http://informahealthcare.com/mdn ISSN: 1940-1736 (print), 1940-1744 (electronic) Mitochondrial DNA, Early Online: 1–2 ! 2014 Informa UK Ltd. DOI: 10.3109/19401736.2014.926511
MITOGENOME ANNOUNCEMENT
Complete mitochondrial DNA genome of Bemisia tabaci cryptic pest species complex Asia I (Hemiptera: Aleyrodidae) W. T. Tay1, S. Elfekih1, L. Court1, K. H. Gordon1, and P. J. De Barro2 CSIRO Biosecurity Flagship, Black Mountain Laboratories, Canberra, Australia and 2CSIRO Ecosystem Sciences, Brisbane, Australia
Mitochondrial DNA Downloaded from informahealthcare.com by Fudan University on 05/12/15 For personal use only.
1
Abstract
Keywords
The complete length of the Asia I member of the Bemisia tabaci species complex mitochondrial DNA genome (mitogenome) is 15,210 bp (GenBank accession no. KJ778614) with an A-T biased nucleotide composition (A: 32.7%; T: 42.4%; G: 14.0%; C: 10.8%). The mitogenome consists of 13 protein-coding genes (PCGs), 22 transfer RNAs (tRNAs), 2 ribosomal RNA (rRNAs) and a 467 bp putative control region which also includes the A+T rich repeat region. All PCGs have an ATA (n ¼ 8) or ATG (n ¼ 5) start codon. Gene synteny of Asia I is overall similar to B. afer and two other members of the B. tabaci species complex Mediterranean and New World 1, and contains the tRNA-Ser2 located between the Cytb and ND1 genes found in Mediterranean and New World 1, but which is absent in B. afer. The orientation of the tRNA-Arg in Asia I is on the ‘‘plus’’ strand and differed from Mediterranean which is found on the ‘‘minus’’ strand. The Asia I mitogenome size is currently ranked the second smallest after B. afer (14,968 bp) followed by New World 1 (15,322 bp) and Mediterranean (15,632 bp).
Asia I, next generation sequencing, whitefly
Asia I belongs to the B. tabaci cryptic whitefly pest species complex (De Barro et al., 2011) that included the original B. tabaci (Mediterranean) species (Tay et al., 2012). All currently known ‘‘B. Tabaci’’ whiteflies fall into at least 11 major clades, with Asia I being the species within the Asia I clade (Boykin et al., 2013). Although it has been possible to demonstrate the delimitation of species’ boundaries in the B. tabaci pest species complex using just the mtCOI gene (Boykin et al., 2012), better understanding of evolutionary genetic relationships between members of this global pest species complex will greatly benefit from full mitogenome comparisons. Assembling complete mitogenomes in pest insects has been facilitated by next generation sequencing (NGS) technologies (e.g. Behere et al., 2014) albeit with multiple and much larger sized individuals. Here, we report using NGS technology to generate the full mitogenome from a single whitefly individual. The Asia I specimens were collected from guava in Bangladesh (Bari, Gazipur) on 18 February 2000. Total genomic DNA was extracted from one individual using the Qiagen DNEasy blood and tissue kit (Qiagen, Hilden, Germany). Library construction was performed using the Illumina Nextera DNA sample preparation kit.
Correspondence: W. T. Tay, CSIRO Biosecurity Flagship, Black Mountain Laboratories, Clunies Ross Street, Canberra 2601, Australia. Tel: +61-2-6246 4286. E-mail: [email protected]
History Received 6 May 2014 Accepted 9 May 2014 Published online 24 June 2014
The sequencing was done on an Illumina MiSeq platform, and assembly of the mitochondrial genome was performed using CLC Genomics Workbench v7.0.3 (CLC bio, Aarhus, Denmark) which recovered most of the mitochondrial DNA sequences. The missing A+T-rich repeat region was assembled using the Velvet assembler v1.2.10 (Zerbino & Birney, 2008) in two steps: (i) velveth that converts short reads into K-mers, followed by (ii) velvetg to assemble overlapping k-mers into contigs via a De Bruijn graph (the best results were obtained using parameter K ¼ 41, with K referring to the K-mer length). The assembled mitogenome was annotated using MITOS (Bernt et al., 2013) and visualized in GeneiousÕ 6.1.6 (Biomatters Ltd. Auckland, New Zealand). We used RNAfold WebServer 5http://rna.tbi.univie.ac.at/4 to infer the length of the large subunit ribosomal RNA (rRNA-L), and Tandem Repeats Finder v4.08 (Benson, 1999) to identify repeat sequence patterns within the putative origin of replication. A total of 3.6 copies of repeat units (94% matched, Score: 293; consensus size: 44 bp, consensus repeat pattern: ATAGAAGAG AAGAGGTAGAATAATATATATATTAATCATTAGCA) were identified at nucleotide positions 13,707–13,866 (160 bp) within the origin of replication (nucleotide positions 13,443–13,909). We compared our Asia I mitogenome with that of B. afer (Wang et al., 2014), Mediterranean (Wang et al., 2013), and New World 1 (Thao et al., 2004) and found overall gene synteny, with two minor differences being: (i) the presence of tRNA-Ser2 in Asia I, Mediterranean and New World 1, but not in B. afer (Wang et al., 2014), and (ii) in Asia I and New World 1, but not Mediterranean, the tRNA-Arg is on the ‘‘plus’’ strand of the mitogenome. All Asia I mitogenome PCGs have either the ATA or ATG start codons, and either the TAA or TAG stop codons (Table 1). All Asia I tRNAs have the characteristic ‘‘cloverleaf’’shaped secondary structures except the tRNA-Ser1 and 2 which lacked the D-domain.
2
W. T. Tay et al.
Mitochondrial DNA, Early Online: 1–2
Table 1. Asia I mitogenome anotation.
Mitochondrial DNA Downloaded from informahealthcare.com by Fudan University on 05/12/15 For personal use only.
Name COI tRNA-Leu2 COII tRNA-Lys ATP8 ATP6 tRNA-Ser1 tRNA-Glu tRNA-Phe ND5 tRNA-His ND4 ND4L tRNA-Thr tRNA-Pro ND6 CYTB tRNA-Ser2 ND1 tRNA-Leu1 rRNA-L tRNA-Val tRNA-Asp tRNA-Gln rRNA-S tRNA-Asn tRNA-Arg tRNA-Ala ND3 tRNA-Gly COIII Origin of replication tRNA-Ile tRNA-Met ND2 tRNA-Trp tRNA-Tyr tRNA-Cys
Strand
Gene position
Gene length (bp)
Start/anti codon
Stop codon
Intergenic nucleotide
+ + + + + + + + + +
1–1542 1538–1602 1603–2286 2267–2334 2353–2589 2579–3229 3263–3322 3332–3394 3418–3486 3464–5134 5135–5202 5203–6495 6492–6776 6778–6841 6842–6903 6938–7384 7385–8518 8517–8573 8591–9493 9509–9579 9607–10,788 10,789–10,855 10,864–10,939 10,945–11,008 11,014–11,764 11,925–11,988 11,990–12,058 12,062–12,126 12,139–12,492 12,494–12,556 12,600–13,442 13,443–13,909 13,910–13,975 13,976–14,045 14,055–15,014 15,013–15,081 15,080–15,142 15,144–15,205
1542 65 684 68 237 651 60 63 69 1671 68 1293 285 64 62 447 1134 57 903 71 1182 67 76 64 751 64 69 65 354 63 843 467 66 70 960 69 63 62
ATG TAA ATA TTT ATA ATG TCT TTC GAA ATA GTG ATA ATG TGT TGG ATA ATG TGA ATA TAG TAA TAC GTC TTG ACA GTT TCG TGC ATG TCC ATA
TAA
5 0 20 18 11 33 9 23 23 0 0 4 1 0 34 0 2 17 15 27 0 8 5 5 160 1 3 12 1 43 467
+ + + +
Declaration of interest The authors acknowledged the Australian Government for funding support to the CSIRO. S.E. was supported by a CSIRO OCE Post Doctoral Fellowship. The authors report no conflict of interest.
References Behere GT, Firake DM, Tay WT, Azad Thakur NS, Ngachan SV. (2014). Complete mitochondrial genome sequence of a phytophagous ladybird beetle, Henosepilachna pusillanima (Mulsant) (Coleoptera: Coccinellidae) Mitochondrial DNA. [Epub ahead of print]. DOI: 10.3109/19401736.2014.892082. Benson G. (1999). Tandem repeats finder: A program to analyze DNA sequences. Nucleic Acid Res 27:573–80. Bernt M, Donath A, Ju¨hling F, Externbrink F, Florentz C, Fritzsch G, Pu¨tz J, et al. (2013). MITOS: Improved de novo metazoan mitochondrial genome annotation. Mol Phylogenet Evol 69:313–19. Boykin LM, Bell CD, Evans GA, Small I, De Barro PJ. (2013). Is agriculture driving the diversification of the Bemisia tabaci species complex (Hemiptera: Sternorrhyncha: Aleyrodidae)?
GAT CAT ATA TCA GTA GCA
TAA TAG TAG
TAA TAA TAA TAA TAA TAG
TAA TAA
TAA
0 9 2 2 1 5
Dating, diversification and biogeographic evidence revealed. BMC Evol Biol 13:228. Boykin LM, Armstrong KF, Kubatko L, De Barro P. (2012). Species delimitation and global biosecurity. Evol Bioinform 8:1–37. De Barro PJ, Liu SS, Boykin LM, Dinsdale AB. (2011). Bemisia tabaci: A statement of species status. Annu Rev Entomolo 56:1–19. Tay WT, Evans GA, Boykin LM, De Barro PJ. (2012). Will the real Bemisia tabaci please stand up? PLoS One 7:e50550. Thao ML, Baumann P. (2004). Evolutionary relationships of primary prokaryotic endosymbionts of whiteflies and their hosts. Appl Environ Microbiol 70:3401–6. Wang HL, Yang J, Boykin LM, Zhao QY, Li Q, Wang XW, Liu SS. (2013). The characteristics and expression profiles of the mitochondrial genome for the Mediterranean species of the Bemisia tabaci complex. BMC Genomics 14:401. Wang HL, Xiao N, Yang J, Wang XW, Colvin J, Liu SS. (2014). The complete mitochondrial genome of Bemisia afer (Hemiptera: Aleyrodidae). Mitochondrial DNA. [Epub ahead of print]. DOI: 0.3109/19401736.2013.873921. Zerbino DR, Birney E. (2008). Velvet: Algorithms for de novo short read assembly using de Bruijn graphs. Genome Res 18:821–9.
Notice of Correction: Following publication of this article online ahead of print on 24 June 2014, the authors identified an error in the labelling of the sequence Asia I, which was mistakenly labelled as Asia II-5. This has been corrected in this version. The authors and editors apologize for any inconvenience caused.
MITOGENOME ANNOUNCEMENT
Complete mitochondrial DNA genome of Bemisia tabaci cryptic pest species complex Asia I (Hemiptera: Aleyrodidae) W. T. Tay1, S. Elfekih1, L. Court1, K. H. Gordon1, and P. J. De Barro2 CSIRO Biosecurity Flagship, Black Mountain Laboratories, Canberra, Australia and 2CSIRO Ecosystem Sciences, Brisbane, Australia
Mitochondrial DNA Downloaded from informahealthcare.com by Fudan University on 05/12/15 For personal use only.
1
Abstract
Keywords
The complete length of the Asia I member of the Bemisia tabaci species complex mitochondrial DNA genome (mitogenome) is 15,210 bp (GenBank accession no. KJ778614) with an A-T biased nucleotide composition (A: 32.7%; T: 42.4%; G: 14.0%; C: 10.8%). The mitogenome consists of 13 protein-coding genes (PCGs), 22 transfer RNAs (tRNAs), 2 ribosomal RNA (rRNAs) and a 467 bp putative control region which also includes the A+T rich repeat region. All PCGs have an ATA (n ¼ 8) or ATG (n ¼ 5) start codon. Gene synteny of Asia I is overall similar to B. afer and two other members of the B. tabaci species complex Mediterranean and New World 1, and contains the tRNA-Ser2 located between the Cytb and ND1 genes found in Mediterranean and New World 1, but which is absent in B. afer. The orientation of the tRNA-Arg in Asia I is on the ‘‘plus’’ strand and differed from Mediterranean which is found on the ‘‘minus’’ strand. The Asia I mitogenome size is currently ranked the second smallest after B. afer (14,968 bp) followed by New World 1 (15,322 bp) and Mediterranean (15,632 bp).
Asia I, next generation sequencing, whitefly
Asia I belongs to the B. tabaci cryptic whitefly pest species complex (De Barro et al., 2011) that included the original B. tabaci (Mediterranean) species (Tay et al., 2012). All currently known ‘‘B. Tabaci’’ whiteflies fall into at least 11 major clades, with Asia I being the species within the Asia I clade (Boykin et al., 2013). Although it has been possible to demonstrate the delimitation of species’ boundaries in the B. tabaci pest species complex using just the mtCOI gene (Boykin et al., 2012), better understanding of evolutionary genetic relationships between members of this global pest species complex will greatly benefit from full mitogenome comparisons. Assembling complete mitogenomes in pest insects has been facilitated by next generation sequencing (NGS) technologies (e.g. Behere et al., 2014) albeit with multiple and much larger sized individuals. Here, we report using NGS technology to generate the full mitogenome from a single whitefly individual. The Asia I specimens were collected from guava in Bangladesh (Bari, Gazipur) on 18 February 2000. Total genomic DNA was extracted from one individual using the Qiagen DNEasy blood and tissue kit (Qiagen, Hilden, Germany). Library construction was performed using the Illumina Nextera DNA sample preparation kit.
Correspondence: W. T. Tay, CSIRO Biosecurity Flagship, Black Mountain Laboratories, Clunies Ross Street, Canberra 2601, Australia. Tel: +61-2-6246 4286. E-mail: [email protected]
History Received 6 May 2014 Accepted 9 May 2014 Published online 24 June 2014
The sequencing was done on an Illumina MiSeq platform, and assembly of the mitochondrial genome was performed using CLC Genomics Workbench v7.0.3 (CLC bio, Aarhus, Denmark) which recovered most of the mitochondrial DNA sequences. The missing A+T-rich repeat region was assembled using the Velvet assembler v1.2.10 (Zerbino & Birney, 2008) in two steps: (i) velveth that converts short reads into K-mers, followed by (ii) velvetg to assemble overlapping k-mers into contigs via a De Bruijn graph (the best results were obtained using parameter K ¼ 41, with K referring to the K-mer length). The assembled mitogenome was annotated using MITOS (Bernt et al., 2013) and visualized in GeneiousÕ 6.1.6 (Biomatters Ltd. Auckland, New Zealand). We used RNAfold WebServer 5http://rna.tbi.univie.ac.at/4 to infer the length of the large subunit ribosomal RNA (rRNA-L), and Tandem Repeats Finder v4.08 (Benson, 1999) to identify repeat sequence patterns within the putative origin of replication. A total of 3.6 copies of repeat units (94% matched, Score: 293; consensus size: 44 bp, consensus repeat pattern: ATAGAAGAG AAGAGGTAGAATAATATATATATTAATCATTAGCA) were identified at nucleotide positions 13,707–13,866 (160 bp) within the origin of replication (nucleotide positions 13,443–13,909). We compared our Asia I mitogenome with that of B. afer (Wang et al., 2014), Mediterranean (Wang et al., 2013), and New World 1 (Thao et al., 2004) and found overall gene synteny, with two minor differences being: (i) the presence of tRNA-Ser2 in Asia I, Mediterranean and New World 1, but not in B. afer (Wang et al., 2014), and (ii) in Asia I and New World 1, but not Mediterranean, the tRNA-Arg is on the ‘‘plus’’ strand of the mitogenome. All Asia I mitogenome PCGs have either the ATA or ATG start codons, and either the TAA or TAG stop codons (Table 1). All Asia I tRNAs have the characteristic ‘‘cloverleaf’’shaped secondary structures except the tRNA-Ser1 and 2 which lacked the D-domain.
2
W. T. Tay et al.
Mitochondrial DNA, Early Online: 1–2
Table 1. Asia I mitogenome anotation.
Mitochondrial DNA Downloaded from informahealthcare.com by Fudan University on 05/12/15 For personal use only.
Name COI tRNA-Leu2 COII tRNA-Lys ATP8 ATP6 tRNA-Ser1 tRNA-Glu tRNA-Phe ND5 tRNA-His ND4 ND4L tRNA-Thr tRNA-Pro ND6 CYTB tRNA-Ser2 ND1 tRNA-Leu1 rRNA-L tRNA-Val tRNA-Asp tRNA-Gln rRNA-S tRNA-Asn tRNA-Arg tRNA-Ala ND3 tRNA-Gly COIII Origin of replication tRNA-Ile tRNA-Met ND2 tRNA-Trp tRNA-Tyr tRNA-Cys
Strand
Gene position
Gene length (bp)
Start/anti codon
Stop codon
Intergenic nucleotide
+ + + + + + + + + +
1–1542 1538–1602 1603–2286 2267–2334 2353–2589 2579–3229 3263–3322 3332–3394 3418–3486 3464–5134 5135–5202 5203–6495 6492–6776 6778–6841 6842–6903 6938–7384 7385–8518 8517–8573 8591–9493 9509–9579 9607–10,788 10,789–10,855 10,864–10,939 10,945–11,008 11,014–11,764 11,925–11,988 11,990–12,058 12,062–12,126 12,139–12,492 12,494–12,556 12,600–13,442 13,443–13,909 13,910–13,975 13,976–14,045 14,055–15,014 15,013–15,081 15,080–15,142 15,144–15,205
1542 65 684 68 237 651 60 63 69 1671 68 1293 285 64 62 447 1134 57 903 71 1182 67 76 64 751 64 69 65 354 63 843 467 66 70 960 69 63 62
ATG TAA ATA TTT ATA ATG TCT TTC GAA ATA GTG ATA ATG TGT TGG ATA ATG TGA ATA TAG TAA TAC GTC TTG ACA GTT TCG TGC ATG TCC ATA
TAA
5 0 20 18 11 33 9 23 23 0 0 4 1 0 34 0 2 17 15 27 0 8 5 5 160 1 3 12 1 43 467
+ + + +
Declaration of interest The authors acknowledged the Australian Government for funding support to the CSIRO. S.E. was supported by a CSIRO OCE Post Doctoral Fellowship. The authors report no conflict of interest.
References Behere GT, Firake DM, Tay WT, Azad Thakur NS, Ngachan SV. (2014). Complete mitochondrial genome sequence of a phytophagous ladybird beetle, Henosepilachna pusillanima (Mulsant) (Coleoptera: Coccinellidae) Mitochondrial DNA. [Epub ahead of print]. DOI: 10.3109/19401736.2014.892082. Benson G. (1999). Tandem repeats finder: A program to analyze DNA sequences. Nucleic Acid Res 27:573–80. Bernt M, Donath A, Ju¨hling F, Externbrink F, Florentz C, Fritzsch G, Pu¨tz J, et al. (2013). MITOS: Improved de novo metazoan mitochondrial genome annotation. Mol Phylogenet Evol 69:313–19. Boykin LM, Bell CD, Evans GA, Small I, De Barro PJ. (2013). Is agriculture driving the diversification of the Bemisia tabaci species complex (Hemiptera: Sternorrhyncha: Aleyrodidae)?
GAT CAT ATA TCA GTA GCA
TAA TAG TAG
TAA TAA TAA TAA TAA TAG
TAA TAA
TAA
0 9 2 2 1 5
Dating, diversification and biogeographic evidence revealed. BMC Evol Biol 13:228. Boykin LM, Armstrong KF, Kubatko L, De Barro P. (2012). Species delimitation and global biosecurity. Evol Bioinform 8:1–37. De Barro PJ, Liu SS, Boykin LM, Dinsdale AB. (2011). Bemisia tabaci: A statement of species status. Annu Rev Entomolo 56:1–19. Tay WT, Evans GA, Boykin LM, De Barro PJ. (2012). Will the real Bemisia tabaci please stand up? PLoS One 7:e50550. Thao ML, Baumann P. (2004). Evolutionary relationships of primary prokaryotic endosymbionts of whiteflies and their hosts. Appl Environ Microbiol 70:3401–6. Wang HL, Yang J, Boykin LM, Zhao QY, Li Q, Wang XW, Liu SS. (2013). The characteristics and expression profiles of the mitochondrial genome for the Mediterranean species of the Bemisia tabaci complex. BMC Genomics 14:401. Wang HL, Xiao N, Yang J, Wang XW, Colvin J, Liu SS. (2014). The complete mitochondrial genome of Bemisia afer (Hemiptera: Aleyrodidae). Mitochondrial DNA. [Epub ahead of print]. DOI: 0.3109/19401736.2013.873921. Zerbino DR, Birney E. (2008). Velvet: Algorithms for de novo short read assembly using de Bruijn graphs. Genome Res 18:821–9.
Notice of Correction: Following publication of this article online ahead of print on 24 June 2014, the authors identified an error in the labelling of the sequence Asia I, which was mistakenly labelled as Asia II-5. This has been corrected in this version. The authors and editors apologize for any inconvenience caused.
