Original Article 357

Constitutional Mismatch Repair-deficiency and Whole-exome Sequencing as the Means of the Rapid Detection of the Causative MSH6 Defect

Authors

J. I. Hoell1, M. Gombert1, S. Ginzel1, S. Loth1, P. Landgraf1, V. Käfer1, M. Streiter2, A. Prokop2, M. Weiss2, R. Thiele3, A. Borkhardt1

Affiliations

Affiliation addresses are listed at the end of the article

Key words ▶ childhood cancer syndrome ● ▶ constitutional mismatch ● repair syndrome ▶ whole-exome sequencing ● ▶ genetic testing ●

Abstract

Zusammenfassung

Background:  Cases of children with more than one type of cancer either diagnosed simultaneously or successively, rarely occur in pediatric oncology. A second malignant neoplasm may be caused by mutagenic effects of the treatment of the primary malignancy and/or may point towards an underlying genetic cancer susceptibility syndrome. One example of such a syndrome is constitutional mismatch repair-deficiency, (CMMR-D) which carries an increased risk of various tumors including childhood hematologic malignancies and Lynch syndrome associated tumors. Timely diagnosis of CMMR-D is crucial, since this diagnosis has implications for the entire family. Patient:  We report the case of a 15-year-old girl who was born to consanguineous parents. At the age of 20 months she was diagnosed with a T-cell non-Hodgkin lymphoma. Treatment was given according to NHL-BFM 95. 12 years later, an invasive adenocarcinoma of the colon was surgically removed which relapsed shortly afterwards. Methods:  Whole-exome sequencing of germline DNA was employed to rapidly detect the underlying mutation in this suspected CMMR-D patient. Results:  After a short turnaround time of less than 3 weeks, the diagnosis of CMMR-D could be confirmed by the identification of a homozygous 29-bp deletion in MSH6 (exon 6), which was confirmed by independent methods. Conclusions:  We demonstrate that “bed-side” whole-exome sequencing is both feasible and cost-effective and may be the method of choice to rapidly uncover the genetical basis of (inherited) diseases.

Hintergrund:  Kinder mit 2 verschiedenen Malignomen, die entweder zeitgleich oder sukzessiv diagnostiziert werden, sind in der pädiatrischen Onkologie eine Rarität. Eine zweite Krebserkrankung kann entweder durch die Primärtherapie des Ersttumors verursacht worden sein oder kann auf ein zu Grunde liegendes erbliches Krebssyndrom hinweisen. Ein Beispiel hierfür ist die sogenannte constitutional mismatch repairdeficiency (CMMR-D), welche charakterisiert ist durch ein erhöhtes Tumorrisiko von u. a. malignen hämatolischen Erkrankungen und LynchSyndrom-assoziierten Tumoren. Eine zeitnahe Diagnosestellung ist hierbei entscheidend, da diese Diagnose Auswirkungen für die gesamte Familie mit sich bringt. Patient:  Vorgestellt wird der Fall eines 15 Jahre alten Mädchens konsanguiner Eltern. Im Alter von 20 Monaten wurde ein mediastinales T-Zell Non-Hodgkin-Lymphom diagnostiziert. 12 Jahre später wurde ein invasiv wachsendes Adenokarzinom des Kolons chirurgisch entfernt, welches kurze Zeit später rezidivierte. Methoden:  Um die zu Grunde liegende Mutation dieses putativen erblichen Krebssyndroms möglichst rasch zu identifizieren wurde eine Gesamt-Exom-Sequenzierung durchgeführt. Resultate:  Nur 3 Wochen nach Blutentnahme konnten wir die Diagnose CMMR-D durch den Nachweis einer homozygoten, 29 Basenpaare umfassenden Deletion im MSH6 Gen (Exon 6) stellen. Die Deletion konnte in unabhängigen Experimenten validiert werden. Schlussfolgerungen:  Patientennahe GesamtExom-Sequenzierung ist sowohl praktikabel als auch kosteneffektiv. Sie ist die Methode der Wahl zur Charakterisierung des zu Grunde liegenden genetischen Defekts bei (Erb-) Krankheiten.

Schlüsselwörter ▶ erbliche Krebssyndrome ● ▶ constitutional mismatch ● repair syndrome ▶ Gesamt-Exom-Sequen● zierung ▶ genetische Testung ●

Bibliography DOI http://dx.doi.org/ 10.1055/s-0034-1389905 Klin Padiatr 2014; 226: 357–361 © Georg Thieme Verlag KG Stuttgart · New York ISSN 0300-8630 Correspondence Dr. Jessica Irmin Hoell Department of Pediatric ­Oncology, Hematology and Clinical Immunology, Medical Faculty Heinrich Heine University Moorenstraße 5 40225 Duesseldorf Germany Tel.:  + 49/211 81 17687 Fax:  + 49/211 81 17634 [email protected]­ duesseldorf.de

▼

▼

Hoell JI et al. Constitutional Mismatch Repair-deficiency and …  Klin Padiatr 2014; 226: 357–361

Downloaded by: University of Pittsburgh. Copyrighted material.

Erbliches Krebssyndrom und Gesamt-Exom-Sequenzierung als Mittel zur raschen Identifizierung des kausativen MSH6-Defekts

358 Original Article

▼

Cases of children with more than one type of cancer either diagnosed simultaneously or successively, rarely occur in pediatric oncology. A second malignant neoplasm may be caused by mutagenic effects of the treatment of the primary malignancy (chemotherapy, ionizing radiation) and/or may point towards an underlying genetic cancer susceptibility syndrome. Examples of such syndromes include Li-Fraumeni syndrome (mutations in TP53 [26]), ataxia teleangiectasia (mutations in ATM [2]), ­DICER1 syndrome (mutations in DICER1 [23]), neurofibromatosis type 1 (mutations in NF1 [22]), Costello syndrome (mutations in HRAS [12]), Wiedemann-Beckwith syndrome (mutations in different genes [18]) and constitutional mismatch repair-deficiency ­(CMMR-D [29]). A rapid diagnosis of such underlying syndromes is of importance not only for subsequent genetic counseling but especially for correct initial treatment assignment. This includes tailoring regimens with reduced overall chemotherapy dose as well as limiting the exposure to radiation to an absolute minimum in case of increased radiosensitivity. CMMR-D is a rare inherited childhood cancer predisposition syndrome and is associated with an increased risk of childhood hematologic malignancies (including leukemias and lymphomas), brain tumors, Lynch syndrome associated cancers including colorectal cancers and other rare malignancies. It is caused by biallelic germline mutations of the genes constituting the mismatch repair machinery. This includes the genes MLH1 (MutL homolog 1), MSH2 (MutS homolog 2), MSH6 (MutS ­homolog 6) and PMS2 (postmeiotic segregation increased 2). The mismatch repair machinery is essential to any living cell since it guards genome integrity. Following DNA replication and potential DNA damage, it corrects single base-pair mismatches and small insertion-deletion loops. Mutations lead to an accumulation of additional genetic defects and thus predispose to various cancers at an early age. Heterozygous mutations in any of these mismatch repair genes cause a dominant adult cancer syndrome termed Lynch syndrome or hereditary non-polyposis colorectal cancer (HNPCC) leading to a predisposition to mostly colorectal and endometrial cancers [14, 24]. The most commonly mutated genes in CMMR-D are PMS2 and MSH6 (reviewed by [21]). Patients with CMMR-D due to mutations in these 2 genes are more likely to have more than one malignancy compared to patients with mutations in MLH1 or MSH2 [30]. With sometimes inconclusive or conflicting results from microsatellite instability analysis and immunohistochemistry [4], germ­line mutation analysis of the mismatch repair genes remains the gold standard for diagnosing CMMR-D [15]. So far, in virtually all published cases this has been achieved by conventional DNA Sanger sequencing. However, depending on the number of genes that have to be screened, this method is very time-consuming and might thus result in delayed diagnosis. Targeted whole-exome sequencing (WES) has already proven a useful tool in the diagnosis of both inherited and acquired mutations and has been employed to tackle diverse questions. In pediatrics, WES has e. g. been used to decipher the genetic basis in primary immunodeficiencies [7], inherited metabolic diseases [11], or epilepsy syndromes [19]. Only recently, a study has been published in the New England Journal of Medicine which performed WES on 250 patients, most of whom were children with a range of different phenotypes, for which genetic causes

had been suspected but had not been diagnosed previously. An impressive 25 % molecular diagnostic rate was achieved since the underlying molecular defect could be defined in 62 patients [33]. Here, we used WES for rapid diagnosis of a patient who fulfilled clinical criteria of CMMR-D [31]. We describe our WES sample pipeline which includes experimental and bioinformatic processing steps. Today, next generation sequencing has found its way into daily clinical routine in (pediatric) hospitals. The incorporation of such novel tools close to the patient’s bed-side facilitates rapid molecular diagnosis thus supporting clinical decision-making.

Materials and methods

▼

Sample acquisition

Genomic DNA was isolated from peripheral blood obtained from the index case, the siblings as well as the parents. The AllPrep DNA/RNA Mini Kit (Qiagen, Hilden, Germany) was used to purify DNA according to the manufacturer’s instructions. The study was approved by the local ethics committee and written informed consent was given by the parents.

Oligonucleotides

The following oligodeoxynucleotides were used for PCR-amplification of the deleted region in MSH6 exon 6 and for Sanger resequencing of the variant rs.2020912: CTGGCTTATTAGCTGTAATG deletion fwd, ATTCTGTCTGAGGCACC deletion rev, CATACAGCAAGAAGAAGATTATTG mutation fwd, CGACCTTCAGGATTTTTTGTC mutation rev.

Exome library preparation and next generation sequencing

Exome library preparation was performed using the Agilent SureSelectXT Human All Exon V4 + UTR kit with modifications adapted from Fisher et al [10]. Briefly, we added SPRI beads to the original protocol and reduced the size of the reaction to 0.5 µl in order to be able to use PCR tubes for subsequent steps. Furthermore, we reduced the volume for washing. We minimized sample loss and optimized sample processing by reducing sample handling. We therefore just added freshly prepared 20 % PEG/2.5 M NaCl (Sigma) instead of elution of samples from the SPRI beads for library preparation. Targeted capture by hybridization to an RNA library was performed according to the manufacturer’s protocol. Purification and enrichment of the captured library was achieved by binding to MyOne Streptavidin T1 Dynabeads (LifeTechnolgies) and off-bead PCR amplification in the linear range. 2 × 100 bp sequencing with a 6 bp index read was performed using the TruSeq SBS Kit v3 on the HiSeq 2500 (Illumina).

Data analysis

Fastq files were generated by using BcltoFastq 1.8.4 (Illumina). BWA version 0.6.1-r104 [16] was used to align sequence data to the human reference genome (GRCh37). Conversion steps were carried out using Samtools [17] followed by removal of duplicate reads [9]. Local realignment around indels, SNP-calling, annotation and recalibration was facilitated by GATK [8]. HapMap, OmniArray and dbSNP135 datasets provided by The Broad Institute were used for recalibration. Resulting variation calls were annotated by Variant Effect Predictor [20] using the Ensembl database (v70) and imported into an in-house MySQL database to facilitate automatic and manual annotation, reconciliation

Hoell JI et al. Constitutional Mismatch Repair-deficiency and …  Klin Padiatr 2014; 226: 357–361

Downloaded by: University of Pittsburgh. Copyrighted material.

Introduction

and data analysis by complex database queries. Loss of function prediction scores for PolyPhen2 [1] and SIFT [13] were extracted from this Ensemble release. Sequence variants within protein coding genes with less than 15 % frequency in the 1 000 genomes and HapMap project were considered for further analysis.

Results and discussion

▼

Clinical case

We here report the case of a girl who was diagnosed with a mediastinal T-cell non-Hodgkin lymphoma (NHL) at the young age of 20 months. Our patient is the third child of healthy consan▶  Fig. 1a) and has 3 healthy siblings. The girl guineous parents ( ● did not have café au lait spots nor did she exhibit other features of NF1. Chemotherapy according to the NHL BFM 95 protocol was given for a total of 24 months. No radiation therapy was administered. Regular follow-up examinations were performed during which the girl always presented in very good health without any reported problems. At the age of 13 years, she presented to the emergency room of a local hospital with abdominal cramping, vomiting and obstipation for several days. Conventional therapy including multiple clysmas was unsuccessful and she was transferred to a tertiary a

care center for surgical therapy. On admission, her general state of health was markedly reduced, the abdomen was distended and she was cachectic with a BMI of only 14 kg/m2. Emergency surgery showed an intussusception of the sigmoid colon, multiple mesenterial adhesions and a tumor of the colon. Because of the large size of the tumor, a total colectomy with subsequent ileostomy and lymphadenectomy was performed. Histology classified the tumor as an invasive adenocarcinoma pT2, pN2a, pM1a, R0 resected. Multiple polyps in the entire intestinal tract were also noted on follow-up esophagogastroduodenoscopy and colonoscopy. Adjuvant chemotherapy was administered over a period of 8 months and consisted of 12 cycles of FOLFOX4 which included oxaliplatin, fluorouracil and leucovorin. A head MRI scan, which was performed to search for intracerebral metastases, revealed small areas of increased signal intensity of the right cerebellar lobe as well as a small cyst below the right putamen. A follow-up MRI scan additionally showed small lacunar bilateral thalamic lesions. However, no abnormalities were noted on neurological history and examination and the lesions remained stable in follow-up head MRI scans. 6 months later, when the temporary ileostomy was reversed and the patient was still symptom-free, multiple suspicious lymph nodes were excised from the upper abdomen. Histology now showed a secondary peritoneal carcinomatosis. Given the limit-

b

I.

c A G A G

A A G C T A A G C T

200

G C T G C T

1

II.

1

2

3

125 75

A G A G

A A G N T A A G N T

G C T G C T

2

III. A G A G

A A G N T A A G N T

IV.

G C T G C T

3 1

d

200 genetic counseling

A G A AG C T G C T A G A A G C T G C T

125 75

Fig. 1  a Pedigree of the investigated family. Roman numbers, generations; circles, females; squares, males; black symbol and arrow, index patient; grey symbols, heterozygous relatives b Confirmation of the homozygous (index patient, 1) and heterozygous mutation (father, 2; mother, 3). c Confirmation of the deletion. The index patient (1) only shows the amplification of the shorter fragment, the parents (father, 2; mother, 3) carry both the wild-type allele as well as the allele carrying the deletion. Below the PCR image is a view of the genome browser showing

the sequence reads (thick black lines) in the 29-bp deleted region of the index patient. There are 26 reads (thin black lines) spanning the deletion, whereas no read corresponding to the wild-type allele was detected. d Schematic representation of the sample processing pipeline. Indicated are the steps blood draw, DNA purification, sample preparation for wholeexome sequencing, next generation sequencing, bioinformatic analysis pipeline, identification of a mutation/deletion, validation of the mutation/ deletion, genetic counseling.

Hoell JI et al. Constitutional Mismatch Repair-deficiency and …  Klin Padiatr 2014; 226: 357–361

Downloaded by: University of Pittsburgh. Copyrighted material.

Original Article 359

ed therapeutic choices, she then started with regional deep hyperthermia [28] of which she so far has received 4 cycles. Due to the consanguinity of her parents and her unusual history of cancer including a lymphoma at a very early age as well as a colorectal cancer in childhood, the suspicion of CMMR-D was raised. Extended family history was unremarkable, in particular there were no cases of childhood cancers or Lynch syndrome associated neoplasms. Immunohistochemical analysis showed positivity for MLH1, MSH2, and PMS2, whereas MSH6 was negative. Microsatellite instability testing remained inconclusive with conflicting reports as to whether slight microsatellite instability or none at all was detected in the examined tumor tissue.

A novel deletion of MSH6

In contrast to conventional Sanger sequencing, targeted WES is a fast and efficient way of uncovering all single nucleotide polymorphisms in (mostly) protein-coding regions in one experiment. Thus, we performed WES of our index patient as well as of her healthy parents and siblings (coverage 98 % of exome targets at  ≥ 10x). Sample preparation was optimized as outlined in the materials and methods section. Sequencing, data analysis and validation of small structural variations and SNPs were performed as previously described [6]. Within the exome sequencing data, we detected 924 sequence variations (including deletions, insertions) – occurring with less than 15 % allele frequency in the 1 000 genomes and HapMap projects–, which were homozygous in our index patient and heterozygous in both parents. To narrow down this number, we next checked which of these sequence variations mapped to a gene list of 488 cancer-associated genes. We then received 25 homozygous sequence variations (including deletions, insertions) in our index patient (parents each heterozygous) mapping to a total of 17 different genes. As above, all alterations occurred with less than 15 % allele frequency (Suppl. Table 1). We used 2 different algorithms for predicting the loss of function potential for all SNPs (SIFT, PolyPhen). 11 of the sequence variations mapped to intronic regions, 5 to either 3’ or 5’ UTR and one to a non-coding isoform of a gene. 8 alterations (corresponding to 5 different genes) mapped to exons and altered the amino acid of the encoded protein. Of these, 5 were classified as benign/tolerated by the prediction tools. Of the remaining 3, we detected 2 homozygous sequence variations in the MMR gene MSH6. Sequencing revealed the homozygous presence of the previously described SNP rs2020912 (NM_000179.2:c.2633 T > C; NP_000170.1:p.Val878Ala), which was classified as benign by both SIFT and PolyPhen as well as by the InSiGHT [25] locus-specific database (class 1). Additionally, we detected a novel homozygous 29 base pair deletion in MSH6 leading to a premature stop codon (g.48032092_48032120delCT GCTGAAGTGTGCAGGCTCACACCAATT). This affects all AA positions after AA 1160, which results in the loss of the so-called DNA mismatch repair proteins mutS family domain signature (AA positions 1208-1224) presumably leading to a loss of mismatch repair potential of this protein. Conventional Sanger sequencing and PCR confirmed the presence of both the SNP as ▶  Fig. 1b, c). well as the deletion ( ●

Conclusions

▼

Here, we illustrate the successful use of WES for rapid and reliable identification of a 29-bp deletion in the MMR-gene MSH6

▶  Fig. 1d). This confirming the clinical diagnosis of CMMR-D ( ● diagnosis is often delayed due to a wide tumor spectrum, the lack of specific clinical features and the overlap with other cancer predisposition syndromes [3]. Although our patient was diagnosed with a rare tumor at an uncommonly young age, the lack of other distinct clinical features meant that she escaped the correct diagnosis of CMMR-D at that time. Timely diagnosis of CMMR-D is crucial, since this diagnosis has implications for the entire family. WES of the entire core family identifies the mutational status of siblings or other relatives and confirms the heterozygous state of parents. Any heterozygous carrier may suffer from Lynch Syndrome later in life. Thus, they (as well as the patients themselves due to a greatly increased risk of developing a second malignancy) will benefit from regular screening examinations [5]. However, any genetic testing (especially in minors) should of course be performed in accordance with national laws and guidelines. Considering that our patient developed 2 metachronous tumors highly suggestive of CMMR-D, the question might be raised whether she could have been diagnosed earlier. However, our patient was diagnosed with the T-NHL only a few months after 2 publications describing children of consanguineous parents, who carried homozygous MLH1 germline mutations and developed hematological malignancies in early childhood as well as a brain tumor (for a detailed review of the history of CMMR-D please refer to [32]). Thus, T-NHL tumor material from our patient was not further tested. Only following these first reports and others subsequently describing mutations in all MMR genes, CMMR-D has been recognized as a distinct childhood cancer predisposition syndrome and our understanding about CMMR-D has vastly increased, cumulating in the foundation of the European consortium “Care for CMMR-D” (C4CMMR-D) in June 2013. This consortium has implemented a scoring system ([32]) in which our patient scores 6 points (carcinoma from the Lynch Syndrome spectrum at