bs_bs_banner
Pathology International 2015; 65: 507–509
doi:10.1111/pin.12293
Letter to the Editor Congenital mesoblastic nephroma with focal anaplastic lesion To the Editor: Congenital mesoblastic nephroma (CMN) is a rare renal tumor that comprises spindle cells and most often arises in newborns and infants. CMNs are classified into three types: cellular, classic, and mixed type. Cellular type CMN expresses the same chimeric protein ETV6-NTRK3 as does infantile fibrosarcoma and is therefore regarded as infantile fibrosarcoma within the kidney.1,2 Pathologically, cellular type CMN is sometimes difficult to distinguish from clear cell sarcoma of the kidney (CCSK)3,4 because CCSK is also a childhood, renal, mesenchymal tumor. However, differentiating cellular type CMN from CCSK is clinically important because therapy after nephrectomy and prognosis differ greatly between these cancers. CCSKs display several variations of histological patterns, and an anaplastic pattern is seen in approximately 2.6% of primary and recurrent CCSKs.5 To our knowledge, no cellular type CMN or infantile fibrosarcoma with an anaplastic pattern has been reported. Here, we describe a renal spindle cell tumor with focal anaplastic lesion in a pediatric patient. The presence of focal anaplastic lesion made diagnosis of CMN difficult, and verifying expression of the oncogenic ETV6-NTRK3 fusion was the key to accurately diagnosing cellular type CMN. This case demonstrates that focal anaplastic lesion may be seen in cellular type CMN. The patient was a boy aged one year and five months. His family noticed abdominal enlargement when he was 1 year old, but did not consider the condition serious because his abdomen was soft and he was afebrile and not vomiting. However, his abdomen gradually became harder and more enlarged. He was admitted to our hospital at the age of 1 year and 5 months. A right renal tumor measuring 9 × 12 cm with necrosis was found on abdominal enhanced computed
tomography. No distant metastasis, lymphadenopathy, or tumor infiltration into the inferior vena cava was detected. Right nephrectomy was performed. The right kidney was resected with the right ureter and right adrenal gland; this complex weighed 1.1 kg and measured 15 × 12 × 12 cm. No rupture of the capsule was evident. On cut section, the tumor was soft and displayed variegated color with the dark red of hemorrhage and the brown of necrosis in the center and a white-yellow color at the margins. The tumor was fairly well demarcated. Samples for reverse transcriptase-polymerase chain reaction (RT-PCR) were taken from the white-yellow peripheral part of the tumor. On microscopic examination, the tumor margin was sharply and linearly demarcated or had infiltrated only a short distance into the renal parenchyma with a pushing border. The tumor was within the kidney and had not invaded into the renal capsule. No invasion into the renal pelvis or adipose tissue in the renal sinus was found. The cut ends of the ureter and the renal artery and vein were tumor-negative. An old hematoma and wide necrosis were centered within the tumor, and microscopic necrotic foci were scattered within the tumor. The tumor entrapped isolated renal tubules or glomeruli. The tumor comprised interlacing fascicles of spindle cells with bipolar cytoplasmic processes and round to slightly elongated nuclei containing fine chromatin and a few (1 or 2) tiny nucleoli (Fig. 1a). A storiform pattern of cells was observed. Mitotic counts per one high-power field (HPF) were 1 to 7 (mean approximately 4), but karyorrhexis was more frequent than mitosis. Cells with bizarre giant nuclei or with multiple nuclei and with abundant eosinophilic cytoplasm were found in the sharply demarcated nodular region that measured 4 × 2 mm (Fig. 1b). Multipolar mitotic figures were also observed in this region. So these cells fulfill the criteria of anaplasia defined for nephroblastoma, CCSK, and anaplastic sarcoma of the kidney (ASK). There were no transitional features between the anaplastic lesion and the surrounding
Figure 1 (a) Microscopic features of the tumor. Hematoxylin and eosin-stained tumor sections indicate that the majority of the tumor has spindle cells growing in an interlacing bundle pattern. (b) Microscopic indicators of anaplastic cells in a focal area 4 × 2 mm in size. Hematoxylin and eosin-stained tumor sections indicate giant multi-nucleated cells and cells with bizarre giant nuclei. © 2015 Japanese Society of Pathology and Wiley Publishing Asia Pty Ltd
508
Letter to the Editor
lesion. We examined 30 paraffin blocks from this tumor and found this small lesion with anaplasia in only one block. Immunohistochemical analysis of the tumor showed the following: vimentin was diffusely positive; BAF47(INI1) was nuclear-positive; internexin-alpha, which is a novel marker for clear cell sarcoma,6 was negative; myogenin, desmin, an epithelial membrane antigen, and alpha-smooth muscle actin were mostly negative; and P53-positive cells were scattered within the tumor. However, the anaplastic cells were all P53negative. Morphological differential diagnoses were: CCSK, monophasic synovial sarcoma, ASK, and cellular type CMN. Total RNA was extracted from frozen tumor tissue using an ISOGEN kit (NIPPON GENE, Tokyo, Japan) and was reverse transcribed to cDNA using the Transcriptor First Strand cDNA Synthesis Kit (Roche Diagnostics, Mannheim, Germany). PCR was performed with the following primer sets: for ETV6/NTRK3, ETV6/541 (CCTCCCACCATTGAA CTGTT) and NTRK3/1838 (CCGCACACTCCATAGAACT TGAC); for SS18-SSX1/2, SYT (CAACAGCAAGATGCAT ACCA)3 and SSX (CACTTGCTATGCACCTGATG)’. The amplified products were analyzed on a 2% agarose gel (Fig. 2a). The products were then purified using GFX PCR DNA and a Gel Band Purification Kit (GE Healthcare, Chalfont St Giles, Bucks, UK) and were sequenced using a BigDyeTerminator v3.1 cycle sequencing kit (Life Technologies, Carlsbad, CA, USA). The ETV6-NTRK3 fusion mRNA in snap-frozen tumor tissues was identified via RT-PCR, and the transcript was confirmed by direct sequencing (Fig. 2b). SS18-SSX1/2 fusion transcripts, which are specific to synovial sarcoma, were not detected. Based on expression of the ETV6-NTRK3 fusion oncogene and the histological mesoblastic pattern of the majority of the tumor, this tumor was ultimately diagnosed as cellular type CMN. The criteria for anaplasia in nephroblastoma require the presence of multipolar polyploid mitotic figures, marked nuclear enlargement, and hyperchromasia.7 Based on a review of 351 CCSK cases, Argani P et al. stated that an anaplastic pattern defined by nuclear hyperchromasia, nuclear gigantism, and atypical mitoses was identified in 2.6% of CCSKs.5 A discrete anaplastic pattern in a CCSK is not an indicator of poor prognosis; however, CCSK itself is an unfavorable histology. In 2007, ASKs were identified by reviewing tumors with unusual anaplastic features.8 The median age of these patients was 5 years, and the mean age of patients was12 years; histologically, all tumors showed a spindle cell component that contained either multiple foci or diffuse widespread anaplastic changes with bizarre pleomorphic cells and very atypical mitotic figures. The present case was not ASK because the tumor did not show undifferentiated small round primitive mesenchymal cells or cartilage or chondroid differentiation.
Figure 2 (a) Molecular analysis. Reverse transcriptase polymerase chain reaction of RNA from the tumor tissue shows an in-frame, ETV6-NTRK3 fusion (Lane 2). Lane1; marker X174 HaeIII digest, lane 2; present case, lane 3; negative control, lane 4; positive control for ETV6-NTRK3, lane 5; negative control, lane 6; present case, lane 7; negative control, lane 8; positive control for SYT-SSX, lane 9; negative control, lane 10; present case, lane 11; negative control, lane 12; positive control for beta-actin, lane 13; negative control. (b) The DNA sequence of the fragment obtained from RT-PCR of RNA from tumor tissue with primers for the ETV6-NTRK3 fusion gene is shown. The point of fusion between the constituent genes is shown. A vertical line indicates the nucleotide position of the fusion junction between the constituent proto-oncogenes.
The anaplastic lesion in our case fulfilled the criteria for anaplasia in nephroblastoma, anaplastic pattern in CCSK, and anaplasia in ASK. In the present case, the anaplastic lesion was focal and was 4 × 2 mm in size. Currently, it is unknown whether a focal anaplastic pattern is an unfavorable factor for CMN. Overexpression of the p53 protein in Wilms tumor indicates poor prognosis because it is correlated with unfavorable tumor histology and a shorter survival period.9 Beniers and colleagues showed a significant correlation between p53 expression and anaplasia.10 Though all anaplastic cells in our case were immunohistochemically negative for p53, careful follow up is needed. Accumulation of more cases is needed to examine the biological features of focal anaplasia in CMN. To our knowledge, this is the first report of focal anaplasia in cellular type CMN.
© 2015 Japanese Society of Pathology and Wiley Publishing Asia Pty Ltd
Letter to the Editor
DISCLOSURE None declared. Makiko Yoshida,1 Hajime Okita,2 Terutaka Tanimoto,3 Yuko Bitoh,3 Hiroaki Fukuzawa,3 Akiko Yokoi,3 Aiko Kozaki,4 Keiichiro Kawasaki,4 and Yoshinobu Akasaka5
Departments of 1Pathology, 3Pediatric Surgery, Oncology, 5Radiology, Kobe Children’s Hospital, Kobe and 2Department of Pediatric Hematology and Oncology Research, National Research Institute for Child Health and Development, National Center for Child Health and Development, Tokyo, Japan 4
REFERENCES 1 Argani P, Sorensen PHB. Congenital mesoblastic nephroma. In: Eble JN, Sauter G, Epstein JI, Sesterhenn IA, eds. Pathology & Genetics. Tumours of the Urinary System and Male Genital Organs. World Health Organization Classification of Tumours. Lyon: International Agency for Research on Cancer Press, 2004; 60–61. 2 Chi HT, Ly BT, Kano Y, Tojo A, Watanabe T, Sato Y. ETV6NTRK3 as a therapeutic target of small molecule inhibitor PKC412. Biochem Biophys Res Commun 2012; 429: 87– 92.
509
3 Murphy WM, Grignon DJ, Perlman EJ. Tumors of the Kidney, Bladder, and Related Urinary Structures (AFIP Atlas of Tumor Pathology 4th Series). Washington, DC: American Registry of Pathology, 2004; 57–75. 4 Alavi S, Khoddami M, Yazdi MK, Dehghanian P, Esteqhamati S. Clear cell sarcoma of the kidney misdiagnosed as mesoblastic nephroma: A case report and review of the literature. Ecancermedicalscience 2013; 7: 311. 5 Argani P, Perlman EJ, Breslow NE et al. Clear cell sarcoma of the kidney: A review of 351 cases from the National Wilms Tumor Study Group Pathology Center. Am J Surg Pathol 2000; 24: 4–18. 6 Tanaka Y, Katayama A, Inoue T et al. High expression and diagnostic utility of internexin alpha in clear cell sarcoma of the kidney: Comparative proteomics analysis and immunohistochemical study. Lab Invest 2013; 93 (Suppl 1): 252A. 7 Perlman EJ, Grosfeld JL, Togashi K, Boccon-Gibod L. Nephroblastoma. In: Eble JN, Sauter G, Epstein JI, Sesterhenn IA, eds. Pathology & Genetics. Tumours of the Urinary System and Male Genital Organs. World Health Organization Classification of Tumours. Lyon: International Agency for Research on Cancer Press, 2004; 48–52. 8 Vujanic´ GM, Kelsey A, Perlman EJ, Sandstedt B, Beckwith JB. Anaplastic sarcoma of the kidney: A clinicopathologic study of 20 cases of a new entity with polyphenotypic features. Am J Surg Pathol 2007; 31: 1459–68. 9 Jadali F, Sayadpour D, Rakhshan M et al. Immunohistochemical detection of p53 protein expression as a prognostic factor in Wilms tumor. Iran J Kidney Dis 2011; 5: 149–53. 10 Beniers AJ, Efferth T, Füzesi L, Granzen B, Mertens R, Jakse G. p53 expression in Wilms’ tumor: A possible role as prognostic factor. Int J Oncol 2001; 18: 133–9.
© 2015 Japanese Society of Pathology and Wiley Publishing Asia Pty Ltd
Pathology International 2015; 65: 507–509
doi:10.1111/pin.12293
Letter to the Editor Congenital mesoblastic nephroma with focal anaplastic lesion To the Editor: Congenital mesoblastic nephroma (CMN) is a rare renal tumor that comprises spindle cells and most often arises in newborns and infants. CMNs are classified into three types: cellular, classic, and mixed type. Cellular type CMN expresses the same chimeric protein ETV6-NTRK3 as does infantile fibrosarcoma and is therefore regarded as infantile fibrosarcoma within the kidney.1,2 Pathologically, cellular type CMN is sometimes difficult to distinguish from clear cell sarcoma of the kidney (CCSK)3,4 because CCSK is also a childhood, renal, mesenchymal tumor. However, differentiating cellular type CMN from CCSK is clinically important because therapy after nephrectomy and prognosis differ greatly between these cancers. CCSKs display several variations of histological patterns, and an anaplastic pattern is seen in approximately 2.6% of primary and recurrent CCSKs.5 To our knowledge, no cellular type CMN or infantile fibrosarcoma with an anaplastic pattern has been reported. Here, we describe a renal spindle cell tumor with focal anaplastic lesion in a pediatric patient. The presence of focal anaplastic lesion made diagnosis of CMN difficult, and verifying expression of the oncogenic ETV6-NTRK3 fusion was the key to accurately diagnosing cellular type CMN. This case demonstrates that focal anaplastic lesion may be seen in cellular type CMN. The patient was a boy aged one year and five months. His family noticed abdominal enlargement when he was 1 year old, but did not consider the condition serious because his abdomen was soft and he was afebrile and not vomiting. However, his abdomen gradually became harder and more enlarged. He was admitted to our hospital at the age of 1 year and 5 months. A right renal tumor measuring 9 × 12 cm with necrosis was found on abdominal enhanced computed
tomography. No distant metastasis, lymphadenopathy, or tumor infiltration into the inferior vena cava was detected. Right nephrectomy was performed. The right kidney was resected with the right ureter and right adrenal gland; this complex weighed 1.1 kg and measured 15 × 12 × 12 cm. No rupture of the capsule was evident. On cut section, the tumor was soft and displayed variegated color with the dark red of hemorrhage and the brown of necrosis in the center and a white-yellow color at the margins. The tumor was fairly well demarcated. Samples for reverse transcriptase-polymerase chain reaction (RT-PCR) were taken from the white-yellow peripheral part of the tumor. On microscopic examination, the tumor margin was sharply and linearly demarcated or had infiltrated only a short distance into the renal parenchyma with a pushing border. The tumor was within the kidney and had not invaded into the renal capsule. No invasion into the renal pelvis or adipose tissue in the renal sinus was found. The cut ends of the ureter and the renal artery and vein were tumor-negative. An old hematoma and wide necrosis were centered within the tumor, and microscopic necrotic foci were scattered within the tumor. The tumor entrapped isolated renal tubules or glomeruli. The tumor comprised interlacing fascicles of spindle cells with bipolar cytoplasmic processes and round to slightly elongated nuclei containing fine chromatin and a few (1 or 2) tiny nucleoli (Fig. 1a). A storiform pattern of cells was observed. Mitotic counts per one high-power field (HPF) were 1 to 7 (mean approximately 4), but karyorrhexis was more frequent than mitosis. Cells with bizarre giant nuclei or with multiple nuclei and with abundant eosinophilic cytoplasm were found in the sharply demarcated nodular region that measured 4 × 2 mm (Fig. 1b). Multipolar mitotic figures were also observed in this region. So these cells fulfill the criteria of anaplasia defined for nephroblastoma, CCSK, and anaplastic sarcoma of the kidney (ASK). There were no transitional features between the anaplastic lesion and the surrounding
Figure 1 (a) Microscopic features of the tumor. Hematoxylin and eosin-stained tumor sections indicate that the majority of the tumor has spindle cells growing in an interlacing bundle pattern. (b) Microscopic indicators of anaplastic cells in a focal area 4 × 2 mm in size. Hematoxylin and eosin-stained tumor sections indicate giant multi-nucleated cells and cells with bizarre giant nuclei. © 2015 Japanese Society of Pathology and Wiley Publishing Asia Pty Ltd
508
Letter to the Editor
lesion. We examined 30 paraffin blocks from this tumor and found this small lesion with anaplasia in only one block. Immunohistochemical analysis of the tumor showed the following: vimentin was diffusely positive; BAF47(INI1) was nuclear-positive; internexin-alpha, which is a novel marker for clear cell sarcoma,6 was negative; myogenin, desmin, an epithelial membrane antigen, and alpha-smooth muscle actin were mostly negative; and P53-positive cells were scattered within the tumor. However, the anaplastic cells were all P53negative. Morphological differential diagnoses were: CCSK, monophasic synovial sarcoma, ASK, and cellular type CMN. Total RNA was extracted from frozen tumor tissue using an ISOGEN kit (NIPPON GENE, Tokyo, Japan) and was reverse transcribed to cDNA using the Transcriptor First Strand cDNA Synthesis Kit (Roche Diagnostics, Mannheim, Germany). PCR was performed with the following primer sets: for ETV6/NTRK3, ETV6/541 (CCTCCCACCATTGAA CTGTT) and NTRK3/1838 (CCGCACACTCCATAGAACT TGAC); for SS18-SSX1/2, SYT (CAACAGCAAGATGCAT ACCA)3 and SSX (CACTTGCTATGCACCTGATG)’. The amplified products were analyzed on a 2% agarose gel (Fig. 2a). The products were then purified using GFX PCR DNA and a Gel Band Purification Kit (GE Healthcare, Chalfont St Giles, Bucks, UK) and were sequenced using a BigDyeTerminator v3.1 cycle sequencing kit (Life Technologies, Carlsbad, CA, USA). The ETV6-NTRK3 fusion mRNA in snap-frozen tumor tissues was identified via RT-PCR, and the transcript was confirmed by direct sequencing (Fig. 2b). SS18-SSX1/2 fusion transcripts, which are specific to synovial sarcoma, were not detected. Based on expression of the ETV6-NTRK3 fusion oncogene and the histological mesoblastic pattern of the majority of the tumor, this tumor was ultimately diagnosed as cellular type CMN. The criteria for anaplasia in nephroblastoma require the presence of multipolar polyploid mitotic figures, marked nuclear enlargement, and hyperchromasia.7 Based on a review of 351 CCSK cases, Argani P et al. stated that an anaplastic pattern defined by nuclear hyperchromasia, nuclear gigantism, and atypical mitoses was identified in 2.6% of CCSKs.5 A discrete anaplastic pattern in a CCSK is not an indicator of poor prognosis; however, CCSK itself is an unfavorable histology. In 2007, ASKs were identified by reviewing tumors with unusual anaplastic features.8 The median age of these patients was 5 years, and the mean age of patients was12 years; histologically, all tumors showed a spindle cell component that contained either multiple foci or diffuse widespread anaplastic changes with bizarre pleomorphic cells and very atypical mitotic figures. The present case was not ASK because the tumor did not show undifferentiated small round primitive mesenchymal cells or cartilage or chondroid differentiation.
Figure 2 (a) Molecular analysis. Reverse transcriptase polymerase chain reaction of RNA from the tumor tissue shows an in-frame, ETV6-NTRK3 fusion (Lane 2). Lane1; marker X174 HaeIII digest, lane 2; present case, lane 3; negative control, lane 4; positive control for ETV6-NTRK3, lane 5; negative control, lane 6; present case, lane 7; negative control, lane 8; positive control for SYT-SSX, lane 9; negative control, lane 10; present case, lane 11; negative control, lane 12; positive control for beta-actin, lane 13; negative control. (b) The DNA sequence of the fragment obtained from RT-PCR of RNA from tumor tissue with primers for the ETV6-NTRK3 fusion gene is shown. The point of fusion between the constituent genes is shown. A vertical line indicates the nucleotide position of the fusion junction between the constituent proto-oncogenes.
The anaplastic lesion in our case fulfilled the criteria for anaplasia in nephroblastoma, anaplastic pattern in CCSK, and anaplasia in ASK. In the present case, the anaplastic lesion was focal and was 4 × 2 mm in size. Currently, it is unknown whether a focal anaplastic pattern is an unfavorable factor for CMN. Overexpression of the p53 protein in Wilms tumor indicates poor prognosis because it is correlated with unfavorable tumor histology and a shorter survival period.9 Beniers and colleagues showed a significant correlation between p53 expression and anaplasia.10 Though all anaplastic cells in our case were immunohistochemically negative for p53, careful follow up is needed. Accumulation of more cases is needed to examine the biological features of focal anaplasia in CMN. To our knowledge, this is the first report of focal anaplasia in cellular type CMN.
© 2015 Japanese Society of Pathology and Wiley Publishing Asia Pty Ltd
Letter to the Editor
DISCLOSURE None declared. Makiko Yoshida,1 Hajime Okita,2 Terutaka Tanimoto,3 Yuko Bitoh,3 Hiroaki Fukuzawa,3 Akiko Yokoi,3 Aiko Kozaki,4 Keiichiro Kawasaki,4 and Yoshinobu Akasaka5
Departments of 1Pathology, 3Pediatric Surgery, Oncology, 5Radiology, Kobe Children’s Hospital, Kobe and 2Department of Pediatric Hematology and Oncology Research, National Research Institute for Child Health and Development, National Center for Child Health and Development, Tokyo, Japan 4
REFERENCES 1 Argani P, Sorensen PHB. Congenital mesoblastic nephroma. In: Eble JN, Sauter G, Epstein JI, Sesterhenn IA, eds. Pathology & Genetics. Tumours of the Urinary System and Male Genital Organs. World Health Organization Classification of Tumours. Lyon: International Agency for Research on Cancer Press, 2004; 60–61. 2 Chi HT, Ly BT, Kano Y, Tojo A, Watanabe T, Sato Y. ETV6NTRK3 as a therapeutic target of small molecule inhibitor PKC412. Biochem Biophys Res Commun 2012; 429: 87– 92.
509
3 Murphy WM, Grignon DJ, Perlman EJ. Tumors of the Kidney, Bladder, and Related Urinary Structures (AFIP Atlas of Tumor Pathology 4th Series). Washington, DC: American Registry of Pathology, 2004; 57–75. 4 Alavi S, Khoddami M, Yazdi MK, Dehghanian P, Esteqhamati S. Clear cell sarcoma of the kidney misdiagnosed as mesoblastic nephroma: A case report and review of the literature. Ecancermedicalscience 2013; 7: 311. 5 Argani P, Perlman EJ, Breslow NE et al. Clear cell sarcoma of the kidney: A review of 351 cases from the National Wilms Tumor Study Group Pathology Center. Am J Surg Pathol 2000; 24: 4–18. 6 Tanaka Y, Katayama A, Inoue T et al. High expression and diagnostic utility of internexin alpha in clear cell sarcoma of the kidney: Comparative proteomics analysis and immunohistochemical study. Lab Invest 2013; 93 (Suppl 1): 252A. 7 Perlman EJ, Grosfeld JL, Togashi K, Boccon-Gibod L. Nephroblastoma. In: Eble JN, Sauter G, Epstein JI, Sesterhenn IA, eds. Pathology & Genetics. Tumours of the Urinary System and Male Genital Organs. World Health Organization Classification of Tumours. Lyon: International Agency for Research on Cancer Press, 2004; 48–52. 8 Vujanic´ GM, Kelsey A, Perlman EJ, Sandstedt B, Beckwith JB. Anaplastic sarcoma of the kidney: A clinicopathologic study of 20 cases of a new entity with polyphenotypic features. Am J Surg Pathol 2007; 31: 1459–68. 9 Jadali F, Sayadpour D, Rakhshan M et al. Immunohistochemical detection of p53 protein expression as a prognostic factor in Wilms tumor. Iran J Kidney Dis 2011; 5: 149–53. 10 Beniers AJ, Efferth T, Füzesi L, Granzen B, Mertens R, Jakse G. p53 expression in Wilms’ tumor: A possible role as prognostic factor. Int J Oncol 2001; 18: 133–9.
© 2015 Japanese Society of Pathology and Wiley Publishing Asia Pty Ltd
