addgene #44714). If the last repeat is “NN,” use GG JDS74 (Addgene #44715). If the last repeat is “NG,” use GG JDS78 (Addgene #44716). 2. Setup second Golden Gate reaction for each “half site” in a PCR compatible tube: (a) 150 ng of each pFUS_A (pFUS_A30A, pFUS_A30B) and pFUS_B. (b) 75 ng of the appropriate GG JDS vector. (c) 2 µL 10× DNA ligase buffer. (d) 1 µL T4 DNA ligase (400 U). (e) 1 µL Esp3I (10 U). (f) Final volume to 20 μL. Unlike the original protocol described for Golden Gate assembly for TALENs [7], “pLR vectors,” which contains the “last half-repeat module,” should not be utilized in this modified protocol. Golden Gate compatible JDS vectors already have the “last half-repeat module” incorporated into its structure. 3. In a thermocycler, run ten cycles of (37 °C for 5 min; 16 °C for 10 min). Incubate reaction an additional 15 min at 37 °C to eliminate leftover vectors with Esp3I site. Inactivate at 80 °C for 5 min. 4. Transform 5 μL of the GG reaction into 50 μL of chemically competent TOP10 cells. 5. Plate on LB/Agar plates containing 100 μg/mL ampicillin. Efficiency of this reaction is extremely high. Plate only 1/5th of the transformation reaction to ensure that distinct colonies grow on the plate the following day.

Site-Specific Artificial Nucleases

293

6. Incubate plates at 37 °C for 12–14 h. 7. Next day, pick 3–5 colonies from each plate and perform colony PCR, as explained in Subheading 3.2.1.1, step 12a–c, with primers GG_JDS_screen_F and GG_JDS_screen_R to screen for positive GG JDS clones. PCR cycling condition is as follows: (a) 98 °C for 5 min. (b) 96 °C for 30 s. (c) 55 °C for 30 s. (d) 72 °C for 3 min. (e) Cycle steps b–d 35×. (f) 72 °C for 10 min. 8. Run PCR reaction on a 0.8% agarose gel. Typically, a properly assembled GG JDS vector with >15 modules should produce a sharp band around 1.5–2 kb with extra laddering of bands every 100 bp starting from 250 bp. Presence of “smearing/laddering” is usually an indication of the correct clone (Fig. 3b, Table 4). 9. Grow potential candidates in 2 mL LB + 100 μg/mL ampicillin at 37 °C for 12–14 h (see Note 6). 10. Miniprep final GG JDS vectors using QIAprep Spin Miniprep Kit (Qiagen). 11. Sequence confirm the final expression vector using GG_JDS_ screen_F and GG_JDS_screen_R primers (see Note 7). Preparation of TALENEncoding RNAs

1. Linearize ~2 μg of sequence confirmed TALEN expression vector with PmeI. (a) 2 μL 10× NEBuffer 4. (b) 0.2 μL 100× BSA. (c) 0.5 μL PmeI (5 U). (d) 2 μg of TALEN vector. (e) Final volume to 20 μL. (f) Incubate at 37 °C for at least 2 h. 2. Run 1 μL of the reaction on a 0.8% agarose gel to confirm complete linearization. 3. Purify remainder of the linearized plasmid by phenol/chloroform extraction. Measure the DNA concentration using Nanodrop. At this point, extreme care should be taken to ensure work surfaces and materials are RNase free for remainder of the RNA synthesis procedure. 4. Transcribe RNA using mMessage mMachine T7 Ultra kit. Reaction volume recommended by the manufacturer can be scaled down to 10 μL. Mix the following in the given order:

294

Fatma O. Kok et al.

(a) x μL H2O (to 10 µL final volume). (b) 5 µL 2× NTP/ARCA. (c) 1 µL 10× T7 reaction buffer. (d) 1 µL T7 enzyme mix. (e) 0.5 µg linearized TALEN plasmid. (f) Incubate at 37 °C for 3 h. 5. Add 0.5 μL TURBO DNase provided in the kit. Incubate @37 °C for 15 min. 6. Perform A-tailing reaction using components of the kit. Save 0.5 μL of transcription reaction as untailed control for comparison. Mix the following components in the given order: (a) 18 µL H2O. (b) 10 µL 5× E-PAP buffer. (c) 5 µL 25 mM MnCl2. (d) 5 µL 25 mM ATP. (e) 2 µL E-PAP. (f) 20 µL transcription reaction from step 4. (g) Incubate at 37 °C for 30 min. 7. Stop the reaction with 10 μL Ammonium acetate stop solution. Clean transcribed RNA using phenol/chloroform extraction followed by isopropanol precipitation. 8. Run 0.5 μg of cleaned RNA on a 1.5% agarose gel. Injection quality RNA should exhibit a single distinct band with minimal smearing. The control sample saved at step 6 should also be run to confirm successful A-tailing reaction. RNA with poly-A tail will migrate slower on the gel. 9. Store RNA at −80 °C in 1 μL aliquots at a concentration of 0.5 μg/μL. 3.3 Detecting Somatic Lesions Induced by ZFN/ TALENs in Zebrafish

The basic experimental design used to study the genomic lesions induced by both ZFNs and TALENs are very similar and straightforward. Simply, ZFNs or TALENs are injected into onecell stage embryos, which are then screened for genomic disruptions by either restriction enzyme or Surveyor Nuclease assays. One slight difference between ZFN and TALEN injections is that TALENs typically can be injected at higher doses due to their low toxicity ([9] and our unpublished observations) even with wildtype FokI nuclease domains. 1. Set up multiple tanks of wild-type (or the desired genetic background) zebrafish crosses with dividers for breeding the day before the injection.

Site-Specific Artificial Nucleases

295

2. Collect embryos 5–10 min after dividers are removed. Transfer ~50 embryos to the pre-warmed injection ramp using polystyrene transfer pipette. Align the embryos in the injection ramp channels blastomere side up. 3. Inject ~2 nL of mRNA into each zebrafish embryo [30]. Save some uninjected embryos as control. It is extremely important to inject the mRNA into the cell directly at early one-cell stage to get a high frequency of germ line mutations. Inject 2–3 different concentrations (low/mid/high) of ZFN RNA to determine the optimal dose for mutagenesis. The optimal dose is typically the dose that causes lethality and abnormal development in 50% of the embryos. However, TALENs are usually less toxic than ZFNs. Therefore, most of the TALEN RNA-injected embryos will develop normally, even at high doses. For TALEN injections, the optimal dose, minimum amount of RNA that still induces somatic lesions, should be determined empirically. 4. Grow both injected and uninjected embryos at 28.5 °C in egg–water. Check embryos several hours after injection. Remove unfertilized, abnormal, and dead embryos from the plate. 5. ~24–26 h after injection, count and remove dead embryos. Separate abnormal embryos with developmental defects (“deformed”) from the normal looking embryos. Record the number of embryos in each group. 6. Collect 15–20 embryos from “deformed” and normal group as well as uninjected clutch into separate microcentrifuge tubes. 7. Isolate genomic DNA as follows: (a) Remove as much egg–water as possible around the embryos. (b) Add 100 μL of lysis buffer-containing Proteinase K at a final concentration of 1 mg/mL. (c) Incubate at 55 °C for 2–3 h, vortexing the tubes occasionally. (d) Incubate at 98 °C for 10 min to inactivate Proteinase K. (e) Use 1–1.5 μL of the crude lysate as PCR template. 8. Amplify the genomic region (~200 bp) containing the ZFN/ TALEN target site using gene specific primers, which flank the target site, by PCR. 9. Run 3 μL of the amplification product on a 1% agarose gel to confirm successful amplification. 10. (a) If there is a convenient restriction enzyme site that coincides with the spacer region between the ZFN/TALEN binding sites that is unique within the PCR amplicon:

296

Fatma O. Kok et al. ●

Digest the PCR product for the ZFN/TALEN-treated embryos as well as the uninjected control with the restriction enzyme: –

2 μL 10× NEBuffer.

–

0.2 μL 100× BSA.

–

5 U Restriction enzyme.

–

10 μL of PCR reaction.

–

Final volume to 20 μL.

–

Incubate at appropriate temperature for the enzyme overnight.

●

Run on a 3% agarose gel. Include a negative “uncut” control in the assay for size reference. Compare the restriction fragments between amplicons from uninjected and injected embryos.

●

PCR product amplified from uninjected control should be completely digested by the restriction enzyme. By contrast, if there are lesions induced by the nuclease, PCR products from the injected embryos will not be cleaved completely due to disruption of the restriction enzyme site at the target (Fig. 4a, b).

(b) If there is no restriction enzyme site that overlaps with the spacer, use the Surveyor Mutation Detection Kit (Transgenomic) to detect the lesions induced by nucleases. ●

●

●

Make sure PCR amplification is performed with a Surveyor Mutation Detection Kit compatible polymerase (see Appendix E in Kit manual). 10 μL of the PCR product is denatured and re-annealed (to itself) according to Kit manual. Assay the DNA for heterogeneity. Add: –

1 μL Surveyor Enhancer S.

–

1 μL Surveyor Nuclease S.

–

1 μL 0.15 M MgCl2 Solution.

–

Incubate at 42 °C for an hour.

●

Run on a 3.5% UltraPure™ Agarose-1000 gel.

●

Surveyor Nuclease will not digest the PCR product amplified from uninjected control. However, if there is a lesion induced by the ZFN/TALEN, PCR products from the injected embryos will be partially cleaved by Surveyor Nuclease due to mismatch formation at the target site (Fig. 4c).

11. Characterize the frequency and the nature of somatic mutations induced by ZFNs or TALENs by cloning mutated fragments into sequencing vector pGEM-T as follows.

Site-Specific Artificial Nucleases

297

Fig. 4 Restriction enzyme and Surveyor Nuclease analysis to identify lesion rates induced by ZFNs and TALENs. (a) Two sets of kdrl ZFNs [31] injected embryos are assayed using the restriction enzyme, NspI to assess the lesion frequency. The last lane displays uninjected (uncut) fragment size. The PCR product from the uninjected embryos is completely digested by NspI (lane 3). The fragments marked by arrows in the ZFN injected samples bear lesion at the target site, hence they are resistant to restriction enzyme digestion (lanes 1, 2). (b) klf2a TALENs are injected into two sets of embryos. PCR amplified fragments are digested with HpyCH4III to evaluate the lesion frequency. The uninjected amplicon is completely cleaved (lane 3), while a subset of PCR amplicons from TALEN injected embryos (arrow) are resistant to restriction enzyme digestion. (c) kdrl ZFN injected embryos are evaluated for genomic lesions by Surveyor Nuclease assay. Fragments indicated by arrow are produced by Surveyor Nuclease cleavage due to mismatch at the ZFN target site (lanes 1, 2). Surveyor Nuclease does not effect fragments amplified from uninjected embryos (lane 3)

Depending on the project we may only estimate lesion frequency by restriction digest assay without further analysis. (a) PCR amplify the genomic region that spans ZFN/TALEN target site as explained above in step 8 using gene-specific primers. Use a polymerase without 5′→3′ nuclease activity to ensure 3′-A overhangs in PCR amplified fragments. (b) Run the entire reaction on a 1.5% agarose gel. (c) Purify the bands using QIAquick Gel Extraction Kit (Qiagen). (d) Clone cleaned PCR amplified product in pGEM-T vector. ● 5 μL 2× Rapid ligation buffer. ●

1 μL pGEM-T vector.

●

3 μL Cleaned PCR product.

298

Fatma O. Kok et al. ●

1 μL T4 DNA ligase (400 U).

●

Incubate at room temperature for 1 h.

(e) Transform 1 µL of the ligation reaction into electro-competent TOP10 cells. (f) Plate on 100 µg/mL Amp plates supplemented with 40 µg/mL X-Gal. (g) Grow at 37 °C overnight. 12. Next day, pick 24–48 colonies and PCR screen as explained in Subheading 3.2.1.1, step 12a–c using gene-specific primers. 13. Run 3 µL of the reaction on a 1% agarose to confirm successful amplification. 14. Digest 10 μL of the amplification product with (a) target-specific restriction enzyme, or (b) Surveyor nuclease as explained in Subheading 3.3, step 10. In this case, mix equal amounts of amplification product with wild-type PCR product prior to denaturation/hybridization step. 15. Run the whole reaction on a 2.5% agarose gel. 16. Note number of clones that are not digested with restriction enzyme/digested with Surveyor Nuclease. Somatic lesion frequency (percentage) can be calculated using the following formula: Somatic lesion frequency = [# of “uncut” (restriction enzyme) or “cut” (Surveyor Nuclease) clones/# of clones with insert] × 100. 17. Grow several clones that contain a mutant sequence in 2 mL LB + 100 μg/mL at 37 °C, overnight. 18. Sequence plasmids with T7 or T3 primers. 19. Compare the mutation induced by ZFN/TALENs to the wildtype genomic sequence (Fig. 5). 20. If a high rate of somatic lesion is detected by restriction digestion or Surveyor Nuclease assay for a particular ZFN or TALEN set, raise nuclease-injected embryos to adulthood, generating P0 generation (see Note 8). 3.4 Identification of P0 Founders

1. Set up multiple individual crosses between mature P0 fish and a wild-type adult. Preferably, use an easily differentiated line such as a nonpigmented golden (gol ) or spotted WT-TL fish as wild-type mate. This enables easier separation between P0 and WT fish the following day. 2. Collect individual clutches of embryos in separate dishes. Place each P0 fish into ¾ L tank labeled with a number that matches to the number of the dish its offspring resides.

Site-Specific Artificial Nucleases

299

Fig. 5 Mutated alleles identified from sequence analysis of ZFN and TALEN injected embryos. A subset of somatic lesions observed in (a) kdrl ZFN and (b) kdrl TALEN injected embryos. (c) two distinct amot founders (ZFN injected) identified carrying 4 nt insertion and Δ14 nt deletion alleles, respectively. (d) flt4 TALEN injection leads to founders bearing multiple alleles. Alleles shown here are isolated from an individual founder. ZFN and TALEN target sites are underlined. Dashes indicate deleted bases

3. Let embryos grow until 24 hpf at 28.5 °C in egg–water. 4. Isolate genomic DNA from 30 to 100 embryos from each clutch, as explained in Subheading 3.3, step 7. If more than 50 embryos are assayed as a group, 200 μL of lysis buffer should be used. 5. Screen for lesions in the offspring as explained in Subheading 3.3, steps 8–10 to identify founders (see Note 9). 6. When a founder is identified, characterize the mutant allele(s) that are being transmitted (see Note 10). 7. To characterize the mutation induced by nucleases, clone the mutated genomic region into pGEM-T vector. (a) PCR amplify the genomic region that spans ZFN/TALEN target site using gene-specific primers using gDNA obtained in step 4. If pGEM-T vector (T/A cloning) is being employed, use a polymerase without 3′→5′ exonuclease activity. (b) Run the entire reaction on a 1.5% agarose gel. (c) Purify the correct-sized band using QIAquick Gel Extraction Kit (Qiagen). (d) Ligate the PCR amplified product with pGEM-T vector. ●

5 μL 2× Rapid ligation buffer.

●

1 μL pGEM-T vector.

300

Fatma O. Kok et al. ●

3 μL Cleaned PCR product.

●

1 μL T4 DNA ligase (400 U).

●

Incubate at room temperature for 1 h.

(e) Transform 1 μL of ligation reaction into electro-competent TOP10 cells. (f) Plate on 100 μg/mL Amp plates supplemented with 40 μg/mL X-Gal. (g) Grow at 37 °C overnight. 8. Next day, pick at least 48 colonies and PCR screen the colonies, as explained in Subheading 3.2.1.1, step 12a–c using genespecific primers. 9. Run 3 μL of the reaction on a 1% agarose gel to confirm successful amplification. 10. Digest 10 μL of amplification products with (1) target-specific restriction enzyme or (2) Surveyor Nuclease as explained in Subheading 3.3, step 10. If Surveyor Nuclease assay is used, amplification products from 6 to 8 colonies can be pooled before denaturation/ re-annealing step. 11. Run the entire reaction on a 2.5% agarose gel. 12. Grow at least four clones which contain a mutant sequence (i.e., did not digest with restriction enzyme) in 2 mL LB + 100 μg/mL Amp at 37 °C, overnight. If Surveyor Nuclease assay is used, grow individual clones from the pools that are digested by Surveyor Nuclease (see Note 11). 13. Miniprep plasmids that carry mutated DNA using QIAprep Spin Miniprep Kit (Qiagen). 14. Sequence plasmids with T7 or T3 primers. 15. Compare the mutation carried by the founder to the wild-type genomic sequence (Fig. 5). 16. Germ-line lesion frequency (percentage) can be calculated using the following formula: Germ-line lesion frequency = (#of mutant clones/# of clones with insert) × 100.

4

Notes 1. Both the WT (homodimeric) and other engineered obligate heterodimeric versions of the FokI nuclease domain are available and can be utilized depending on the requirements of the user. The terminal restriction enzyme sites can be altered in the final primer set used for overlapping PCR, if cloning the ZFA into another vector is desired.

Site-Specific Artificial Nucleases

301

2. Glycogen can also be added as a carrier to facilitate DNA precipitation. 3. For example, if the target “half-site” is 18 nucleotides long (not including the 5′ T), group 1st –10th RVD array into one set, 11th–17th RVD array into the second. The last RVD unit should not be included into either of the sets since this halfmodule is a component of the final destination vector. Similarly, if the target site is longer than 21 nucleotides, the RVD array should be grouped into three sets: 1st–10th residues into one set, 11th–20th into another set, and the remaining residues into the last set. Again, last the RVD unit should not be included into the final array. 4. Reaction efficiency is higher in GG reactions involving pFUS_B vector, which typically accommodates fewer modules. Only a fraction of the transformation reaction should be plated to ensure distinct colonies on the plate the next day. 5. Typically, a properly assembled pFUS_A vector with ten modules should generate an amplicon of ~1,200 bp, whereas pFUS_B clones will exhibit different sized amplicons, depending on the number of the modules used in the assembly. 6. It is important not to grow the bacteria more than 14 h. The presence of repeating modules in the final vector can generate recombination and rearrangement products in vivo if cultures grow too long. 7. It is important to sequence the final vector from both ends since sequencing from one end will not be enough to confirm the integrity of the entire assembly of RVD modules. 8. Typically, the frequency of the lesions induced by TALENs is higher than ZFNs. Therefore, we usually raise significantly fewer TALEN-injected embryos (~20–25 fish) than ZFNinjected embryos (~50–60 fish) to adulthood. 9. We typically identify at least two founders per ZFN/TALEN target site. 10. A good founder exhibits two qualities: High lesion frequency in germ cells (low mosaicism), and preferably carries one (and only one) null allele. Lesions inducing nonsense mutations generate a truncated protein and are usually considered to produce null alleles if the location of the lesion is early in the coding sequence. 11. Since TALENs are usually more active than ZFNs, in our experience, TALEN-injected fish typically carry more than one allele (Fig. 5). Note any variability in size of the amplified fragments from TALEN-injected founders. Grow and sequence all of the different sized clones, if necessary.

302

Fatma O. Kok et al.

References 1. Carroll D (2011) Genome engineering with zinc-finger nucleases. Genetics 188(4):773– 782. doi:10.1534/genetics.111.131433 2. Szczepek M, Brondani V, Buchel J, Serrano L, Segal DJ, Cathomen T (2007) Structurebased redesign of the dimerization interface reduces the toxicity of zinc-finger nucleases. Nat Biotechnol 25(7):786–793. doi:10.1038/ nbt1317 3. Miller JC, Holmes MC, Wang J, Guschin DY, Lee YL, Rupniewski I, Beausejour CM, Waite AJ, Wang NS, Kim KA, Gregory PD, Pabo CO, Rebar EJ (2007) An improved zinc-finger nuclease architecture for highly specific genome editing. Nat Biotechnol 25(7):778– 785. doi:10.1038/nbt1319 4. Doyon Y, Vo TD, Mendel MC, Greenberg SG, Wang J, Xia DF, Miller JC, Urnov FD, Gregory PD, Holmes MC (2011) Enhancing zincfinger-nuclease activity with improved obligate heterodimeric architectures. Nat Methods 8(1):74–79. doi:10.1038/nmeth.1539 5. Zhu C, Smith T, McNulty J, Rayla AL, Lakshmanan A, Siekmann AF, Buffardi M, Meng X, Shin J, Padmanabhan A, Cifuentes D, Giraldez AJ, Look AT, Epstein JA, Lawson ND, Wolfe SA (2011) Evaluation and application of modularly assembled zinc-finger nucleases in zebrafish. Development 138(20):4555–4564. doi:10.1242/dev.066779 6. Gupta A, Christensen RG, Rayla AL, Lakshmanan A, Stormo GD, Wolfe SA (2012) An optimized two-finger archive for ZFNmediated gene targeting. Nat Methods 9(6):588–590. doi:10.1038/nmeth.1994 7. Cermak T, Doyle EL, Christian M, Wang L, Zhang Y, Schmidt C, Baller JA, Somia NV, Bogdanove AJ, Voytas DF (2011) Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. Nucl Acid Res 39(12):e82. doi:10.1093/nar/gkr218 8. Huang P, Xiao A, Zhou M, Zhu Z, Lin S, Zhang B (2011) Heritable gene targeting in zebrafish using customized TALENs. Nat Biotechnol 29(8):699–700. doi:10.1038/ nbt.1939 9. Sander JD, Cade L, Khayter C, Reyon D, Peterson RT, Joung JK, Yeh JR (2011) Targeted gene disruption in somatic zebrafish cells using engineered TALENs. Nat Biotechnol 29(8):697–698. doi:10.1038/nbt.1934 10. Tesson L, Usal C, Menoret S, Leung E, Niles BJ, Remy S, Santiago Y, Vincent AI, Meng X,

11.

12.

13.

14.

15.

16.

17.

18.

19.

20.

Zhang L, Gregory PD, Anegon I, Cost GJ (2011) Knockout rats generated by embryo microinjection of TALENs. Nat Biotechnol 29(8):695–696. doi:10.1038/nbt.1940 Reyon D, Tsai SQ, Khayter C, Foden JA, Sander JD, Joung JK (2012) FLASH assembly of TALENs for high-throughput genome editing. Nat Biotechnol 30(5):460–465. doi:10.1038/nbt.2170 Weber E, Gruetzner R, Werner S, Engler C, Marillonnet S (2011) Assembly of designer TAL effectors by golden gate cloning. PLoS ONE 6(5):e19722. doi:10.1371/journal. pone.0019722 Engler C, Marillonnet S (2011) Generation of families of construct variants using golden gate shuffling. Methods Mol Biol 729:167–181. doi:10.1007/978-1-61779-065-2_11 Engler C, Kandzia R, Marillonnet S (2008) A one pot, one step, precision cloning method with high throughput capability. PLoS ONE 3(11):e3647. doi:10.1371/journal. pone.0003647 Engler C, Gruetzner R, Kandzia R, Marillonnet S (2009) Golden gate shuffling: a one-pot DNA shuffling method based on type IIs restriction enzymes. PLoS ONE 4(5):e5553. doi:10.1371/journal.pone.0005553 Miller JC, Tan S, Qiao G, Barlow KA, Wang J, Xia DF, Meng X, Paschon DE, Leung E, Hinkley SJ, Dulay GP, Hua KL, Ankoudinova I, Cost GJ, Urnov FD, Zhang HS, Holmes MC, Zhang L, Gregory PD, Rebar EJ (2011) A TALE nuclease architecture for efficient genome editing. Nat Biotechnol 29(2):143– 148. doi:10.1038/nbt.1755 Kay S, Bonas U (2009) How Xanthomonas type III effectors manipulate the host plant. Curr Opin Microbiol 12(1):37–43. doi:10.1016/j.mib.2008.12.006 Boch J, Bonas U (2010) Xanthomonas AvrBs3 family-type III effectors: discovery and function. Annu Rev Phytopathol 48:419–436. doi:10.1146/annurev-phyto-080508-081936 Moscou MJ, Bogdanove AJ (2009) A simple cipher governs DNA recognition by TAL effectors. Science 326(5959):1501. doi:10.1126/science.1178817 Boch J, Scholze H, Schornack S, Landgraf A, Hahn S, Kay S, Lahaye T, Nickstadt A, Bonas U (2009) Breaking the code of DNA binding specificity of TAL-type III effectors. Science 326(5959):1509–1512. doi:10.1126/ science.1178811

Site-Specific Artificial Nucleases 21. Deng D, Yan C, Pan X, Mahfouz M, Wang J, Zhu JK, Shi Y, Yan N (2012) Structural basis for sequence-specific recognition of DNA by TAL effectors. Science 335(6069):720–723. doi:10.1126/science.1215670 22. Mak AN, Bradley P, Cernadas RA, Bogdanove AJ, Stoddard BL (2012) The crystal structure of TAL effector PthXo1 bound to its DNA target. Science 335(6069):716–719. doi:10.1126/science.1216211 23. Doyle EL, Booher NJ, Standage DS, Voytas DF, Brendel VP, Vandyk JK, Bogdanove AJ (2012) TAL Effector-Nucleotide Targeter (TALE-NT) 2.0: tools for TAL effector design and target prediction. Nucl Acid Res 40(Web Server issue):W117–W122. doi:10.1093/ nar/gks608 24. Mussolino C, Morbitzer R, Lutge F, Dannemann N, Lahaye T, Cathomen T (2011) A novel TALE nuclease scaffold enables high genome editing activity in combination with low toxicity. Nucl Acid Res 39(21):9283– 9293. doi:10.1093/nar/gkr597 25. Mahfouz MM, Li L, Shamimuzzaman M, Wibowo A, Fang X, Zhu JK (2011) De novo-engineered transcription activator-like effector (TALE) hybrid nuclease with novel DNA binding specificity creates doublestrand breaks. Proc Natl Acad Sci USA 108(6):2623–2628. doi:10.1073/ pnas.1019533108 26. Christian ML, Demorest ZL, Starker CG, Osborn MJ, Nyquist MD, Zhang Y, Carlson DF, Bradley P, Bogdanove AJ, Voytas DF (2012) Targeting G with TAL effectors: a

27.

28.

29.

30.

31.

303

comparison of activities of TALENs constructed with NN and NK repeat variable di-residues. PLoS ONE 7(9):e45383. doi:10.1371/journal.pone.0045383 Hockemeyer D, Wang H, Kiani S, Lai CS, Gao Q, Cassady JP, Cost GJ, Zhang L, Santiago Y, Miller JC, Zeitler B, Cherone JM, Meng X, Hinkley SJ, Rebar EJ, Gregory PD, Urnov FD, Jaenisch R (2011) Genetic engineering of human pluripotent cells using TALE nucleases. Nat Biotechnol 29(8):731–734. doi:10.1038/nbt.1927 Wood AJ, Lo TW, Zeitler B, Pickle CS, Ralston EJ, Lee AH, Amora R, Miller JC, Leung E, Meng X, Zhang L, Rebar EJ, Gregory PD, Urnov FD, Meyer BJ (2011) Targeted genome editing across species using ZFNs and TALENs. Science 333(6040):307. doi:10.1126/science.1207773 Bedell VM, Wang Y, Campbell JM, Poshusta TL, Starker CG, Krug Ii RG, Tan W, Penheiter SG, Ma AC, Leung AY, Fahrenkrug SC, Carlson DF, Voytas DF, Clark KJ, Essner JJ, Ekker SC (2012) In vivo genome editing using a high-efficiency TALEN system. Nature 491:114–118. doi:10.1038/nature11537 Rosen JN, Sweeney MF, Mably JD (2009) Microinjection of zebrafish embryos to analyze gene function. J Vis Exp (25): 1115, DOI:10.3791/1115 Meng X, Noyes MB, Zhu LJ, Lawson ND, Wolfe SA (2008) Targeted gene inactivation in zebrafish using engineered zinc-finger nucleases. Nat Biotechnol 26(6):695–701. doi:10.1038/nbt1398