Virus Genes DOI 10.1007/s11262-014-1078-4
Complete sequence and phylogenetic analysis of a porcine sapovirus strain isolated from western China Wei Liu • Bin Yang • Enli Wang • Jixing Liu Xi Lan
•
Received: 3 March 2014 / Accepted: 14 April 2014 Ó Springer Science+Business Media New York 2014
Abstract Sapovirus (SaV) is a type of calicivirus that can cause acute viral gastroenteritis in humans and animals. SaVs have been found in several mammalian species, including humans, pigs, minks, dogs, and bats. Porcine sapovirus (PoSaV) was first identified in 1980 in the United States and has been found to be circulating throughout China in recent years. In this study, the complete genomic characterization of PoSaV CH430, first found in west China, was reported and analyzed. The genome was 7,342 bp excluding the 30 nt poly(A) tail at the 30 terminus and comprised two major open reading frames. Comprehensive evolutionary and phylogenetic analyses indicated that the CH430 strain belongs to genotype III SaVs. However, this particular isolate and DG24 strain occupied an independent branch of the phylogenetic tree we generated, indicating that they could form a separate subgenotype in the near future. We predicted the cleavage sites for the ORF1 polyprotein located at Q56/ G57, Q310/A311, E649/A650, E934/A935, E1047/G1048, and E1712/ A1713, separately. This is the first PoSaV strain isolated from western China to be fully sequenced and characterized. It provided a reliable experimental basis for studying the genetic nature of emerging PoSaVs. Keywords Porcine Sapovirus Complete genome Sequence analysis Northwest China
W. Liu B. Yang E. Wang J. Liu X. Lan (&) State Key Laboratory of Veterinary Etiological Biology, Key Laboratory of Grazing Animal Diseases, Lanzhou Veterinary Research Institute Chinese Academy of Agricultural Sciences, Lanzhou 730046, China e-mail: [email protected] E. Wang College of Veterinary Medicine, Gansu Agricultural University, Lanzhou 730070, China
Introduction Caliciviridae virus particles are nonenveloped, have a diameter in the range of 27–40 nm, and contain singlestranded, positive-sense RNA genomes of 7.4–8.3 kb [1]. Members of the Caliciviridae family can be divided among five genera: vesiviruses; lagoviruses; noroviruses (NoVs); Nebovirus; and sapoviruses (SaVs). The prototype SaV strain was first detected in 1977 in Japan [2]. SaVs have been detected in humans [3], pigs [4], cattle [5], dogs [6], bats [7], and mink [8] and are one of the major causes of acute viral gastroenteritis, especially in younger individuals. The SaV genome typically encodes two or three open reading frames (ORFs). ORF1 encoded a polyprotein that is cleaved by a viral protease to form nonstructural proteins and the major capsid protein (VP1). ORF2 encoded a small structural protein (VP2) of unknown function, while ORF3 encoded a basic protein associated with effective replication of the virus [9]. The poly(A) tail at the 30 end of the genome possibly affected the adaptability and virulence of the virus [10]. Porcine SaVs (PoSaVs) were identified for the first time in the fecal samples of the US piglets in 1980 [11], and genetically were characterized in 1999 [4]. In recent years, SaVs were detected from swine samples in many countries, such as Canada, Japan, the Netherlands, England, North Korea, and China [4, 12–15]. The prevalence of these PoSaVs is relatively high in premises where pigs are housed [16]. Recent research has shown that some PoSaVs have been detected in asymptomatic pigs [12], and these viruses are able to infect humans [17]. Therefore, they posed a potential public health threat to humans. In this study, a PoSaV detected from the piglets with serious diarrhea in west China was reported, and the complete genomic characterization was analyzed.
123
Virus Genes
Methods Viral specimens and extraction of total RNA Fecal samples from pigs with diarrhea were collected from pig farms around Gansu Province, China. Samples were homogenized in phosphate-buffered saline (PBS; 0.01 M, pH 7.2–7.4) to achieve a 10 % (w/v) solution, and then clarified by centrifugation at 10,000 9 g for 10 min. Viral RNA was extracted from 160 lL of the supernatant using RNeasy Mini Kit (QIAGEN, Shanghai, China) according to the manufacturer’s instructions. Purified RNA was eluted with 35 lL of RNase-free water and reserved. Primer design For amplification and sequencing of the entire genome, 10 primer sets (Table 1) were designed based on the sequences of PoSaVs (GenBank accession numbers FJ387164, AF182760, and JX678943), using the Primer5 and oligo6 software applications. Cloning the full-length viral genome Purified RNA was subjected to one-step RT-PCR assays for entire genome amplification using 10 sets of specific primers (Table 1). The one-step RT-PCR was conducted with the aid of a kit (Takara, China), and each reaction mixture comprised 7 lL of RNA template, 1 lL of each primer (25 mM), 5 lL of 10 9 one-step RNA PCR Buffer, Table 1 The sequences of oligonucleotide primers used for amplification and sequencing of the entire genome
Sequencing and phylogenetic analysis Amplified fragments were visualized on 1.5 % (w/v) agarose gels in TAE (0.04 M Tris-acetate, 0.001 M EDTA) buffer and purified using an AxyPrep DNA Gel Extraction Kit (Axygene, Silicon Valley, USA). The purified products were then cloned into the pGEM-T Easy Vector (Promega, UK) at 16 °C for 4 h. Ligated products were transformed into competent JM109 Escherichia coli cells, and recombinant clones screened on LB/ampicillin/IPTG/X-Gal plates after incubation at 37 °C overnight. We picked and sequenced three–five white colonies for each product. We sequenced ten segments, including the 50 and 30 ends of the genome, with alignment, editing, and assembly of
Sequence of primers (50 –30 )
Position
Amplicon length (bp)
Primer set
Primer name
1
Seau1
GGAAGAAATCGTCCACCAC
199–181
199
2
Ses2 Sea2
TGCCGTCCGTTGCCTAT CCACCATGCCTTGAACTTGC
19–36 918–899
899
3
Ses3
GCTGCCACATTGACTGCC
778–795
656
Sea3
TTCCACCACCCGTGTTTT
1434–1417
Ses4
AAACACGGCTGGTAGAAG
1418–1435
Sea4
TGGGTCCACATCAGAAATCA
2139–2120
Ses5
GCTGCGGTTCCACTCTTA
2034–2052
Sea5
CTGCCACTCATCATACTCATCG
2889–2868
6
Ses6
CTGAGCGAGGCTAAAGGG
2803–2320
Sea6
TTGAGGCTGTGGCTGGTG
4681–4664
7
Ses7
GCCGTTCACCAGYGTMATAA
4509–4528
Sea7
GTGTGKTCCARGTRACRTT
5353–5335
Ses8
GAAGTGTWTGTGATGGAGG
5128–5146
Sea8
GMCGAATCWGGGTAGTG
6098–6082
9
Ses9
CACAMCARATCAACCRCCA
5909–5927
Sea9
CACCTRCTAYCCAACTCAT
6789–6771
10
Sesu10
ATGCTCTGGGTGGARWCTGT
6448–6467
4 5
8
123
10 lL of MgCl2 (25 mM), 5 lL of dNTP mixture (10 mM each dNTP), 40 U of RNase inhibitor, 5 U of AMV RTase XL, 5 U of AMV-Optimized Raq, and RNase-free sterilized H2O to 50 lL. The thermal cycling conditions involved 45 min of reverse transcription at 50 °C, then 5 min of denaturation at 94 °C, followed by 35 cycles of 30 s at 94 °C, 40 s at 50 °C, and 2 min at 72 °C. The reaction was terminated with a final extension step at 72 °C for 15 min. For the 50 and 30 termini of the genome, these were amplified with primers seau1: 50 - GGAAGAAATC GTCCACCAC-30 and sesu10: 50 -ATGCTCTGGGTGG ARWCTGT-30 , respectively, in conjunction with anchor primers from a SMART RACE cDNA Amplification Kit (Clontech, Takara, Dalian, China) following the manufacturer’s protocols.
721 855 1878 844 970 880 924
Virus Genes
the complete genome sequence done with the assistance of BLASTN from the National Center for Biotechnology Information (NCBI) website. The MegAlign program was used to calculate the genetic distances between sequences, following multiple and pairwise alignments with ClustalW [18], and to deduce the amino acid sequence. Neighborjoining trees and maximum likelihood trees were constructed using ClustalW, within the MEGA5 software package [19], applying 1,000 bootstrap replicates.
Results and discussion Genome organization This viral genome sequence was deposited in GenBank (Accession Number KF204570) with a strain designation of PoSaV CH430. The PoSaV CH430 genome was 7342 nt excluding the 30-nt poly(A) tail at the 30 terminus. The genomic organization of PoSaV CH430 was typical of other viruses in the SaV genus, with a 10-nt 50 untranslated region (UTR), and two ORFs, and a 55-nt 30 UTR (Fig. 1). The conserved sequence motif at the 50 terminus of the genomic and predicted subgenomic RNA of PoSaV CH430 contained a Kozak sequence (underlined) (GTGA/TTCGTGATGGC/ AT/G), which was beneficial for translation initiation of eukaryotic mRNA [20]. In Rabbit Hemorrhagic Disease Virus (RHDV), the capsid protein could be translated from the genomic and subgenomic RNA [21]; thus, these sequences could play an important role in the replication, and coupled transcription and translation of genomic and subgenomic RNAs. ORF1 comprised 6,765 nt encoding a single polyprotein of 2,254 aa with characteristic amino acid motifs: 2C helicase at residue 464 (GPPGIGKT), VPg at residue 936 (KGKNK) and 954 (DEYDE), 3C-like protease at residue 1161 (GDCG), 3D RNA-dependent RNA polymerase at
Fig. 1 Schematic of PoSaV CH430 genome organization and function. The nucleotide coordinates of the 50 UTR, ORFs 1 and 2, and the 30 UTR are numbered above or below the genome map. ORF1 encoded a single polyprotein that was co-translationally processed by
residue 1495 (GLPSG) and 1543 (YGDD), and capsid protein at residue 1,838 (PPG). These are highly conserved in all Caliciviridae strains [4, 19, 22]. All the caliciviruses had a common feature with the proteolytic processing of the ORF1 polyprotein [1]. The precursor polyprotein was predicted to be co- or post-translationally cleaved into the following proteins: p11; p28; NTPase; p32; viral genomelinked protein (VPg); p70 (pro-pol); and capsid protein VP1 (542 amino acids). Based on comparison with the ORF1 cleavage map of SaV/Mc10 [23, 24], we predicted the cleavage site that generates these cleavage products (p11/p28, p28/NTPase, NTPase/protein p32, p32/VPg, VPg/p70, and p70/VP1) to be located at Q56/G57, Q310/ A311, E649/A650, E934/A935, E1047/G1048, and E1712/A1713, respectively (Fig. 1). This result was consistent with the conclusion that dipeptides for the cleavage sites were either E or Q at the P1 position (the amino acid immediately upstream of the scissile bond) and A, G, or S at the P10 position (the amino acid immediately downstream of the scissile bond) [24]. ORF2 comprised 516 nt (nt 6771–7286) and contained a 4-nt overlapping region (6771ATGA6774) with the 30 end of ORF1. This ORF encoded the minor structural protein VP2 (171 amino acids). Although it shared 90.6 % amino acid sequence identity with the PEC strain (GenBank: AF182760), PoSaV CH430 had a 21-nt insertion at the 30 end of ORF2 (nt 7199–7219). Research has shown that this inserted sequence enriched of antigenic site likely affected the antigenicity profile of the capsid protein [22]. Amino acid sequence comparison of the VP1 capsid protein The PoSaV CH430 capsid protein (542 amino acids) was slightly shorter than that of other animal SaVs and had lowamino acid sequence identities with the capsid proteins of human (43.9 %; GenBank: BAN62699), canine (42.9 %; GenBank: AEL19657), mink (39.5 %; GenBank:
the viral protease, resulting in six nonstructural proteins and the VP1 capsid protein. ORF2 encoded the small VP2 structural protein (171 amino acids). The putative cleavage sites at the interface of the six nonstructural proteins are shown
123
Virus Genes
AAN64326), sea lion (44.5 %; GenBank: AEM37581), and bat (38.5 %; GenBank: AFJ39353). According to the amino acid sequence characterization and structure, VP1 was divided into S (shell) domain and P (protruding) domain. S domain (amino acids 1–219) was highly conserved and had high amino acid sequence identity with the corresponding region in human and other animal SaVs (43.1–60.5 %). The S domain folded into a classical eightstranded b-barrel, which formed the icosahedral shell and maintained the structure of viral capsid as in Norwalk virus (NV) [25]. The structure of S domain in PoSaV CH430, forecasted using the bioinformatics software SWISSMODEL, was very similar to that in NV. Therefore, we postulated that the S domain possesses the same function in SaVs. The P domain (amino acids 220–542) was a hypervariable region containing several significant inserts between the strains in different species; this region might contain multiple antigenic determinants [4]. Variations in this protein were correlated with viral capsid diversity and host specificity.
Fig. 2 Comparison of the complete sequence of Caliciviridae members using a phylogenetic tree generated by the neighbor-joining method. PoSaV CH430 belongs to SaV genus. The scale bar indicates the number of substitutions per site. GeneBank accession numbers and country: Sapovirus Hu/Dresden/pJG-Sap01/DE, AY694184, Germany; Sapovirus Mc114, AY237422, Japan; Sapovirus Mc10, NC_010624, Thailand; Sapovirus SaKaeo-15/Thailand, AY646855, Thailand; Hu/SV/Chiba/000671/1999/JP, AJ786349, Japan; Sapovirus NongKhai-24/Thailand, AY646856, Thailand; Porcine enteric sapovirus strain ah-1, JX678943, China; Sapovirus pig/sav1/2008/ CHN, FJ387164, China; Porcine enteric sapovirus, AF182760,
123
Multiple sequence alignment and phylogenetic analysis The phylogenetic trees constructed using neighbor-joining and maximum likelihood method had the same results, and so only the neighbor-joining phylogenetic trees are shown. The entire sequence of PoSaV CH430 was compared with the other members of the Caliciviridae. The phylogenetic tree (Fig. 2) revealed that PoSaV CH430 belongs to the SaV genus. Phylogenetic analysis showed that PoSaV CH430 has a high nucleotide sequence identity with GIII members (47.5–85.7 %). It shared a low-nucleotide sequence identity (\39.4 %) with the members of other Caliciviridae genera. Phylogenetic tree of VP1 using 36 SaV strains of varying genotypes indicated that SaV has 13 distinct major phylogenetic groups, corresponding to GI–X and three unclassified animal SaVs (Fig. 3). Further phylogenetic analysis showed that there was a high amino acid identity for PoSaV CH430 with other GIII members (86.9–98.7 %) based on the VP1 amino acid sequence. The highest amino acid sequence identity (98.7 %) was found with the Korea
America; Bat sapovirus TLC58/HK, JN899075, Hong Kong; Norwalk virus, M87661, America; Norovirus Hu/NLV/Oxford/B4S4/2002/UK, AY587986, United Kingdom; Norovirus mouse/Hannover1/2007/ DEU, EU854589, Germany; Bo/Dumfries/94/UK, AY126474, United Kingdom; Feline calicivirus, M86379, United Kingdom; San Miguel sea lion virus serotype 1, SMU15301, America; Rabbit hemorrhagic disease virus-FRG, M67473, Germany; European brown hare syndrome virus RNA, Z69620, France; Norovirus pig/GII/Ch6/ China/2009,HQ392821, China; Norovirus swine/GII/OH-QW125/ 03/US, AY823305, America
Virus Genes Fig. 3 A phylogenetic tree was constructed using MEGA 5 to compare VP1 amino acid sequence of numerous SaVs. GenBank accession numbers and names are shown. Genotypes are indicated to the right. Two new porcine sapovirus were named as GX. The scale bar indicates the number of substitutions per site
DG24 strain (GenBank: ADN84678) not with the Chinese strain. It indicated that they evolved from the same source, which may be related to international trade of live pigs. The PoSaV CH430 strain shared 32.4–44.6 % amino acid sequence identity with other SaV genotypes. The GIII members can be further divided into five distinct subgroups. The topology of the phylogenetic tree indicates that PoSaV CH430 belongs to GIII of sapovirus genus and forms an independent branch with the DG24 strain and could be regarded as a separate subgenotype in the near future. The majority of PoSaV strains have been characterized as GIII. However, a number of novel animal SaV strains have been recently reported and have been found to be distantly related to the GIII PEC strain of PoSaV. Genotypes of SaVs isolated from human and GIII PoSaVs can be further subdivided into several subgenotypes or clusters. According to sequence alignment and phylogenetic analyses, the CH430 strain of PoSaV belongs to GIII. The CH430 strain was the first PoSaVs strain being sequenced in the northwest of china. It provided a reliable
experimental basis for studying the genetic nature of emerging PoSaVs.
References 1. K. Green, T. Ando, M. Balayan, T. Berke, I. Clarke, M. Estes, D. Matson, S. Nakata, J. Neill, M. Studdert, J. Infect. Dis. 181, S322–S330 (2000) 2. S. Chiba, Y. Sakuma, R. Kogasaka, M. Akihara, K. Horino, T. Nakao, S. Fukui, J. Med. Virol. 4, 249–254 (1979) 3. G.S. Hansman, N. Takeda, K. Katayama, E.T. Tu, C.J. McIver, W.D. Rawlinson, P.A. White, Emerg. Infect. Dis. 12, 141 (2006) 4. M. Guo, K. Chang, M. Hardy, Q. Zhang, A. Parwani, L. Saif, J. Virol. 73, 9625–9631 (1999) 5. J.Z. Mijovski, M. Poljsˇak-Prijatelj, A. Steyer, D. Barlicˇ-Maganja, S. Koren, Infect. Genet. Evol. 10, 413–420 (2010) 6. L. Li, P.A. Pesavento, T. Shan, C.M. Leutenegger, C. Wang, E. Delwart, J. Gen. Virol. 92, 2534–2541 (2011) 7. H. Tse, W.-M. Chan, K.S. Li, S.K. Lau, P.C. Woo, K.-Y. Yuen, PLoS ONE 7, e34987 (2012) 8. M. Guo, J. Evermann, L. Saif, Arch. Virol. 146, 479–493 (2001) 9. G.S. Hansman, T. Oka, K. Katayama, N. Takeda, Rev. Med. Virol. 17, 133–141 (2007)
123
Virus Genes 10. D. Bailey, W.J. Kaiser, M. Hollinshead, K. Moffat, Y. Chaudhry, T. Wileman, S.V. Sosnovtsev, I.G. Goodfellow, J. Gen. Virol. 91, 739–749 (2010) 11. L.J. Saif, E.H. Bohl, K.W. Theil, R.F. Cross, J.A. House, J. Clin. Microbiol. 12, 105–111 (1980) 12. P. Collins, V. Martella, C. Buonavoglia, H. O’Shea, Vet. Microbiol. 139, 176–182 (2009) 13. H. Kim, H. Cho, K. Cho, N. Park, J. Vet. Med. Ser. B 53, 155–159 (2006) 14. Y. L’Homme, R. Sansregret, E´. Plante-Fortier, A.-M. Lamontagne, G. Lacroix, M. Ouardani, J. Deschamps, G. Simard, C. Simard, Arch. Virol. 154, 581–593 (2009) 15. G. Reuter, J. Zimsˇek-Mijovski, M. Poljsˇak-Prijatelj, I. Di Bartolo, F.M. Ruggeri, T. Kantala, L. Maunula, I. Kiss, S. Kecskeme´ti, N. Halaihel, J. Clin. Microbiol. 48, 363–368 (2010) 16. Q.-H. Wang, M. Souza, J.A. Funk, W. Zhang, L.J. Saif, J. Clin. Microbiol. 44, 2057–2062 (2006) 17. V. Martella, E. Lorusso, K. Banyai, N. Decaro, M. Corrente, G. Elia, A. Cavalli, A. Radogna, V. Costantini, L. Saif, J. Clin. Microbiol. 46, 1907–1913 (2008)
123
18. K. Tamura, D. Peterson, N. Peterson, G. Stecher, M. Nei, S. Kumar, Mol. Biol. Evol. 28, 2731–2739 (2011) 19. J.D. Thompson, D.G. Higgins, T.J. Gibson, Nucleic Acids Res. 22, 4673–4680 (1994) 20. M. Kozak, J. Biol. Chem. 266, 19867–19870 (1991) 21. M. Sibilia, M.B. Boniotti, P. Angoscini, L. Capucci, C. Rossi, J. Virol. 69, 5812–5815 (1995) 22. S. Yang, W. Zhang, Q. Shen, F. Huang, Y. Wang, J. Zhu, L. Cui, Z. Yang, X. Hua, Virol. J 6, 216 (2009) 23. T. Oka, K. Katayama, S. Ogawa, G.S. Hansman, T. Kageyama, H. Ushijima, T. Miyamura, N. Takeda, J. Virol. 79, 7283–7290 (2005) 24. T. Oka, M. Yamamoto, K. Katayama, G.S. Hansman, S. Ogawa, T. Miyamura, N. Takeda, J. Gen. Virol. 87, 3329–3338 (2006) 25. B.V. Prasad, M.E. Hardy, T. Dokland, J. Bella, M.G. Rossmann, M.K. Estes, Science 286, 287–290 (1999)
Complete sequence and phylogenetic analysis of a porcine sapovirus strain isolated from western China Wei Liu • Bin Yang • Enli Wang • Jixing Liu Xi Lan
•
Received: 3 March 2014 / Accepted: 14 April 2014 Ó Springer Science+Business Media New York 2014
Abstract Sapovirus (SaV) is a type of calicivirus that can cause acute viral gastroenteritis in humans and animals. SaVs have been found in several mammalian species, including humans, pigs, minks, dogs, and bats. Porcine sapovirus (PoSaV) was first identified in 1980 in the United States and has been found to be circulating throughout China in recent years. In this study, the complete genomic characterization of PoSaV CH430, first found in west China, was reported and analyzed. The genome was 7,342 bp excluding the 30 nt poly(A) tail at the 30 terminus and comprised two major open reading frames. Comprehensive evolutionary and phylogenetic analyses indicated that the CH430 strain belongs to genotype III SaVs. However, this particular isolate and DG24 strain occupied an independent branch of the phylogenetic tree we generated, indicating that they could form a separate subgenotype in the near future. We predicted the cleavage sites for the ORF1 polyprotein located at Q56/ G57, Q310/A311, E649/A650, E934/A935, E1047/G1048, and E1712/ A1713, separately. This is the first PoSaV strain isolated from western China to be fully sequenced and characterized. It provided a reliable experimental basis for studying the genetic nature of emerging PoSaVs. Keywords Porcine Sapovirus Complete genome Sequence analysis Northwest China
W. Liu B. Yang E. Wang J. Liu X. Lan (&) State Key Laboratory of Veterinary Etiological Biology, Key Laboratory of Grazing Animal Diseases, Lanzhou Veterinary Research Institute Chinese Academy of Agricultural Sciences, Lanzhou 730046, China e-mail: [email protected] E. Wang College of Veterinary Medicine, Gansu Agricultural University, Lanzhou 730070, China
Introduction Caliciviridae virus particles are nonenveloped, have a diameter in the range of 27–40 nm, and contain singlestranded, positive-sense RNA genomes of 7.4–8.3 kb [1]. Members of the Caliciviridae family can be divided among five genera: vesiviruses; lagoviruses; noroviruses (NoVs); Nebovirus; and sapoviruses (SaVs). The prototype SaV strain was first detected in 1977 in Japan [2]. SaVs have been detected in humans [3], pigs [4], cattle [5], dogs [6], bats [7], and mink [8] and are one of the major causes of acute viral gastroenteritis, especially in younger individuals. The SaV genome typically encodes two or three open reading frames (ORFs). ORF1 encoded a polyprotein that is cleaved by a viral protease to form nonstructural proteins and the major capsid protein (VP1). ORF2 encoded a small structural protein (VP2) of unknown function, while ORF3 encoded a basic protein associated with effective replication of the virus [9]. The poly(A) tail at the 30 end of the genome possibly affected the adaptability and virulence of the virus [10]. Porcine SaVs (PoSaVs) were identified for the first time in the fecal samples of the US piglets in 1980 [11], and genetically were characterized in 1999 [4]. In recent years, SaVs were detected from swine samples in many countries, such as Canada, Japan, the Netherlands, England, North Korea, and China [4, 12–15]. The prevalence of these PoSaVs is relatively high in premises where pigs are housed [16]. Recent research has shown that some PoSaVs have been detected in asymptomatic pigs [12], and these viruses are able to infect humans [17]. Therefore, they posed a potential public health threat to humans. In this study, a PoSaV detected from the piglets with serious diarrhea in west China was reported, and the complete genomic characterization was analyzed.
123
Virus Genes
Methods Viral specimens and extraction of total RNA Fecal samples from pigs with diarrhea were collected from pig farms around Gansu Province, China. Samples were homogenized in phosphate-buffered saline (PBS; 0.01 M, pH 7.2–7.4) to achieve a 10 % (w/v) solution, and then clarified by centrifugation at 10,000 9 g for 10 min. Viral RNA was extracted from 160 lL of the supernatant using RNeasy Mini Kit (QIAGEN, Shanghai, China) according to the manufacturer’s instructions. Purified RNA was eluted with 35 lL of RNase-free water and reserved. Primer design For amplification and sequencing of the entire genome, 10 primer sets (Table 1) were designed based on the sequences of PoSaVs (GenBank accession numbers FJ387164, AF182760, and JX678943), using the Primer5 and oligo6 software applications. Cloning the full-length viral genome Purified RNA was subjected to one-step RT-PCR assays for entire genome amplification using 10 sets of specific primers (Table 1). The one-step RT-PCR was conducted with the aid of a kit (Takara, China), and each reaction mixture comprised 7 lL of RNA template, 1 lL of each primer (25 mM), 5 lL of 10 9 one-step RNA PCR Buffer, Table 1 The sequences of oligonucleotide primers used for amplification and sequencing of the entire genome
Sequencing and phylogenetic analysis Amplified fragments were visualized on 1.5 % (w/v) agarose gels in TAE (0.04 M Tris-acetate, 0.001 M EDTA) buffer and purified using an AxyPrep DNA Gel Extraction Kit (Axygene, Silicon Valley, USA). The purified products were then cloned into the pGEM-T Easy Vector (Promega, UK) at 16 °C for 4 h. Ligated products were transformed into competent JM109 Escherichia coli cells, and recombinant clones screened on LB/ampicillin/IPTG/X-Gal plates after incubation at 37 °C overnight. We picked and sequenced three–five white colonies for each product. We sequenced ten segments, including the 50 and 30 ends of the genome, with alignment, editing, and assembly of
Sequence of primers (50 –30 )
Position
Amplicon length (bp)
Primer set
Primer name
1
Seau1
GGAAGAAATCGTCCACCAC
199–181
199
2
Ses2 Sea2
TGCCGTCCGTTGCCTAT CCACCATGCCTTGAACTTGC
19–36 918–899
899
3
Ses3
GCTGCCACATTGACTGCC
778–795
656
Sea3
TTCCACCACCCGTGTTTT
1434–1417
Ses4
AAACACGGCTGGTAGAAG
1418–1435
Sea4
TGGGTCCACATCAGAAATCA
2139–2120
Ses5
GCTGCGGTTCCACTCTTA
2034–2052
Sea5
CTGCCACTCATCATACTCATCG
2889–2868
6
Ses6
CTGAGCGAGGCTAAAGGG
2803–2320
Sea6
TTGAGGCTGTGGCTGGTG
4681–4664
7
Ses7
GCCGTTCACCAGYGTMATAA
4509–4528
Sea7
GTGTGKTCCARGTRACRTT
5353–5335
Ses8
GAAGTGTWTGTGATGGAGG
5128–5146
Sea8
GMCGAATCWGGGTAGTG
6098–6082
9
Ses9
CACAMCARATCAACCRCCA
5909–5927
Sea9
CACCTRCTAYCCAACTCAT
6789–6771
10
Sesu10
ATGCTCTGGGTGGARWCTGT
6448–6467
4 5
8
123
10 lL of MgCl2 (25 mM), 5 lL of dNTP mixture (10 mM each dNTP), 40 U of RNase inhibitor, 5 U of AMV RTase XL, 5 U of AMV-Optimized Raq, and RNase-free sterilized H2O to 50 lL. The thermal cycling conditions involved 45 min of reverse transcription at 50 °C, then 5 min of denaturation at 94 °C, followed by 35 cycles of 30 s at 94 °C, 40 s at 50 °C, and 2 min at 72 °C. The reaction was terminated with a final extension step at 72 °C for 15 min. For the 50 and 30 termini of the genome, these were amplified with primers seau1: 50 - GGAAGAAATC GTCCACCAC-30 and sesu10: 50 -ATGCTCTGGGTGG ARWCTGT-30 , respectively, in conjunction with anchor primers from a SMART RACE cDNA Amplification Kit (Clontech, Takara, Dalian, China) following the manufacturer’s protocols.
721 855 1878 844 970 880 924
Virus Genes
the complete genome sequence done with the assistance of BLASTN from the National Center for Biotechnology Information (NCBI) website. The MegAlign program was used to calculate the genetic distances between sequences, following multiple and pairwise alignments with ClustalW [18], and to deduce the amino acid sequence. Neighborjoining trees and maximum likelihood trees were constructed using ClustalW, within the MEGA5 software package [19], applying 1,000 bootstrap replicates.
Results and discussion Genome organization This viral genome sequence was deposited in GenBank (Accession Number KF204570) with a strain designation of PoSaV CH430. The PoSaV CH430 genome was 7342 nt excluding the 30-nt poly(A) tail at the 30 terminus. The genomic organization of PoSaV CH430 was typical of other viruses in the SaV genus, with a 10-nt 50 untranslated region (UTR), and two ORFs, and a 55-nt 30 UTR (Fig. 1). The conserved sequence motif at the 50 terminus of the genomic and predicted subgenomic RNA of PoSaV CH430 contained a Kozak sequence (underlined) (GTGA/TTCGTGATGGC/ AT/G), which was beneficial for translation initiation of eukaryotic mRNA [20]. In Rabbit Hemorrhagic Disease Virus (RHDV), the capsid protein could be translated from the genomic and subgenomic RNA [21]; thus, these sequences could play an important role in the replication, and coupled transcription and translation of genomic and subgenomic RNAs. ORF1 comprised 6,765 nt encoding a single polyprotein of 2,254 aa with characteristic amino acid motifs: 2C helicase at residue 464 (GPPGIGKT), VPg at residue 936 (KGKNK) and 954 (DEYDE), 3C-like protease at residue 1161 (GDCG), 3D RNA-dependent RNA polymerase at
Fig. 1 Schematic of PoSaV CH430 genome organization and function. The nucleotide coordinates of the 50 UTR, ORFs 1 and 2, and the 30 UTR are numbered above or below the genome map. ORF1 encoded a single polyprotein that was co-translationally processed by
residue 1495 (GLPSG) and 1543 (YGDD), and capsid protein at residue 1,838 (PPG). These are highly conserved in all Caliciviridae strains [4, 19, 22]. All the caliciviruses had a common feature with the proteolytic processing of the ORF1 polyprotein [1]. The precursor polyprotein was predicted to be co- or post-translationally cleaved into the following proteins: p11; p28; NTPase; p32; viral genomelinked protein (VPg); p70 (pro-pol); and capsid protein VP1 (542 amino acids). Based on comparison with the ORF1 cleavage map of SaV/Mc10 [23, 24], we predicted the cleavage site that generates these cleavage products (p11/p28, p28/NTPase, NTPase/protein p32, p32/VPg, VPg/p70, and p70/VP1) to be located at Q56/G57, Q310/ A311, E649/A650, E934/A935, E1047/G1048, and E1712/A1713, respectively (Fig. 1). This result was consistent with the conclusion that dipeptides for the cleavage sites were either E or Q at the P1 position (the amino acid immediately upstream of the scissile bond) and A, G, or S at the P10 position (the amino acid immediately downstream of the scissile bond) [24]. ORF2 comprised 516 nt (nt 6771–7286) and contained a 4-nt overlapping region (6771ATGA6774) with the 30 end of ORF1. This ORF encoded the minor structural protein VP2 (171 amino acids). Although it shared 90.6 % amino acid sequence identity with the PEC strain (GenBank: AF182760), PoSaV CH430 had a 21-nt insertion at the 30 end of ORF2 (nt 7199–7219). Research has shown that this inserted sequence enriched of antigenic site likely affected the antigenicity profile of the capsid protein [22]. Amino acid sequence comparison of the VP1 capsid protein The PoSaV CH430 capsid protein (542 amino acids) was slightly shorter than that of other animal SaVs and had lowamino acid sequence identities with the capsid proteins of human (43.9 %; GenBank: BAN62699), canine (42.9 %; GenBank: AEL19657), mink (39.5 %; GenBank:
the viral protease, resulting in six nonstructural proteins and the VP1 capsid protein. ORF2 encoded the small VP2 structural protein (171 amino acids). The putative cleavage sites at the interface of the six nonstructural proteins are shown
123
Virus Genes
AAN64326), sea lion (44.5 %; GenBank: AEM37581), and bat (38.5 %; GenBank: AFJ39353). According to the amino acid sequence characterization and structure, VP1 was divided into S (shell) domain and P (protruding) domain. S domain (amino acids 1–219) was highly conserved and had high amino acid sequence identity with the corresponding region in human and other animal SaVs (43.1–60.5 %). The S domain folded into a classical eightstranded b-barrel, which formed the icosahedral shell and maintained the structure of viral capsid as in Norwalk virus (NV) [25]. The structure of S domain in PoSaV CH430, forecasted using the bioinformatics software SWISSMODEL, was very similar to that in NV. Therefore, we postulated that the S domain possesses the same function in SaVs. The P domain (amino acids 220–542) was a hypervariable region containing several significant inserts between the strains in different species; this region might contain multiple antigenic determinants [4]. Variations in this protein were correlated with viral capsid diversity and host specificity.
Fig. 2 Comparison of the complete sequence of Caliciviridae members using a phylogenetic tree generated by the neighbor-joining method. PoSaV CH430 belongs to SaV genus. The scale bar indicates the number of substitutions per site. GeneBank accession numbers and country: Sapovirus Hu/Dresden/pJG-Sap01/DE, AY694184, Germany; Sapovirus Mc114, AY237422, Japan; Sapovirus Mc10, NC_010624, Thailand; Sapovirus SaKaeo-15/Thailand, AY646855, Thailand; Hu/SV/Chiba/000671/1999/JP, AJ786349, Japan; Sapovirus NongKhai-24/Thailand, AY646856, Thailand; Porcine enteric sapovirus strain ah-1, JX678943, China; Sapovirus pig/sav1/2008/ CHN, FJ387164, China; Porcine enteric sapovirus, AF182760,
123
Multiple sequence alignment and phylogenetic analysis The phylogenetic trees constructed using neighbor-joining and maximum likelihood method had the same results, and so only the neighbor-joining phylogenetic trees are shown. The entire sequence of PoSaV CH430 was compared with the other members of the Caliciviridae. The phylogenetic tree (Fig. 2) revealed that PoSaV CH430 belongs to the SaV genus. Phylogenetic analysis showed that PoSaV CH430 has a high nucleotide sequence identity with GIII members (47.5–85.7 %). It shared a low-nucleotide sequence identity (\39.4 %) with the members of other Caliciviridae genera. Phylogenetic tree of VP1 using 36 SaV strains of varying genotypes indicated that SaV has 13 distinct major phylogenetic groups, corresponding to GI–X and three unclassified animal SaVs (Fig. 3). Further phylogenetic analysis showed that there was a high amino acid identity for PoSaV CH430 with other GIII members (86.9–98.7 %) based on the VP1 amino acid sequence. The highest amino acid sequence identity (98.7 %) was found with the Korea
America; Bat sapovirus TLC58/HK, JN899075, Hong Kong; Norwalk virus, M87661, America; Norovirus Hu/NLV/Oxford/B4S4/2002/UK, AY587986, United Kingdom; Norovirus mouse/Hannover1/2007/ DEU, EU854589, Germany; Bo/Dumfries/94/UK, AY126474, United Kingdom; Feline calicivirus, M86379, United Kingdom; San Miguel sea lion virus serotype 1, SMU15301, America; Rabbit hemorrhagic disease virus-FRG, M67473, Germany; European brown hare syndrome virus RNA, Z69620, France; Norovirus pig/GII/Ch6/ China/2009,HQ392821, China; Norovirus swine/GII/OH-QW125/ 03/US, AY823305, America
Virus Genes Fig. 3 A phylogenetic tree was constructed using MEGA 5 to compare VP1 amino acid sequence of numerous SaVs. GenBank accession numbers and names are shown. Genotypes are indicated to the right. Two new porcine sapovirus were named as GX. The scale bar indicates the number of substitutions per site
DG24 strain (GenBank: ADN84678) not with the Chinese strain. It indicated that they evolved from the same source, which may be related to international trade of live pigs. The PoSaV CH430 strain shared 32.4–44.6 % amino acid sequence identity with other SaV genotypes. The GIII members can be further divided into five distinct subgroups. The topology of the phylogenetic tree indicates that PoSaV CH430 belongs to GIII of sapovirus genus and forms an independent branch with the DG24 strain and could be regarded as a separate subgenotype in the near future. The majority of PoSaV strains have been characterized as GIII. However, a number of novel animal SaV strains have been recently reported and have been found to be distantly related to the GIII PEC strain of PoSaV. Genotypes of SaVs isolated from human and GIII PoSaVs can be further subdivided into several subgenotypes or clusters. According to sequence alignment and phylogenetic analyses, the CH430 strain of PoSaV belongs to GIII. The CH430 strain was the first PoSaVs strain being sequenced in the northwest of china. It provided a reliable
experimental basis for studying the genetic nature of emerging PoSaVs.
References 1. K. Green, T. Ando, M. Balayan, T. Berke, I. Clarke, M. Estes, D. Matson, S. Nakata, J. Neill, M. Studdert, J. Infect. Dis. 181, S322–S330 (2000) 2. S. Chiba, Y. Sakuma, R. Kogasaka, M. Akihara, K. Horino, T. Nakao, S. Fukui, J. Med. Virol. 4, 249–254 (1979) 3. G.S. Hansman, N. Takeda, K. Katayama, E.T. Tu, C.J. McIver, W.D. Rawlinson, P.A. White, Emerg. Infect. Dis. 12, 141 (2006) 4. M. Guo, K. Chang, M. Hardy, Q. Zhang, A. Parwani, L. Saif, J. Virol. 73, 9625–9631 (1999) 5. J.Z. Mijovski, M. Poljsˇak-Prijatelj, A. Steyer, D. Barlicˇ-Maganja, S. Koren, Infect. Genet. Evol. 10, 413–420 (2010) 6. L. Li, P.A. Pesavento, T. Shan, C.M. Leutenegger, C. Wang, E. Delwart, J. Gen. Virol. 92, 2534–2541 (2011) 7. H. Tse, W.-M. Chan, K.S. Li, S.K. Lau, P.C. Woo, K.-Y. Yuen, PLoS ONE 7, e34987 (2012) 8. M. Guo, J. Evermann, L. Saif, Arch. Virol. 146, 479–493 (2001) 9. G.S. Hansman, T. Oka, K. Katayama, N. Takeda, Rev. Med. Virol. 17, 133–141 (2007)
123
Virus Genes 10. D. Bailey, W.J. Kaiser, M. Hollinshead, K. Moffat, Y. Chaudhry, T. Wileman, S.V. Sosnovtsev, I.G. Goodfellow, J. Gen. Virol. 91, 739–749 (2010) 11. L.J. Saif, E.H. Bohl, K.W. Theil, R.F. Cross, J.A. House, J. Clin. Microbiol. 12, 105–111 (1980) 12. P. Collins, V. Martella, C. Buonavoglia, H. O’Shea, Vet. Microbiol. 139, 176–182 (2009) 13. H. Kim, H. Cho, K. Cho, N. Park, J. Vet. Med. Ser. B 53, 155–159 (2006) 14. Y. L’Homme, R. Sansregret, E´. Plante-Fortier, A.-M. Lamontagne, G. Lacroix, M. Ouardani, J. Deschamps, G. Simard, C. Simard, Arch. Virol. 154, 581–593 (2009) 15. G. Reuter, J. Zimsˇek-Mijovski, M. Poljsˇak-Prijatelj, I. Di Bartolo, F.M. Ruggeri, T. Kantala, L. Maunula, I. Kiss, S. Kecskeme´ti, N. Halaihel, J. Clin. Microbiol. 48, 363–368 (2010) 16. Q.-H. Wang, M. Souza, J.A. Funk, W. Zhang, L.J. Saif, J. Clin. Microbiol. 44, 2057–2062 (2006) 17. V. Martella, E. Lorusso, K. Banyai, N. Decaro, M. Corrente, G. Elia, A. Cavalli, A. Radogna, V. Costantini, L. Saif, J. Clin. Microbiol. 46, 1907–1913 (2008)
123
18. K. Tamura, D. Peterson, N. Peterson, G. Stecher, M. Nei, S. Kumar, Mol. Biol. Evol. 28, 2731–2739 (2011) 19. J.D. Thompson, D.G. Higgins, T.J. Gibson, Nucleic Acids Res. 22, 4673–4680 (1994) 20. M. Kozak, J. Biol. Chem. 266, 19867–19870 (1991) 21. M. Sibilia, M.B. Boniotti, P. Angoscini, L. Capucci, C. Rossi, J. Virol. 69, 5812–5815 (1995) 22. S. Yang, W. Zhang, Q. Shen, F. Huang, Y. Wang, J. Zhu, L. Cui, Z. Yang, X. Hua, Virol. J 6, 216 (2009) 23. T. Oka, K. Katayama, S. Ogawa, G.S. Hansman, T. Kageyama, H. Ushijima, T. Miyamura, N. Takeda, J. Virol. 79, 7283–7290 (2005) 24. T. Oka, M. Yamamoto, K. Katayama, G.S. Hansman, S. Ogawa, T. Miyamura, N. Takeda, J. Gen. Virol. 87, 3329–3338 (2006) 25. B.V. Prasad, M.E. Hardy, T. Dokland, J. Bella, M.G. Rossmann, M.K. Estes, Science 286, 287–290 (1999)
