Plant Molecular Biology 18: 613-616, 1992. © 1992 Kluwer Academic Publishers. Printed in Belgium.
613
Update section Sequence
Complete DNA sequence of the Chlamydomonas reinhardtii chloroplast atpA gene Stefan Leu, Jacob Schlesinger, Allan Michaels and Noun Shavit Department of Life Sciences, Ben Gurion University of the Negev, Beer Sheva, Israel Received 4 October 1991; 9 October 1991
The atpA gene, coding for the a subunit of the chloroplast ATPase/synthase complex C F 1 / C F o , is located on the chloroplast D N A in green algae and higher plants. In contrast to higher-plant chloroplast DNAs, where the ATPase genes are arranged in two operons, the ATPase genes of Chlamydomonas reinhardtii chloroplast D N A are individually arranged [8]. The atpA gene is located near the rbcL gene, and the 5' end of the gene, located on Eco RI fragment 15 of Chlamydomonas chloroplast DNA, has been sequenced [ 1]. We have subcloned the complete Chlamydomonas atpA gene into pT7-2. RNA produced in vitro from this construct yielded an in vitro translation product of 54 kDa, which comigrates with the ~ subunit of C F 1 in SDS-polyacrylamide gels [3]. We determined the D N A sequence of 2010 bp of this construct, starting from the unique Eco RI site at position 162 (Fig. 1). Overlapping D N A fragments, obtained by digestion of the pT7-2atpA plasmid with the restriction endonucleases Eco RI, Hind III, Ssp I, Pst I and Rsa I were subcloned into the plasmid pBS S K - (Stratagene). The D N A sequence was determined using denatured plasmid DNA as template and T7 D N A polymerase (Promega) according to the manufacturer's instructions. The resulting D N A sequence and the deduced amino acid sequence are shown
in Fig. 1. For continuity, part of the previously determined sequence coding for the 5' untranslated region and the first 54 amino acids of the atpA gene [ 1] were included in the figure. Another 174 bp of the previously published sequence overlapped the sequence determined in our laboratory [ 1]. The two sequences were identical except for one base (No. 336, Fig. 1, No. 1 in Dron et al. [1]), which we determined to be A, while Dron et al. found G. The restriction map for Eco RI fragment 7 published by Dron et al. [ 1] must be modified in the light of our sequencing data. We found Hind III restriction sites at positions 605, 806, 1180 and 2167 (Fig. 1), resulting in a much more complex Hind III cleavage pattern than was proposed. The open reading frame identified in the D N A sequence shown in Fig. 1 codes for a polypeptide of 508 amino acids. This polypeptide is highly homologous to higher-plant C F 1 ~ subunits (75 ~o identical amino acids compared to the tobacco ~t subunit [5]) and is therefore clearly Chlamydomonas CF 1 ct subunit. No other open reading frame was found in this D N A sequence. It was originally proposed that translation of the atpA gene starts at the third methionine of the open reading frame (amino acid 26, Fig. 1) [1]. However, the sequence preceding this methionine shows considerable homology to the e subunits of
The nucleotide sequence data reported will appear in the EMBL, GenBank and DDBJ Nucleotide Sequence Databases under the accession number X60298.
614 -60 -30 tttgttgaattttaaacttatttaaaattctcgagaaagattttaaaaataaacttttttaatcttttatttatttttt
1 / atg g c a met ala 61 / act cca thr p r o 121 / cgt att arg ile 181 / tta ggt leu g l y 241 / tta aaa leu lys 301 / ggt gaa gly g l u 361 / gct gtt ala val 421 / cgt tct arg ser 481 / ggt cgt g l y arg 541 / gta gat val asp 601 / caa aaa gln lys 661 / tat aca tyr t h r 721 / tat aca tyr t h r 781 / tac gat tyr asp 841 / cca cca pro p r o 901 / cgt gct arg ala 961 / gaa aca glu thr 1021 / ggt cag gly g l n 1081 / ggt att gly ile
1 atg met 21 gaa glu 41 tat tyr 61 att ile 81 att ile i01 gca ala 121 caa gln 141 gtt val 161 ggt gly 181 act thr 201 gct ala 221 att ile 241 ggt gly 261 gac asp 281 ggt gly 301 gct ala 321 caa gln 341 att ile 361 tca ser
31 / cgt act cca g a a gaa ctt agt aat ctt a r g t h r p r o g l u gl u leu set asn leu 91 / g t g aaa a t g g t a gat t t c ggt atc gtt v a l lys m e t v a l asp p h e g l y ile val 151 / ggt tta gaa aaa gca a t g tca ggt gaa g l y leu g l u lys ala m e t set g l y g l u 211 / g c a c t t aac t t a g a a gca aac aac g t a ala leu a s n leu g l u ala asn asn v a l 271 / act g a a g g t agc cgt gtt cgt tgt act t h r g l u g l y ser arg v a l arg cys t h r 331 / t a c t t a g g t cgt gta gtt gac ggt tta t y r leu g l y a r g v a l v a l asp g l y leu 391 / aca aaa gat agc cgt gct att gaa t c a t h r lys a s p ser a r g ala ile glu ser 451 / tat g a a cca tta gct act ggt tta gtt t y r g l u p r o leu ala t h r g l y leu val 511 /. caa cgt g a g cta att att ggt gac cgt g l n a r g g l u leu ile ile g l y asp a r g 571 / atc ctt aac caa aaa ggt aaa ggt gtt ile leu asn g l n lys g l y lys gly v a l 631 / t c a tct g t a gct caa gta tta aat aca ser ser val ala g l n va! leu asn t h r 691 / atc g t a a t g gct aac gct aac gaa cca ile v a l m e t ala asn ala asn g l u p r o 751 / gct a c g t t a gct g a g tac ttc atg tac ala t h r leu ala glu t y r p h e met t y r 811 / tta tct aaa caa gca caa gct tac cgt leu s e t lys g l n ala g l n ala tyr a r g 871 / cgt gaa gct tac cca ggt gac gta ttc a r g g l u ala t y r p r o g l y asp val p h e 931 / aaa t t a aat aat gca tta ggt gaa ggt lys leu a s n asn ala leu g l y glu g l y 991 / g a a ggt g a c g t a tct gct tat atc cca g l u g l y asp v a l set ala tyr ile p r o 1051 / ttc tta gct gct ggt tta ttt aac tca p h e leu ala ala g l y leu phe ash ser IIii / gta tca cgt g t a ggt tct gca gct caa v a l set a r g v a l g l y ser ala ala g l n
11 att ile 31 ttc phe 51 tta leu 71 ggt gly 91 ggt gly iii cct pro 131 cca pro 151 gct ala 171 caa gln 191 art ile 211 tta leu 231 gct ala 251 aca thr 271 gaa glu 291 tat tyr 311 agt ser 331 aca thr 351 ggt gly 371 cca pro
aaa gat tta att gaa lys asp leu ile g l u
caa tac gln t y r
caa gta ggt gac ggt att gct g l n val g l y asp g l y ile ala ctt g a a ttc g a a gat ggt act leu g l u p h e g l u asp g l y t h r g c g gta ala val
tta tta ggt gat ggt leu leu g l y asp g l y
aaa atc gct g a a lys ile ala g l u cgt cca gtt arg pro val
att cct ile p r o
gta val
gat ggt aaa ggt asp g l y lys g l y
gct cct ggt atc gtt gca cgt ala p r o g l y ile val ala a r g gta gat gct a t g att cca gtt val asp ala m e t ile p r o val aca ggt thr gly
aaa aca gca atc gct lys t h r ala ile ala
tgt gtt t a c gtt gct att ggt cys val t y r v a l ala ile g l y aaa gaa lys g l u
cgt ggt gct tta gat a r g g l y ala leu asp
aca tta caa tat t h r leu gln t y r
tta gca cca leu ala p r o
ggt cgt cca act tta aca att g l y a r g p r o t h r leu thr ile a t g tct cta tta ctt cgt cgt m e t ser leu leu leu arg arg cta cac tct cgt tta tta gaa leu his ser a r g leu leu g l u a t g aca gct ctt cca m e t thr ala leu p r o aac gta asn val
att gtt ile val
att tct att aca gat ile ser ile t h r asp
tta cgc cca g c g leu arg p r o ala aaa gca a t g lys ala m e t
art aac gta ile ash val
aaa caa gtt g c g lys g l n val ala
615 1141 / 381 ggt aaa ctt gly lys leu 1201 / 401 tca gac ctt set asp leu 1261 / 421 tta aaa caa leu lys g l n 1321 / 441 ggt act aat gly thrasn 1381 / 461 tta cgt agc leu a r g ser 1441 / 481 aca ttc act thr phe thr 1501 / 501 ttt aaa tct p h e lys s e r
I171 / 391 a a g tta gaa cta gca caa ttc gct gaa cta gaa gct ttc tca caa ttc gct lys leu g l u leu ala g l n p h e ala g l u leu g l u ala p h e s e r g l n p h e ala 1231 / 411 gac caa gct aca caa aac caa tta gct cgt ggt gct cgt tta cgt g a a att a s p g l n a l a t h r g l n a s h g l n !eu ala a r g g l y ala a r g leu a r g g l u ile 1291 / 431 cca caa tct tct cca ctt tca gtt g a a gaa caa gta gct tct ctt tat gct p r o g l n s e r s e t p r o l e u ser val g l u g l u g l n val ala s e r leu t y r ala 1351 / 451 ggt tat tta gac aaa ctt gaa gta t c a caa gta cgt g c a tac tta tct ggt g l y t y r leu asp lys leu g l u v a l ser g l n val a r g a l a t y r leu ser g l y 1411 / 471 tac tta gct aat agc t a c c c g aaa tat ggt gaa att t t a cgt tca act tta t y r leu ala a s n s e r t y r p r o lys t y r g l y g l u ile leu a r g s e t t h r leu 1471 / 491 cct g a a gct gaa ggt t t a gtt aaa caa gct art aat gaa tac t t a gaa gaa p r o g l u ala g l u g l y leu val lys g l n ala ile a s n g l u t y r leu g l u g l u 1531 1561 caa g c t aaa gct gct t a a t t t t t a a t t a a g t a g g a a c t c g g t a t a t g c t c t t t t g g g g t c t t g l n ala lys ala ala 1591 1621 attagctagtattagttaactaacaaaagatcaatattttagtttgttttatatattttattacttaagtagtaaggat 1651 1681 1711 ttgcatttagcaatcttaaatacttaagtaataatctataaataaaatatattttcgctttaaaacttataaaaattat 1741 1771 1801 ttgctcgttataagcctaaaaaaacgtaggatctctacgagatattacattgtttttttctttaattggctttaatatt 1831 1861 actttgtatatataaaccaaagtacttgttaatagttattaaattatattaactatacagtacaaagaaattttttgct 1891 1921 1951 aaaaaaagtatgttaacattaaaaatttttgtttatacagtagttacgttctttgtttgtttatttatttttggtttct 1981 2011 2041 tatctaatgaccctgctcgtaacccaggtaaaaatttagactaatttaatttagctaagagattgttaccttaacaatc 2071 2101 tcttagctaaattattaattccttaaatgcaaatatgcatatcccttttcttttcataatttgcttaaagtgttaaaat. 2131 2161 cgttttaagtaactttggttatttagttgcatttaatagctaaagctt
Fig. 1. D N A sequence of the Chlamydomonas reinhardtii chloroplast atpA gene and the deduced amino acid sequence of the Chlamydomonas C F 1 ~ subunit. The D N A sequence up to base 336 has been previously determined by Dron et al. [1 ]. N o open reading frame besides the one shown here was found in this sequence. According to amino acid microsequencing, translation of the ~ subunit gene starts at the first methionine of the open reading frame.
higher-plant chloroplasts [2]. We have therefore subjected a mixture of the c~ and ~ subunits of isolated Chlamydomonas CF~ to amino acid microsequencing. The resulting amino acids in each step were: Ala/Ser, Met/x, x/Ser, Thr/Ile, Pro/ Glu, Glu/Thr, Glu/Lys, Leu/Asn ( x = u n identified amino acids). These results indicate that the ~ subunit is translated from the first methionine of the open reading fame. The deduced molecular weight of the resulting protein is 54 000, exactly corresponding to the molecular weight observed on SDS-PAGE. The/~ subunit, however,
seems to be translated from the second methionine of the open reading frame [7] or is processed from a pre-/~ subunit. We have recently shown that transcription and abundance of the atpA and atpB mRNAs are regulated in parallel during the cell cycle of synchronized Chlamydomonascells [4]. It has been shown that a distinct stem loop structure at the end of the open reading frame of the atpB mRNA is responsible for the accumulation of this transcript in vivo [6], and it would be tempting to speculate that the atpA transcript stability is regulated by
616 the same mechanism. While two stem loop structures can be found after the end of the atpA open reading frame, no similarity to the structure found in the atpB gene was identified. Therefore, no analogy in the mechanism of accumulation for the two transcripts could be deduced from our sequencing data.
Acknowledgements This research was supported by a grant from the Bertie I. Black Foundation, Great Britain (to N.S.), and by grant 823A-028429 from the Swiss National Science Foundation (to S.L.).
References 1. Dron M, Rahire M, Rochaix J-D: Section of the chloroplast DNA region of Chlamydomonas reinhardtii containing the gene of the large subunit of ribulose biphosphate carboxylase and parts of its flanking genes. J Mol Biol 162: 775-793 (1982).
2. H allick RB: Identifiction and partial DNA sequence of the gene for the alpha subunit of the ATP synthase complex of Chlamydomonas reinhardtii chloroplasts. FEB S Lett 177: 274-276 (1984). 3. Leu S, Schlesinger J, Motzery R, Shavit N, Michaels A: Towards protein engineering of Chlarnydomonas reinhardtii chloroplast ATP synthase. In: Argyroudi-AkoyunoglouJH (ed), Regulation of Chloroplast Biogenesis. Plenum, New York (1991), in press. 4. Leu S, White D, Michaels A: Cell cycle dependent transcriptional and posttranscriptional regulation of chloroplast gene expression in Chlamydomonas reinhardtii. Biochim Biophys Acta 1049:311-317 (1990). 5. Mahendran R, Spottswood MR, Miller DL: RNA editing by cytidine insertion in mitochondria of Physarum polycephalum. Nature 349:434-438 (1991). 6. Stern DB, Radwanski ER, Kindle KL: A 3' stem/loop structure of the Chlamydomonas chloroplast atpB gene regulates mRNA accumulation in vivo. Plant Cell 3:285-297 (1991). 7. Woessner JP, Gillham NW, Boynton JE: The sequence of the chloroplast atpB gene and its flanking regions in Chlamydomonas reinhardtii. Gene 44:17-28 (1986). 8. Woessner JP, Gillham NW, Boynton JE: Chloroplast genes encoding subunits of the H + -ATPase complex of Chlamydornonas reinhardtii are rearranged compared to higher plants: sequence of the atpE gene and location of the atpF and atpI genes. Plant Mol Biol 8:151-158 (1987).
613
Update section Sequence
Complete DNA sequence of the Chlamydomonas reinhardtii chloroplast atpA gene Stefan Leu, Jacob Schlesinger, Allan Michaels and Noun Shavit Department of Life Sciences, Ben Gurion University of the Negev, Beer Sheva, Israel Received 4 October 1991; 9 October 1991
The atpA gene, coding for the a subunit of the chloroplast ATPase/synthase complex C F 1 / C F o , is located on the chloroplast D N A in green algae and higher plants. In contrast to higher-plant chloroplast DNAs, where the ATPase genes are arranged in two operons, the ATPase genes of Chlamydomonas reinhardtii chloroplast D N A are individually arranged [8]. The atpA gene is located near the rbcL gene, and the 5' end of the gene, located on Eco RI fragment 15 of Chlamydomonas chloroplast DNA, has been sequenced [ 1]. We have subcloned the complete Chlamydomonas atpA gene into pT7-2. RNA produced in vitro from this construct yielded an in vitro translation product of 54 kDa, which comigrates with the ~ subunit of C F 1 in SDS-polyacrylamide gels [3]. We determined the D N A sequence of 2010 bp of this construct, starting from the unique Eco RI site at position 162 (Fig. 1). Overlapping D N A fragments, obtained by digestion of the pT7-2atpA plasmid with the restriction endonucleases Eco RI, Hind III, Ssp I, Pst I and Rsa I were subcloned into the plasmid pBS S K - (Stratagene). The D N A sequence was determined using denatured plasmid DNA as template and T7 D N A polymerase (Promega) according to the manufacturer's instructions. The resulting D N A sequence and the deduced amino acid sequence are shown
in Fig. 1. For continuity, part of the previously determined sequence coding for the 5' untranslated region and the first 54 amino acids of the atpA gene [ 1] were included in the figure. Another 174 bp of the previously published sequence overlapped the sequence determined in our laboratory [ 1]. The two sequences were identical except for one base (No. 336, Fig. 1, No. 1 in Dron et al. [1]), which we determined to be A, while Dron et al. found G. The restriction map for Eco RI fragment 7 published by Dron et al. [ 1] must be modified in the light of our sequencing data. We found Hind III restriction sites at positions 605, 806, 1180 and 2167 (Fig. 1), resulting in a much more complex Hind III cleavage pattern than was proposed. The open reading frame identified in the D N A sequence shown in Fig. 1 codes for a polypeptide of 508 amino acids. This polypeptide is highly homologous to higher-plant C F 1 ~ subunits (75 ~o identical amino acids compared to the tobacco ~t subunit [5]) and is therefore clearly Chlamydomonas CF 1 ct subunit. No other open reading frame was found in this D N A sequence. It was originally proposed that translation of the atpA gene starts at the third methionine of the open reading frame (amino acid 26, Fig. 1) [1]. However, the sequence preceding this methionine shows considerable homology to the e subunits of
The nucleotide sequence data reported will appear in the EMBL, GenBank and DDBJ Nucleotide Sequence Databases under the accession number X60298.
614 -60 -30 tttgttgaattttaaacttatttaaaattctcgagaaagattttaaaaataaacttttttaatcttttatttatttttt
1 / atg g c a met ala 61 / act cca thr p r o 121 / cgt att arg ile 181 / tta ggt leu g l y 241 / tta aaa leu lys 301 / ggt gaa gly g l u 361 / gct gtt ala val 421 / cgt tct arg ser 481 / ggt cgt g l y arg 541 / gta gat val asp 601 / caa aaa gln lys 661 / tat aca tyr t h r 721 / tat aca tyr t h r 781 / tac gat tyr asp 841 / cca cca pro p r o 901 / cgt gct arg ala 961 / gaa aca glu thr 1021 / ggt cag gly g l n 1081 / ggt att gly ile
1 atg met 21 gaa glu 41 tat tyr 61 att ile 81 att ile i01 gca ala 121 caa gln 141 gtt val 161 ggt gly 181 act thr 201 gct ala 221 att ile 241 ggt gly 261 gac asp 281 ggt gly 301 gct ala 321 caa gln 341 att ile 361 tca ser
31 / cgt act cca g a a gaa ctt agt aat ctt a r g t h r p r o g l u gl u leu set asn leu 91 / g t g aaa a t g g t a gat t t c ggt atc gtt v a l lys m e t v a l asp p h e g l y ile val 151 / ggt tta gaa aaa gca a t g tca ggt gaa g l y leu g l u lys ala m e t set g l y g l u 211 / g c a c t t aac t t a g a a gca aac aac g t a ala leu a s n leu g l u ala asn asn v a l 271 / act g a a g g t agc cgt gtt cgt tgt act t h r g l u g l y ser arg v a l arg cys t h r 331 / t a c t t a g g t cgt gta gtt gac ggt tta t y r leu g l y a r g v a l v a l asp g l y leu 391 / aca aaa gat agc cgt gct att gaa t c a t h r lys a s p ser a r g ala ile glu ser 451 / tat g a a cca tta gct act ggt tta gtt t y r g l u p r o leu ala t h r g l y leu val 511 /. caa cgt g a g cta att att ggt gac cgt g l n a r g g l u leu ile ile g l y asp a r g 571 / atc ctt aac caa aaa ggt aaa ggt gtt ile leu asn g l n lys g l y lys gly v a l 631 / t c a tct g t a gct caa gta tta aat aca ser ser val ala g l n va! leu asn t h r 691 / atc g t a a t g gct aac gct aac gaa cca ile v a l m e t ala asn ala asn g l u p r o 751 / gct a c g t t a gct g a g tac ttc atg tac ala t h r leu ala glu t y r p h e met t y r 811 / tta tct aaa caa gca caa gct tac cgt leu s e t lys g l n ala g l n ala tyr a r g 871 / cgt gaa gct tac cca ggt gac gta ttc a r g g l u ala t y r p r o g l y asp val p h e 931 / aaa t t a aat aat gca tta ggt gaa ggt lys leu a s n asn ala leu g l y glu g l y 991 / g a a ggt g a c g t a tct gct tat atc cca g l u g l y asp v a l set ala tyr ile p r o 1051 / ttc tta gct gct ggt tta ttt aac tca p h e leu ala ala g l y leu phe ash ser IIii / gta tca cgt g t a ggt tct gca gct caa v a l set a r g v a l g l y ser ala ala g l n
11 att ile 31 ttc phe 51 tta leu 71 ggt gly 91 ggt gly iii cct pro 131 cca pro 151 gct ala 171 caa gln 191 art ile 211 tta leu 231 gct ala 251 aca thr 271 gaa glu 291 tat tyr 311 agt ser 331 aca thr 351 ggt gly 371 cca pro
aaa gat tta att gaa lys asp leu ile g l u
caa tac gln t y r
caa gta ggt gac ggt att gct g l n val g l y asp g l y ile ala ctt g a a ttc g a a gat ggt act leu g l u p h e g l u asp g l y t h r g c g gta ala val
tta tta ggt gat ggt leu leu g l y asp g l y
aaa atc gct g a a lys ile ala g l u cgt cca gtt arg pro val
att cct ile p r o
gta val
gat ggt aaa ggt asp g l y lys g l y
gct cct ggt atc gtt gca cgt ala p r o g l y ile val ala a r g gta gat gct a t g att cca gtt val asp ala m e t ile p r o val aca ggt thr gly
aaa aca gca atc gct lys t h r ala ile ala
tgt gtt t a c gtt gct att ggt cys val t y r v a l ala ile g l y aaa gaa lys g l u
cgt ggt gct tta gat a r g g l y ala leu asp
aca tta caa tat t h r leu gln t y r
tta gca cca leu ala p r o
ggt cgt cca act tta aca att g l y a r g p r o t h r leu thr ile a t g tct cta tta ctt cgt cgt m e t ser leu leu leu arg arg cta cac tct cgt tta tta gaa leu his ser a r g leu leu g l u a t g aca gct ctt cca m e t thr ala leu p r o aac gta asn val
att gtt ile val
att tct att aca gat ile ser ile t h r asp
tta cgc cca g c g leu arg p r o ala aaa gca a t g lys ala m e t
art aac gta ile ash val
aaa caa gtt g c g lys g l n val ala
615 1141 / 381 ggt aaa ctt gly lys leu 1201 / 401 tca gac ctt set asp leu 1261 / 421 tta aaa caa leu lys g l n 1321 / 441 ggt act aat gly thrasn 1381 / 461 tta cgt agc leu a r g ser 1441 / 481 aca ttc act thr phe thr 1501 / 501 ttt aaa tct p h e lys s e r
I171 / 391 a a g tta gaa cta gca caa ttc gct gaa cta gaa gct ttc tca caa ttc gct lys leu g l u leu ala g l n p h e ala g l u leu g l u ala p h e s e r g l n p h e ala 1231 / 411 gac caa gct aca caa aac caa tta gct cgt ggt gct cgt tta cgt g a a att a s p g l n a l a t h r g l n a s h g l n !eu ala a r g g l y ala a r g leu a r g g l u ile 1291 / 431 cca caa tct tct cca ctt tca gtt g a a gaa caa gta gct tct ctt tat gct p r o g l n s e r s e t p r o l e u ser val g l u g l u g l n val ala s e r leu t y r ala 1351 / 451 ggt tat tta gac aaa ctt gaa gta t c a caa gta cgt g c a tac tta tct ggt g l y t y r leu asp lys leu g l u v a l ser g l n val a r g a l a t y r leu ser g l y 1411 / 471 tac tta gct aat agc t a c c c g aaa tat ggt gaa att t t a cgt tca act tta t y r leu ala a s n s e r t y r p r o lys t y r g l y g l u ile leu a r g s e t t h r leu 1471 / 491 cct g a a gct gaa ggt t t a gtt aaa caa gct art aat gaa tac t t a gaa gaa p r o g l u ala g l u g l y leu val lys g l n ala ile a s n g l u t y r leu g l u g l u 1531 1561 caa g c t aaa gct gct t a a t t t t t a a t t a a g t a g g a a c t c g g t a t a t g c t c t t t t g g g g t c t t g l n ala lys ala ala 1591 1621 attagctagtattagttaactaacaaaagatcaatattttagtttgttttatatattttattacttaagtagtaaggat 1651 1681 1711 ttgcatttagcaatcttaaatacttaagtaataatctataaataaaatatattttcgctttaaaacttataaaaattat 1741 1771 1801 ttgctcgttataagcctaaaaaaacgtaggatctctacgagatattacattgtttttttctttaattggctttaatatt 1831 1861 actttgtatatataaaccaaagtacttgttaatagttattaaattatattaactatacagtacaaagaaattttttgct 1891 1921 1951 aaaaaaagtatgttaacattaaaaatttttgtttatacagtagttacgttctttgtttgtttatttatttttggtttct 1981 2011 2041 tatctaatgaccctgctcgtaacccaggtaaaaatttagactaatttaatttagctaagagattgttaccttaacaatc 2071 2101 tcttagctaaattattaattccttaaatgcaaatatgcatatcccttttcttttcataatttgcttaaagtgttaaaat. 2131 2161 cgttttaagtaactttggttatttagttgcatttaatagctaaagctt
Fig. 1. D N A sequence of the Chlamydomonas reinhardtii chloroplast atpA gene and the deduced amino acid sequence of the Chlamydomonas C F 1 ~ subunit. The D N A sequence up to base 336 has been previously determined by Dron et al. [1 ]. N o open reading frame besides the one shown here was found in this sequence. According to amino acid microsequencing, translation of the ~ subunit gene starts at the first methionine of the open reading frame.
higher-plant chloroplasts [2]. We have therefore subjected a mixture of the c~ and ~ subunits of isolated Chlamydomonas CF~ to amino acid microsequencing. The resulting amino acids in each step were: Ala/Ser, Met/x, x/Ser, Thr/Ile, Pro/ Glu, Glu/Thr, Glu/Lys, Leu/Asn ( x = u n identified amino acids). These results indicate that the ~ subunit is translated from the first methionine of the open reading fame. The deduced molecular weight of the resulting protein is 54 000, exactly corresponding to the molecular weight observed on SDS-PAGE. The/~ subunit, however,
seems to be translated from the second methionine of the open reading frame [7] or is processed from a pre-/~ subunit. We have recently shown that transcription and abundance of the atpA and atpB mRNAs are regulated in parallel during the cell cycle of synchronized Chlamydomonascells [4]. It has been shown that a distinct stem loop structure at the end of the open reading frame of the atpB mRNA is responsible for the accumulation of this transcript in vivo [6], and it would be tempting to speculate that the atpA transcript stability is regulated by
616 the same mechanism. While two stem loop structures can be found after the end of the atpA open reading frame, no similarity to the structure found in the atpB gene was identified. Therefore, no analogy in the mechanism of accumulation for the two transcripts could be deduced from our sequencing data.
Acknowledgements This research was supported by a grant from the Bertie I. Black Foundation, Great Britain (to N.S.), and by grant 823A-028429 from the Swiss National Science Foundation (to S.L.).
References 1. Dron M, Rahire M, Rochaix J-D: Section of the chloroplast DNA region of Chlamydomonas reinhardtii containing the gene of the large subunit of ribulose biphosphate carboxylase and parts of its flanking genes. J Mol Biol 162: 775-793 (1982).
2. H allick RB: Identifiction and partial DNA sequence of the gene for the alpha subunit of the ATP synthase complex of Chlamydomonas reinhardtii chloroplasts. FEB S Lett 177: 274-276 (1984). 3. Leu S, Schlesinger J, Motzery R, Shavit N, Michaels A: Towards protein engineering of Chlarnydomonas reinhardtii chloroplast ATP synthase. In: Argyroudi-AkoyunoglouJH (ed), Regulation of Chloroplast Biogenesis. Plenum, New York (1991), in press. 4. Leu S, White D, Michaels A: Cell cycle dependent transcriptional and posttranscriptional regulation of chloroplast gene expression in Chlamydomonas reinhardtii. Biochim Biophys Acta 1049:311-317 (1990). 5. Mahendran R, Spottswood MR, Miller DL: RNA editing by cytidine insertion in mitochondria of Physarum polycephalum. Nature 349:434-438 (1991). 6. Stern DB, Radwanski ER, Kindle KL: A 3' stem/loop structure of the Chlamydomonas chloroplast atpB gene regulates mRNA accumulation in vivo. Plant Cell 3:285-297 (1991). 7. Woessner JP, Gillham NW, Boynton JE: The sequence of the chloroplast atpB gene and its flanking regions in Chlamydomonas reinhardtii. Gene 44:17-28 (1986). 8. Woessner JP, Gillham NW, Boynton JE: Chloroplast genes encoding subunits of the H + -ATPase complex of Chlamydornonas reinhardtii are rearranged compared to higher plants: sequence of the atpE gene and location of the atpF and atpI genes. Plant Mol Biol 8:151-158 (1987).
