This article was downloaded by: [Rutgers University] On: 05 April 2015, At: 22:48 Publisher: Taylor & Francis Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House, 37-41 Mortimer Street, London W1T 3JH, UK
Journal of Biomolecular Structure and Dynamics Publication details, including instructions for authors and subscription information: http://www.tandfonline.com/loi/tbsd20
Conformation of DNA-DNA Polymerase I Complex Observed by Scanning Tunneling Microscopy a
b
a
Chang-De Lu , Min-Quian Li , Ming-Yan Qui , b
b
b
Xiao-Wei Yao , Yao-Liang Xu , Ming-Min Gu & Ju Hu
b
a
Shanghai Institute of Biochemistry Acedemia Sinica , 320 Yue-Yang Road, Shanghai , 200031 , China b
Institute of Nuclear Research Acedemia Sinica , P.O. Box 800204-3, Shanghai , 201800 , China Published online: 21 May 2012.
To cite this article: Chang-De Lu , Min-Quian Li , Ming-Yan Qui , Xiao-Wei Yao , Yao-Liang Xu , Ming-Min Gu & Ju Hu (1991) Conformation of DNA-DNA Polymerase I Complex Observed by Scanning Tunneling Microscopy, Journal of Biomolecular Structure and Dynamics, 9:2, 233-238, DOI: 10.1080/07391102.1991.10507909 To link to this article: http://dx.doi.org/10.1080/07391102.1991.10507909
PLEASE SCROLL DOWN FOR ARTICLE Taylor & Francis makes every effort to ensure the accuracy of all the information (the “Content”) contained in the publications on our platform. However, Taylor & Francis, our agents, and our licensors make no representations or warranties whatsoever as to the accuracy, completeness, or suitability for any purpose of the Content. Any opinions and views expressed in this publication are the opinions and views of the authors, and are not the views of or endorsed by Taylor & Francis. The accuracy of the Content should not be relied upon and should be independently verified with primary sources of information. Taylor and Francis shall not be liable for any
losses, actions, claims, proceedings, demands, costs, expenses, damages, and other liabilities whatsoever or howsoever caused arising directly or indirectly in connection with, in relation to or arising out of the use of the Content.
Downloaded by [Rutgers University] at 22:48 05 April 2015
This article may be used for research, teaching, and private study purposes. Any substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any form to anyone is expressly forbidden. Terms & Conditions of access and use can be found at http://www.tandfonline.com/page/terms-and-conditions
Journal of Biomolecular Structure & Dynamics, /SSN 0739-1102 Volume 9,/ssue Number 2 (1991), ®Adenine Press (1991).
Conformation of DNA-DNA Polymerase I Complex Observed by Scanning Tunneling Microscopy Chang-De Lu 1, Min-Quian Li2, Ming-Yan Qui 1, Xiao-Wei Yao 2 Yao-Liang Xu 2 , Ming-Min Gu2 and Ju Hu2 Downloaded by [Rutgers University] at 22:48 05 April 2015
1
Shanghai Institute of Biochemistry Acedemia Sinica 320 Yue-Yang Road Shanghai 200031, China 2
Institute of Nuclear Research Acedemia Sinica P.O. Box 800204-3 Shanghai 201800, China
Abstract The conformation of a complex of a 41 mer/31 mer DNA fragment and the Klenow fragment of DNA polymerase I of Escherichia coli was studied by scanning tunnelling microscopy (STM). The results shows that near two turns of double helix ofthis DNA fragment was outside of enzyme while another part containing more than one turn of helix and 10 nucleotides single strand was combined with enzyme. The dimension and shape of DNA polymerase I (KF) in complex were different from that of free enzyme. The conformation of DNA-DNA polymerase I (KF) complex and the application ofSTM in studying structure of complex of DNA polymerase with DNA were discussed.
Introduction Because of the importance in ensuring the high fidelity of DNA replication, the interaction between DNA polymerase and DNA has been investigated with different kinds of method including electron microscopy (1), X-ray diffraction (2,3) etc. The Klenow fragment of DNA polymerase I of Escherichia coli having the polymerase and 3'-5' exoneclease (proofreading) functions in a single peptide (4) is an excellent model for investigating the molecular details of DNA replication. Although extensive efforts have been directed to the conformation of complex of Klenow enzyme with DNA, only one structure of a co-crystal ofKlenow fragment with DNA has been solved (3), it represents the conformation of editing state of enzyme. The conformation of enzyme in the polymerization state was still remained unreported. Recently, scanning tunnelling microscope (STM) has been used to study the structure ofbiological molecules such as B-DNA (5,6) and Rec A-DNA complex (7) etc. Here, we present the first image of DNA polymerase I (KF) and its complex with a DNA fragment by STM. Our results showed a conformational change of enzyme after binding with DNA
233
234
Lu eta/.
37 mer
30 mer
l
5'GAAAACTTTCCATTTGTTAACCATAGATCTAAGCTTG 3' 3'TAAACAATTGGTATCTAGATTCGAACTTAA 5' E. co 1i dATP, TTP DNA polymerase I ddGTP klenow Fragment MgCl Downloaded by [Rutgers University] at 22:48 05 April 2015
2
5'GAAAACTTTCCATTTGTTAACCATAGATCTAAGCTTGAATT 3 1 3'ddGTAAACAATTGGTATCTAGATTCGAACTTAA 5 1 I
30
20
10
Figure 1: Preparation and Sequence of 41 mer/31 mer DNA fragment.
In order to image the conformation ofDNA-DNA polymerase I (KF) complex by STM, a 41 mer/31 mer DNA fragment including 31 base pairs double stranded and 10 nucleotides single stranded 5' over hang was prepared from two chemically synthesized oligonucleotides 37 mer and 30 mer as shown in Figure 1. Figure 2a shows an image of a DNA polymerase I (KF) by STM.It appears a ellipsoid of 55-60 Awide and 70-7 5 Along, with a hollow cleft in the middle. Figure 2b indicates the profile of probe displacement along the line AB. According the proftle of probe displacement, the cleft offree enzyme was of ~ 20 Awide and ~ 24 Adeep and the apparent height of enzyme was ~ 43 A. Structural information obtained by X-ray diffraction indicated that Klenowfragment structure has two domains. The smaller domain contains the active site of3'-5' exonuclease. The large domain has DNA polymerase activity. In the large domain, there is a cleft of20-24 Awide and 25-35 A deep. This size and shape is of the appropriate dimensions to bind a B-DNA double helix. The image of DNA polymerase I (KF) observed by STM was in agreement with the model predicted by X-ray diffraction study. Figure 3a shows an image of 41 mer/31 mer DNA-DNA polymerase I (KF) complex. Figure 3b is the structure model of this complex. In this image, enzyme bound at the 3' end of primer, near two turns of right-handed helix DNA was outside of enzyme, the pitch was in the range of32-38 Aand the diameter of helix was 20-22 A the remaining part of 41 mer/31 mer DNA fragment including more than one tum double stranded and 10 nucleotides long single stranded DNA was combined with the enzyme. Our previous experiment of DNase I hydrolysis protection of DNA showed that 14 nucleotides upstream of primer terminus were protected by DNA polymerase I (KF) (unpublished data). Joyce et al. observed that 12-15 bp upstream and 9 bp downstream in template/primer were protected by DNA polymerase I (KF) from DNase I hydrolysis (2). The result observed with STM agrees with the DNase I hydrolysis protection experiments. The DNA looks to be bound into the cleft of enzyme. After binding with DNA, the width of DNA polymerase I (KF) was changed from 55-60 Ato 75-80 A. Compared to ellipsoid free enzyme the shape of enzyme was also changed.
235
Downloaded by [Rutgers University] at 22:48 05 April 2015
DNA-DNA Polymerase I Complex
Figure 2: a) Image ofKlenowFragmentofDNA polymerase I ofE. Coli. An aliquotof2 J.!l containing0.04 unit ofE. coli DNA polymerase I (KF) was deposited on freshly cleaved highly orianted pyrolytic graghite then was dehydrated to a thin layer under vacuum for serveral minutes. STM image was carried out with a self-designed STM instrument. Polished Pt-Ir tips were used for scanning. The sample bias was+ 100mV and constant feedback current was kept at 0.2 nA A lateral resolution of 1-2 A and a vertical resolution of 0.1 A was checked from the atomic structure of the graphite support before each measurement. The seals were as indicated in Figure 2b) Profile of probe displacement along line AB shown in 2a.
Lu eta/.
Downloaded by [Rutgers University] at 22:48 05 April 2015
236
3b Figure 3: a) Image of 41 mer/31 mer DNA-DNA polymerase I (KF) complex. An aliquot of2 jll containing 0.15 Alffi /ml of 41 mer/31 mer DNA, 0.04 unit of E. coli DNA polymerase I (KF), 10 mM Tris pH 7.8, I mM AMP, 0.5 mM EDTA, I% Glycerol was used. Sample treatment and STM image were carried out as the same as in Figure 2a. b) Structure model for 41 mer/31 mer DNA-DNA polymerase I (KF) complex shown in 3a.
DNA-DNA Polymerase I Complex
237
Downloaded by [Rutgers University] at 22:48 05 April 2015
This work was the first time to show the conformation of a DNA-DNA polymerase I (KF) complex by STM. Sample solution was in low ionic strength and neutral pH; AMP and EDTA were used to inhibit the 3'-5' exonuclease activity; glycerol was used to protect enzyme from complete dehydration and denaturation. Enzyme was freshly added into sample just before scanning, the total time ofexperiment was less than one hour. All experiments were carried out at 0-4 oc. In these conditions, the complex is stable and the results represent the solution conformation of enzyme and DNA Because the binding of primer terminus to 3'-S' exonuclease requires a 3' hydroxyl group (4), the absence of3' hydroxyl group ofprimer terminus leads itto failure to bind to exonuclease site. Low tempreture protects primer strand from being melted out. So, the conformational observed in this experiment should represent the conformation of enzyme in polymerization state. Our work indicated STM is a useful tool to investigate the conformation of complex of DNA and DNA polymerase. It has the following advantages: fast; small amount of sample; low tempreture; solution sample and a direct image can be observed. But at the binding position of enzyme with DNA, the overlapping of two molecules makes it difficult to resolve the fine structure. Besides, in STM imagining, the dimensions of enzyme and DNA molecules and the shape of some structure were slightly different from that observed by other methods. In addition to the difference of sample condition, such as ionic strength, it also could be caused by the limitation ofSTM itself, as we observed in imaging DNA helix by STM (6). Since the STM tip scans over the surface of sample molecules, the resolution of the surface image would be limited by the contouring space of the object in sense of spatial hindance and local density of electronic state to allow the STM tip to scan. In this work, 10 nucleotides long single-stranded DNA appeared to be covered by enzyme. It is not clear whether or not it exists as a helix. We plan to further image a complex ofDNA polymerase I (KF) with a DNA fragment containing longer singlestranded part by STM. Kinetics (8), X-ray diffraction (2,3), energy transfer (9) and DNA crosslinking (10) indicated that the two activity sites of DNA polymerase I (KF) are separate, in editing state, the terminus of primer binds to exonuclease site requires that at least four base pairs of the primer strand must melt out; in polymerizing state, the active site of polymerase is the binding site of nucleotides and 3' terminus of primer. How the two separate active sites may work together to achieve high fidelity of DNA synthesis is greatly interested. Imagingofthe conformation of DNA-DNA polymerase complex in different states especially with mismatched or complementary primer terminus will give us more information. Study on conformation of DNA-DNA polymerase complex with mismatched primer terminus is undergoing in our laboratory. References and Footnotes I. Huberman, J.A and Kornberg, A.J Mol. Bioi. 55, 209-214 (1971). 2. Joyce, C.M., eta/., in Protein Structure, Folding and Design. UCLA Symposia on Molecular and Cellular Biology. ed. Oxender, D. (Alan R. Liss, Inc., New York) 197-205 (1986).
238
Lu eta/.
3. Beese, L.S. and Steitz, T.A, in Nucleic Acids and Molecular Biology, Vol 3, ed. by F. Eckstein and D.M.J. Lilley (Spring-Verlag Berlin Heidelberg) 28-43 (1989). 4. Kornberg, A, DNA Replication (W.H. Freeman San Francisco, CA) ( 1980). 5. Beebe, T.P., et al., Science 243, 370-372 (1989). 6. Li, M.Q., et al., European Nuclear Workshop in Suzdal, USSR 11, 18-23 ( 1989). 7. Amrein, M., Durr, R., Stasiak, A, Gross, H. and Travaglini, G., Science 243, 1708-1711 (1989). 8. Que, B.G., Downey, K.M. and So, AG., Biochemistry 17, 1603-1606 (1978). 9. Allen, D.J. and Benkovic, S.J., Biochemistry 28, 9586-9593 ( 1989). 10. Cowart, M., Gibson, K.J., Allen, D.J. and Benkovic, S.J., Biochemistry 28, 1975-1983 (1989). Date Received: June 8, 1991
Downloaded by [Rutgers University] at 22:48 05 April 2015
Communicated by the Editor Valery Ivanov
Journal of Biomolecular Structure and Dynamics Publication details, including instructions for authors and subscription information: http://www.tandfonline.com/loi/tbsd20
Conformation of DNA-DNA Polymerase I Complex Observed by Scanning Tunneling Microscopy a
b
a
Chang-De Lu , Min-Quian Li , Ming-Yan Qui , b
b
b
Xiao-Wei Yao , Yao-Liang Xu , Ming-Min Gu & Ju Hu
b
a
Shanghai Institute of Biochemistry Acedemia Sinica , 320 Yue-Yang Road, Shanghai , 200031 , China b
Institute of Nuclear Research Acedemia Sinica , P.O. Box 800204-3, Shanghai , 201800 , China Published online: 21 May 2012.
To cite this article: Chang-De Lu , Min-Quian Li , Ming-Yan Qui , Xiao-Wei Yao , Yao-Liang Xu , Ming-Min Gu & Ju Hu (1991) Conformation of DNA-DNA Polymerase I Complex Observed by Scanning Tunneling Microscopy, Journal of Biomolecular Structure and Dynamics, 9:2, 233-238, DOI: 10.1080/07391102.1991.10507909 To link to this article: http://dx.doi.org/10.1080/07391102.1991.10507909
PLEASE SCROLL DOWN FOR ARTICLE Taylor & Francis makes every effort to ensure the accuracy of all the information (the “Content”) contained in the publications on our platform. However, Taylor & Francis, our agents, and our licensors make no representations or warranties whatsoever as to the accuracy, completeness, or suitability for any purpose of the Content. Any opinions and views expressed in this publication are the opinions and views of the authors, and are not the views of or endorsed by Taylor & Francis. The accuracy of the Content should not be relied upon and should be independently verified with primary sources of information. Taylor and Francis shall not be liable for any
losses, actions, claims, proceedings, demands, costs, expenses, damages, and other liabilities whatsoever or howsoever caused arising directly or indirectly in connection with, in relation to or arising out of the use of the Content.
Downloaded by [Rutgers University] at 22:48 05 April 2015
This article may be used for research, teaching, and private study purposes. Any substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any form to anyone is expressly forbidden. Terms & Conditions of access and use can be found at http://www.tandfonline.com/page/terms-and-conditions
Journal of Biomolecular Structure & Dynamics, /SSN 0739-1102 Volume 9,/ssue Number 2 (1991), ®Adenine Press (1991).
Conformation of DNA-DNA Polymerase I Complex Observed by Scanning Tunneling Microscopy Chang-De Lu 1, Min-Quian Li2, Ming-Yan Qui 1, Xiao-Wei Yao 2 Yao-Liang Xu 2 , Ming-Min Gu2 and Ju Hu2 Downloaded by [Rutgers University] at 22:48 05 April 2015
1
Shanghai Institute of Biochemistry Acedemia Sinica 320 Yue-Yang Road Shanghai 200031, China 2
Institute of Nuclear Research Acedemia Sinica P.O. Box 800204-3 Shanghai 201800, China
Abstract The conformation of a complex of a 41 mer/31 mer DNA fragment and the Klenow fragment of DNA polymerase I of Escherichia coli was studied by scanning tunnelling microscopy (STM). The results shows that near two turns of double helix ofthis DNA fragment was outside of enzyme while another part containing more than one turn of helix and 10 nucleotides single strand was combined with enzyme. The dimension and shape of DNA polymerase I (KF) in complex were different from that of free enzyme. The conformation of DNA-DNA polymerase I (KF) complex and the application ofSTM in studying structure of complex of DNA polymerase with DNA were discussed.
Introduction Because of the importance in ensuring the high fidelity of DNA replication, the interaction between DNA polymerase and DNA has been investigated with different kinds of method including electron microscopy (1), X-ray diffraction (2,3) etc. The Klenow fragment of DNA polymerase I of Escherichia coli having the polymerase and 3'-5' exoneclease (proofreading) functions in a single peptide (4) is an excellent model for investigating the molecular details of DNA replication. Although extensive efforts have been directed to the conformation of complex of Klenow enzyme with DNA, only one structure of a co-crystal ofKlenow fragment with DNA has been solved (3), it represents the conformation of editing state of enzyme. The conformation of enzyme in the polymerization state was still remained unreported. Recently, scanning tunnelling microscope (STM) has been used to study the structure ofbiological molecules such as B-DNA (5,6) and Rec A-DNA complex (7) etc. Here, we present the first image of DNA polymerase I (KF) and its complex with a DNA fragment by STM. Our results showed a conformational change of enzyme after binding with DNA
233
234
Lu eta/.
37 mer
30 mer
l
5'GAAAACTTTCCATTTGTTAACCATAGATCTAAGCTTG 3' 3'TAAACAATTGGTATCTAGATTCGAACTTAA 5' E. co 1i dATP, TTP DNA polymerase I ddGTP klenow Fragment MgCl Downloaded by [Rutgers University] at 22:48 05 April 2015
2
5'GAAAACTTTCCATTTGTTAACCATAGATCTAAGCTTGAATT 3 1 3'ddGTAAACAATTGGTATCTAGATTCGAACTTAA 5 1 I
30
20
10
Figure 1: Preparation and Sequence of 41 mer/31 mer DNA fragment.
In order to image the conformation ofDNA-DNA polymerase I (KF) complex by STM, a 41 mer/31 mer DNA fragment including 31 base pairs double stranded and 10 nucleotides single stranded 5' over hang was prepared from two chemically synthesized oligonucleotides 37 mer and 30 mer as shown in Figure 1. Figure 2a shows an image of a DNA polymerase I (KF) by STM.It appears a ellipsoid of 55-60 Awide and 70-7 5 Along, with a hollow cleft in the middle. Figure 2b indicates the profile of probe displacement along the line AB. According the proftle of probe displacement, the cleft offree enzyme was of ~ 20 Awide and ~ 24 Adeep and the apparent height of enzyme was ~ 43 A. Structural information obtained by X-ray diffraction indicated that Klenowfragment structure has two domains. The smaller domain contains the active site of3'-5' exonuclease. The large domain has DNA polymerase activity. In the large domain, there is a cleft of20-24 Awide and 25-35 A deep. This size and shape is of the appropriate dimensions to bind a B-DNA double helix. The image of DNA polymerase I (KF) observed by STM was in agreement with the model predicted by X-ray diffraction study. Figure 3a shows an image of 41 mer/31 mer DNA-DNA polymerase I (KF) complex. Figure 3b is the structure model of this complex. In this image, enzyme bound at the 3' end of primer, near two turns of right-handed helix DNA was outside of enzyme, the pitch was in the range of32-38 Aand the diameter of helix was 20-22 A the remaining part of 41 mer/31 mer DNA fragment including more than one tum double stranded and 10 nucleotides long single stranded DNA was combined with the enzyme. Our previous experiment of DNase I hydrolysis protection of DNA showed that 14 nucleotides upstream of primer terminus were protected by DNA polymerase I (KF) (unpublished data). Joyce et al. observed that 12-15 bp upstream and 9 bp downstream in template/primer were protected by DNA polymerase I (KF) from DNase I hydrolysis (2). The result observed with STM agrees with the DNase I hydrolysis protection experiments. The DNA looks to be bound into the cleft of enzyme. After binding with DNA, the width of DNA polymerase I (KF) was changed from 55-60 Ato 75-80 A. Compared to ellipsoid free enzyme the shape of enzyme was also changed.
235
Downloaded by [Rutgers University] at 22:48 05 April 2015
DNA-DNA Polymerase I Complex
Figure 2: a) Image ofKlenowFragmentofDNA polymerase I ofE. Coli. An aliquotof2 J.!l containing0.04 unit ofE. coli DNA polymerase I (KF) was deposited on freshly cleaved highly orianted pyrolytic graghite then was dehydrated to a thin layer under vacuum for serveral minutes. STM image was carried out with a self-designed STM instrument. Polished Pt-Ir tips were used for scanning. The sample bias was+ 100mV and constant feedback current was kept at 0.2 nA A lateral resolution of 1-2 A and a vertical resolution of 0.1 A was checked from the atomic structure of the graphite support before each measurement. The seals were as indicated in Figure 2b) Profile of probe displacement along line AB shown in 2a.
Lu eta/.
Downloaded by [Rutgers University] at 22:48 05 April 2015
236
3b Figure 3: a) Image of 41 mer/31 mer DNA-DNA polymerase I (KF) complex. An aliquot of2 jll containing 0.15 Alffi /ml of 41 mer/31 mer DNA, 0.04 unit of E. coli DNA polymerase I (KF), 10 mM Tris pH 7.8, I mM AMP, 0.5 mM EDTA, I% Glycerol was used. Sample treatment and STM image were carried out as the same as in Figure 2a. b) Structure model for 41 mer/31 mer DNA-DNA polymerase I (KF) complex shown in 3a.
DNA-DNA Polymerase I Complex
237
Downloaded by [Rutgers University] at 22:48 05 April 2015
This work was the first time to show the conformation of a DNA-DNA polymerase I (KF) complex by STM. Sample solution was in low ionic strength and neutral pH; AMP and EDTA were used to inhibit the 3'-5' exonuclease activity; glycerol was used to protect enzyme from complete dehydration and denaturation. Enzyme was freshly added into sample just before scanning, the total time ofexperiment was less than one hour. All experiments were carried out at 0-4 oc. In these conditions, the complex is stable and the results represent the solution conformation of enzyme and DNA Because the binding of primer terminus to 3'-S' exonuclease requires a 3' hydroxyl group (4), the absence of3' hydroxyl group ofprimer terminus leads itto failure to bind to exonuclease site. Low tempreture protects primer strand from being melted out. So, the conformational observed in this experiment should represent the conformation of enzyme in polymerization state. Our work indicated STM is a useful tool to investigate the conformation of complex of DNA and DNA polymerase. It has the following advantages: fast; small amount of sample; low tempreture; solution sample and a direct image can be observed. But at the binding position of enzyme with DNA, the overlapping of two molecules makes it difficult to resolve the fine structure. Besides, in STM imagining, the dimensions of enzyme and DNA molecules and the shape of some structure were slightly different from that observed by other methods. In addition to the difference of sample condition, such as ionic strength, it also could be caused by the limitation ofSTM itself, as we observed in imaging DNA helix by STM (6). Since the STM tip scans over the surface of sample molecules, the resolution of the surface image would be limited by the contouring space of the object in sense of spatial hindance and local density of electronic state to allow the STM tip to scan. In this work, 10 nucleotides long single-stranded DNA appeared to be covered by enzyme. It is not clear whether or not it exists as a helix. We plan to further image a complex ofDNA polymerase I (KF) with a DNA fragment containing longer singlestranded part by STM. Kinetics (8), X-ray diffraction (2,3), energy transfer (9) and DNA crosslinking (10) indicated that the two activity sites of DNA polymerase I (KF) are separate, in editing state, the terminus of primer binds to exonuclease site requires that at least four base pairs of the primer strand must melt out; in polymerizing state, the active site of polymerase is the binding site of nucleotides and 3' terminus of primer. How the two separate active sites may work together to achieve high fidelity of DNA synthesis is greatly interested. Imagingofthe conformation of DNA-DNA polymerase complex in different states especially with mismatched or complementary primer terminus will give us more information. Study on conformation of DNA-DNA polymerase complex with mismatched primer terminus is undergoing in our laboratory. References and Footnotes I. Huberman, J.A and Kornberg, A.J Mol. Bioi. 55, 209-214 (1971). 2. Joyce, C.M., eta/., in Protein Structure, Folding and Design. UCLA Symposia on Molecular and Cellular Biology. ed. Oxender, D. (Alan R. Liss, Inc., New York) 197-205 (1986).
238
Lu eta/.
3. Beese, L.S. and Steitz, T.A, in Nucleic Acids and Molecular Biology, Vol 3, ed. by F. Eckstein and D.M.J. Lilley (Spring-Verlag Berlin Heidelberg) 28-43 (1989). 4. Kornberg, A, DNA Replication (W.H. Freeman San Francisco, CA) ( 1980). 5. Beebe, T.P., et al., Science 243, 370-372 (1989). 6. Li, M.Q., et al., European Nuclear Workshop in Suzdal, USSR 11, 18-23 ( 1989). 7. Amrein, M., Durr, R., Stasiak, A, Gross, H. and Travaglini, G., Science 243, 1708-1711 (1989). 8. Que, B.G., Downey, K.M. and So, AG., Biochemistry 17, 1603-1606 (1978). 9. Allen, D.J. and Benkovic, S.J., Biochemistry 28, 9586-9593 ( 1989). 10. Cowart, M., Gibson, K.J., Allen, D.J. and Benkovic, S.J., Biochemistry 28, 1975-1983 (1989). Date Received: June 8, 1991
Downloaded by [Rutgers University] at 22:48 05 April 2015
Communicated by the Editor Valery Ivanov
