Comparative Gel Electrophoresis Measurement of the DNA Bend Angle Induced by the Catabolite Activator Protein SANDRA S. ZINKEL and DONALD M. CUOTHERS
Departments of Molecular Biophysics and Biochemistry and Chemistry, Yale University, New Haven, Connecticut 06512
SYNOPSIS
We describe a method to detennine the magnitude of protein-induced DNA bends relative t o a set of standard A tract bends using comparative gel electrophoresis. The DNA bend of interest was that induced by the catabolite activator protein (CAP), the transcriptional activator protein of the lac operon. The set of comparison molecules contained both bends of known magnitude and a bound CAP. The electrophoretic influence of the bound protein was accounted for by placing its binding site at the end of the molecule where its induced bend has little influence. Standard bends at the DNA center were introduced by 10.5 base-pair phasing. The mobility of these control incorporating 3-9 A, tracts at molecules was compared to the mobility of a test molecule of comparable length containing a central CAP-induced DNA bend. The CAP bend angle was found to be 5.6 f 0.3 A tract loo", independent of the concentration of the gel used within the range equivalents, or tested. The dependence of gel retardation on DNA end-bend distance was found to break down for A tract bend angles above 120". corresponding roughly to the angle beyond which the long axis of the molecule is no longer parallel to the end-to-end vector. We speculate that this may reflect a switch in the mode of migration of molecules through the gel.
-
-
INTRODUCTION Gene expression in prokaryotes is mediated primarily through the specific interaction of proteins with DNA sequences. An understanding of the mechanisms by which these proteins act is therefore central to the elucidation of transcriptional control. A classic gene regulatory system is the lac operon of Escherichia coli, for which transcription of the genes for three proteins involved in lactose metabolism is stimulated by the catabolite activator protein or CAP, also known as the CAMP receptor protein or CRP. Gel electrophoresis studhave indicated that CAP induces a bend
0 1990 John Wiley & Sons, Inc. CCC 0006-3525/90/010029-10 $04.00 Biopolymers, Vol. 29, 29-38 (1990)
upon binding to DNA. Additional evidence in support of a CAP-induced DNA bend arises from the finding that a large binding site [28-30 base pairs (bp)] is necessary for strong complex f ~ r m a t i o n , ~ . ~ and from molecular modeling, which predicts a sharply bent DNA conformation in contact with a ramp of positive electrostatic potential on three sides of the pr~tein.~,' The hydrodynamic properties of CAP-DNA complexes also support substantial bending.8 It has been proposed that the energy stored in the DNA bend may be released to do mechanical work during transcription initiati~n,~ but the role of the DNA bend in the activation of transcription is not well understood. In view of these considerations, measurement of the magnitude of the CAP-induced DNA bend is an important step in reaching an understanding of its role in biological function. Thompson and Landyg recently reported an estimate of the CAP-
30
ZINKEL AND CROTHERS
induced bend by comparing the relative mobility of molecules that have a bend respectively in the middle or a t an end of the molecule. Standard bends were supplied by A tracts, as in ow experiments; our approach differs from theirs in that our comparison molecules contain both A tracts and bound protein. In addition, the standard A tracts 10.5 in the molecules we studied were phased a t bp rather than 10 bp as in the Thompson and Landy experiments, and were of sequence essentially identical to that used for determination of the A tract bend angle by cyclization kinetics.","
-
MATERfALS AND METHODS Construction of Calibration DNA The parent DNA for these experiments12consisted of an isomeric set of DNA molecules containing a protein-induced bend (CAP) flanking a sequencedirected bend, the latter deriving from a segment of kinetoplast DNA (kDNA) from the parasite Leishmunia tarentohe. The phasing between the bends was shifted over one helical turn by the addition of linkers between them. The calibration DNA was constructed by replacing the kDNA from the parent molecules with runs of from 3-9 A tracts phased a t 10.5-bp intervals. To accomplish this, the parent DNA was restricted with EcoRI, treated with calf intestinal alkaline phosphatase (Roehringer-Mannheim), and run on a 4% polyacrylamide gel to separate the vector from the kDNA insert. The vector was then visualized by uv shadowing, cut from the gel, and electroeluted into TAE (40 m M tris-acetate, pH 8.0,2 m M EDTA) a t 4 mA for 12 h. The inserts that contained from 3-9 A tracts phased a t 10.5-bp intervals were constructed by ligation of two duplex oligonucleotidesof 21 and 32 bp, of the following sequence:
ligase (New England Biolabs) a t room temperature ( - 20°C). The ligation produced a ladder of DNA
molecules containing increasing numbers of A tracts. Aliquots of 12 pL were removed a t 10, 15, and 20 min, and loaded directly onto an 8%TBE (89 m M Tris . Borate pH 8.0,2 m M EDTA) gel. The gel was run a t 200 V until the bromophenol blue had migrated about 12 cm on the 16-cm gel, stained with ethidium bromide, and the desired lengths of DNA (3-9 A tracts) were excised from the gel and electroeluted as above. The 5' overhanging ends of the inserts were filled in using the large subunit of E. coli DNA polymerase (Klenow fragment, New England Biolabs), deoxycytidine triphosphate (dCTP), and deoxyguanosine triphosphate (dGTP). The molecules were extracted with phenol/CHCl, and precipitated in ethanol. Ten base pair EcoRl linkers (synthesized on an Applied Biosystems DNA synthesizer) were ligated to the insert at an insert :linker ratio of 1:5. The DNA was then phenol/CHCl extracted, ethanol precipitated, and digested with a 10 X excess of EcoR1. These reactions were loaded directly onto an 8% TBE gel. In general, three bands were obtained for each ligation, containing zero, one, and two EcoRI linkers on the ends of the oligonucleotide. The DNA that contained two linkers was excised and purified as above. One-half of the purified insert was ligated to the vector in a 3 :1 molar ratio of insert:vector, and a volume of 25 pL. For each insert, all six vectors (with linkers varying by 2-bp intervals over one helical turn between the two bend sites) were ligated and cloned. One-half of each ligation was then transformed into AG, cells using the method of Hanahan (1983).13 Minipreparations of the plasmid DNA (minipreps) were performed using a standard alkaline lysis procedure. The orientation of the insert was verified by sequencing of the miniprep DNA using the procedure of Sanger et al.,14 as modified for plasmid DNA by Zagursky. Plasmid DNA was purified using the technique of Clewell et al.I5*l6
5'GGGCAAAAAACGGCAAAAAAC CG'MTMTGCCGTT'ITTTGCC 5' S'GGGCAAAAAACGGCAAAAAACGGGCAAAAAAAC
CGT'T"MT"GCCG'MTMTGCCCGTM"MTGCC 5'
Ten micrograms of each oligonucleotide were incubated together in a 40 pL reaction volume with 3 mJ.4 ATP, 50 m M HC1, PH 7.8, 10 m M MgCl,, 20 m M DT", and 400 units of T4 DNA
Purification of Restriction Fragments
Plasmid DNA was restricted with PvuII and RsaI (New England Biolabs), ethanol precipitated, and run on a 4% TBE gel. The fragment containing the lac operon was excised, and the DNA was electroeluted and purified as above. DNA was then restricted with BstNI, phenol/CHCl extracted, ethanol precipitated, and resuspended in 10 m M Tris . HC1, pH 8.0,1 m M EDTA.
31
COMPARATIVE GEL ELECTROPHORESIS
Purification of Oligonucleotides
Each strand of the two oligonucleotides was synthesized on an Applied Biosystems DNA synthesizer. The crude DNA was purified on a 15% polyacrylamide gel, 20 : 1acrylamide :bis, 8M urea. The main product was visualized by uv shadowing, excised from the gel, and soaked in TAE a t 37°C overnight. The buffer was dialyzed against T E to remove the urea and loaded onto a DEAE-Sephacel (Whatman DE-52) column that had been equilibrated according to the procedure of Maniatis et al.17 The column was rinsed with three column volumes of 10 m M Tris . HC1, pH 8.0,O.lM NaC1, and the DNA was eluted in 1M NaC1,lO m M Tris . HC1,pH 8.0,O.l m M EDTA (TE/10). The DNA was then lyophylized to reduce the volume 10 x.
-
Construction of Test DNA
T o obtain a DNA molecule of comparable length to the calibration DNA with a CAP site in the center, we used DNA that contained the lac promoter region oriented such that the CAP site was distal t o the kDNA. A complete digestion of this DNA with HinPI, followed by a partial restriction digest with BamHI, produced, as one product of this digestion, a 220-bp DNA molecule with a central CAP site. This molecule was excised from the gel and purified as above.
Construction of Control DNA
T o measure the gel retardation due to CAP bound a t the end of a straight DNA molecule, we digested pHW104 (four consecutive lac 203 fragments cloned into pJW37 by Hen-Ming Wu) with HinP1, thereby obtaining a 203-bp lac promoter fragment, which commences with a CAP site. Formation of CAP - DNA complexes
The DNA fragment of interest was incubated with CAP (kindly provided by Dr. Abraham Brown) a t a molar ratio of protein: DNA of 1: 1 (5.5 x 1W "A4 CAP, 5.2 x lO-'*M DNA), in 10 m M Tris . HCl, pH 8.0, 1 m M EDTA, 100 p M CAMP,and 40 m M NaCl and a volume of 10 pL for 20 min a t room temperature ( - 20°C). The protein was 30% active, as judged by DNA-binding gel assays. One-tenth volume of 10 x loading buffer was then added (60% sucrose,0.1% xylene cyanol, 0.1%
-
bromophenol blue) and the reaction mixtures were loaded onto a TBE gel of the desired percentage. Cyclic AMP was added to 10 p M to the running buffer that was recirculated. The acrylamide :bis ratio for all gels was 39: 1. Gels were run in a constant temperature gel box (Hoeffer Scientific) a t 20°C in order to approximate the conditions under which the measurement of the A tract bending angle was The gels were run a t 250 V until the xylene cyanol had migrated 12 cm on the 16-cm gel. Gels were stained with ethidium bromide, visualized by uv light, and photographed using a Polaroid camera and type 667 film.
-
Measurement of Gel Mobilities
The mobilities of the DNA and protein-DNA complexes were measured from a photograph of the gel using a ruler. All measurements were made from the bottom of the well. For each DNA molecule and DNA-protein complex, we computed an R , value, equal to the apparent length of the molecule (from its mobility relative to the GX174 HaeIII digest standards) divided by its actual length.
RESULTS Relationship Between the Bend Angle of D N A and Anomalies in Gel Mobility Design of the Experiment. The basic idea of the experiment was to calibrate the gel assay to the retardation of DNA molecules due to bends in the appropriate range of magnitudes. Once a calibration curve was constructed, the gel retardation due to the CAP was measured and the bend angle (in A tract equivalents) was extrapolated from the calibration curve. The calibration molecules consisted of a set of DNA fragments harboring sequenceinduced bends comprised of from 3 to 9 A tracts phased a t 10.5-bp intervals. The A tracts were placed in the center of the molecule, and a CAP binding site was placed on the end, in order to allow for the frictional contribution of bound protein. The test bend was a DNA fragment of similar length with a CAP site in the center. Figure 1 depicts the set of standard bends and the test bend. The CAP is shown both cis and trans to the A tract bends on the calibration molecules. The entire set of isomers (varying the orientation between the A tract bend and the CAP binding site
32
ZINKEL AND CROTHERS
Standard Bends
Test Bend
Figure 1. Design of the experiment. The standard bends consist of a .set of DNA molecules containing runs of from3 to 9 A tracts phased at 10.5-bp intervals,and in the center of the molecule. A CAP site at the end of theae DNA fragments allows a correction for any gel retardation due to the CAP protein. ‘fietest bend is a DNA of similar length with a centrally located CAP site. CAP protein is shown as two circles. The A tracts are shown as a bold line. CAP protein is shown both cis and trans to the A tracts on the calibration molecules to indicate that the entire set of isomers was constructed for each bend angle, thereby facilitating a correction for any gel mobility changes due to the orientation of CAP protein with respect to the A tract bends.
over one helical turn in 2-bp increments) was constructed for each bend angle to provide a reasonable basis by which to correct for any gel irregularities due to the orientation of the CAP with respect to the A tract bends.
Separation of Gel Retardation E f f e a s due to P r e fein Binding vs DNA Bending. The validity of these comparisons depended on an ability to separate the gel retardation effect of the test molecule due to CAP from that due to the D N A bend induced by CAP. We have shown in a previous paper12 that the orientation of lac repressor with respect to the kDNA bend had no effect on gel mobility of the protein-DNA compIex. Furthermore, the fractional variation of gel mobility in the set of phasing mutants, which arises from intrinsic bends in the promoter fragment, was the same in the free DNA and protein-DNA compkxcs. In the present experiment, we separated the gel retardation due to CAP from that due to the bend by placing the CAP site as dose to the end of the calibration m o l ~ ~ ~asl epoesible, s thus minimizing the effect of the b e d 3 (The restriction site that we used is 21 bp from the center of the CAP site, resulting in a CAP site very close to the minimum size required for tight binding.5) The bend effect cancellation was verified by comparing the value of R , (the apparent number of base pairs judged from electrophoretic mobility divided by the actual number) for all of the phasings of the calibration molecules with a fixed number of A tracts. The standard
-
deviation for R I Avalues was 3%for the calibration molecules. Figure 2 shows a typical gel from which the data were obtained. I t can be readily seen that the gel retardation due to CAP binding was significantly smaller for the molecules that contained the standard bends in the center and a CAP site on the end than for the molecules that harbored the test bend. It is also apparent from lanes 2,4,6, and 9 that the gel mobility decreased in a uniform manner as the number of A tracts was increased. The relationship between the relative curvature of DNA molecules and the gel mobility has been determined for ligated multimers of duplexed oligonucleotides containing A tracts.” For these molecules, the R, value was a quadratic function of the curvature of the molecule (number of A tracts per helical repeat). A calculation of curvature w a s not possible in the present study due to the fact that these molecules contain a substantial percentage of straight DNA. However, by analogy we chose to plot R, values vs the square of the number of A tracts. Figure 3 shows a plot of the (number of A tracts)2 vs R, value for the free DNA. The advantage of using R, value. instead of mobility was that i t was independent of slight variations in the running time of the gel as well as slight variations in the length of different DNA molecules. The data were fit to a quadratic function on a VAX computer, using a least-squares program based on a combination of the Marquardt algorithm and the method of steepest descents (written by S. D.
COMPARATIVE GEL ELECTROPHORESIS
33
Figure 2. A typical gel from which the data were obtained. The percentage of acrylamide used in this gel was 4%, with a ratio of acrylamide :bis of 39 :1. Lanes 1 and 2: calibration molecule with 3 A tracts, - and + CAP,respectively. The band of importance is the middle band in lane 1, which is seen to move to a lower mobility upon the addition of CAP in lane 2. The other two bands that remain unchanged are contaminating vector DNA, Lanes 3 and 4: calibration molecule with 4 A tracts,- and CAP, respectively. Lanes 5 and 6: calibration molecule with 5 A tracts,- and CAP,respectively. Lane 7: HaeIII digest of +X174 DNA markers. Lanes 8 and 9: calibration molecule containing 6 A tracts,- and + CAP,respectively. Lane 10: HinPI digest of wt 203 fragment of the 2ac operon + CAP (control for mobility of CAP bound on the end of a straight piece of DNA).Lanes 11 and 12: test bend (CAP site in the center of a DNA fragment) - and + CAP, respectively. The gel mobility increases in a uniform manner as the number of A tracts is increased. The gel retardation due to CAP binding is significantly smaller for the calibration molecules than for the test molecule.
+
Levene). The data show a very good fit to a quadratic polynomial (quartic in the number of A tracts) for molecules containing up to 6 A tracts. The shape of the curve leveled off after 6 A tracts for all gel percentages employed. Figure 4 shows a plot of the (number of A tracts)2 vs R , value for the CAP-DNA complexes. It was not possible to calculate the gel retardation due to the CAP molecule alone from an extrapolation to zero bend of a plot of RuCAP)/RLFD due to the shape of the curve. Instead, we used the R , value of a straight DNA molecule (derived from the lac 203 fragment) with a CAP molecule bound
+
at the end. The data show a very good fit to a quadratic polynomial up to the point of 6 A tracts, where the curve began to plateau. Although the absolute R , values varied with the percentage of acrylamide, the shape of the curve remained that of a second-order polynomial. Choice of Calibration Curve for the Determination of the CAP Bend Angle. The irregular shape of the plots of Figure 4 precluded a simple choice for the
calibration curve. Up to the point of seven A tracts, the curves were quite regular, after which some competing factor began to dominate the gel mobil-
34
ZINKEL AND CROTHERS
A Tracts
A Tracts
2w
R
t
L
3
4"/0
2
3.2'
L 3.2"
1
0
4c
570
4
L 3
20
CAP
J
R i 0
+
60
80
100
2
'i 0
20
40
80
60
100
(# A Tracts)
Figure 3. Plot of (number of A tracts)2 vs R , for the free DNA. The five curves show different gel percentages on which the DNA was run.As graphed, the data show a very good fit to a quadratic for molecules containing up to 6 A tracts for all gel percentages tested, after which it levels off dramatically. The point at which the plot plateaus is independent of gel concentration.
ity and the curve became flat. In the absence of a clear explanation of all of the factors involved, or a reasonable means to describe the whole curve, we focused on the portion of the curve that was still regular in shape (corresponding to the data points from 3 to 6 A tracts) as a calibration curve for the gel mobility of bent DNA (Figure 5). Since the R , value for the test bend was within the regular region of the curve (between the R, values for 5 and 6 A tracts), the mobility of the CAP bend should conform to that expected for a calibration molecule containing a bend of similar magnitude. Additional support for the validity of this choice comes from the data of Gartenberg and Crothers (1988)." They showed that a positive or negative change in the CAP-induced DNA bend of magnitude equal t o 1 A tract, due to mutations in the CAP binding site, results in a large and linear change of gel mobility. A corresponding increase in the bend angle that we calculate for CAP would place this bend around the magnitude of 7 A tracts. This indicates that for CAP-DNA complexes, the
2
(# A Tracts)
Figure 4. Plot of (number of A tracts)' vs R , for CAP-DNA complexes. The data show the same effect as the corresponding plot for free DNA (Figure 3), fitting well to a quadratic polymanial up to the point of 6 A tracts for all gel percentages tested, and then leveling off. The point for 0 A tracts was measured directly from the gel retardation of a straight fragment of DNA with a CAP site on the end.
gel mobility should continue to conform to the behavior of the calibration curve, and should not level off with increasing bend angle in the same manner as was seen for large A tract induced bends. Estimate of Error. Several factors must be considered in the calculation of the error of these measurements. First, there was some degree of error in the accuracy of the measurement of gel mobilities. We estimate this uncertainty to be approximately 0.5 times the bandwidth ( - 0.1 cm) divided by the total distance migrated, or about 1%.Some additional uncertainty arose from the uncertainty in the extrapolation of the test point from the curve, and from the different radii of curvature of the CAP bend vs an equivalent bend directed by A tracts. We estimated the total error, therefore, to be on the order of 0.3 A tracts.
COMPARATIVE GEL ELECTROPHORESIS
36
Table I Effect of Gel Concentration on Estimation of Bend Angle" Calibration Equation % Acrylamide 4
(Ax2 4.04885
+ Bx + C )
1.85003
x ~ o - X~ 5
1.12871
8
1.92409
1.43097
R , of CAP
R , of CAP
A Tract
(Centered)
(33% to end)
Equivalents
2.409 2.262
~ O - ~
1.54366
1.75145
3.486
x ~ o - XIO-~ ~ 3.2633
3.065 5.44
2.49508
5.6 5.3 5.6 5.3 5.6
5 0.3
i 0.3 k 0.3 k 0.3 i 0.3
In terms of A tract equivalents.
5% Calibration Curve
different acrylamide concentrations to determine the effect of pore size on the apparent bend angle. The data for these molecules as well as the equations for the calibration curves a t the three different concentrations of acrylamide are shown in Table I. The bends angles calculated for CAP bound to wt 203 fragments were 5.3 A tracts for a 4% and a 5% gel, and 5.6 A tracts for an 8% gel. Although these values showed a trend toward a greater CAP bend angle relative to A tract bend angles a t high gel concentrations, they were identical to within experimental error, which indicated that the method is effectively independent of gel concentration.
DISCUSSION 0
20
40
60
80
2 (# A Tracts) Figure 5. Calibration curve for a 5% gel. We have chosen to fit the first five points of the plot of (number of A tracts)' vs R , , for the CAP-DNA complexes to a quadratic polynomial for the purposes of a calibration curve. The R , , value for the test bend falls within this range. Lack of Dependence of Caicutated Angte on Get Concentration. Although the absolute R , values
varied with acrylamide concentration, when the bend angle of CAP was determined from the R , value of the test bend and the calibration curve from the corresponding acrylamide concentration, the bend angles in A tract equivalents were 5.6 A tracts for a 4% gel and 5.7 A tracts for a 5% gel. The CAP site was located approximately one-third of the way from one end of the wild-type lac 203 fragment when it was restricted with EcoRI. We measured the bend angle of this fragment when CAP was bound in A tract equivalents a t three
The induction of a bend upon binding to DNA is a common feature of many DNA-binding prot e i n ~ . ~An , ~important ~ - ~ ~ first step in understanding the relevance of DNA bending to the biological function of these proteins is an estimate of the magnitude of the bend. Measurements of the extent of protein-induced DNA bends present some unique problems due to the fact that many protein-DNA complexes are not stable under the conditions required for physical techniques. In addition, many of these complexes are difficult to prepare in quantities large enough and pure enough to be amenable to study by such methods. Gel electrophoresis has been the primary technique used to study DNA bending, both sequencedirected and protein-induced. The anomaly in gel mobility is an increasing function of the extent of bending of the DNA molecule, and has been suggested to be proportional to the mean square endto-end distance of the molecule on the basis of theoretical calculations.8~9An empirical relationship between the gel mobility and the relative curvature of bent DNA molecules has been determined for the case of sequence-induced bends."
36
ZINKEL AND CROTHERS
This relationship was determined for the case of DNA bends that are evenly distributed along the helix axis and well phased with the helix screw, and is useful for estimating the curvature of DNA fragments based on their gel mobility. However, this method is not directly applicable to the problem posed by protein-induced DNA bending where there is an additional contribution to gel retardation from the protein molecule. Calibration Molecules
The basic approach of our experiment was to calibrate the gel retardation of bent DNA to the magnitude of the bend using runs of from 3 to 9 A tracts repeated a t 10.5-bp helical phasing. Each of these standard molecules also contained a CAP binding site centered a t 20 bp from the end of the molecule, thus providing a control for the gel retardation due t o CAP protein while minimizing any contribution of the CAP-induced bend. A plot of the relative mobility vs the square of the number of A tracts (Figures 3 and 4) was fit by a second-order polynomial up to 6 A tracts. For larger numbers of A tracts, the R , values did not continue to increase, but leveled off. The point a t which the curve plateaus was rather abrupt, was
the same for all gel percentages employed and was independent of the presence of CAP bound a t the molecular end. This result is not predicted by the current theories of gel electrophoresis; it implies that the generally observed dependence of mobility anomaly on end-to-end distance breaks down for centrally located bends above the magnitude of 6 A tracts. One interpretation of these results is that for highly bent molecules, the reptation mode of gel migration becomes less favorable since it becomes increasingly difficult for the molecule to untangle itself from the gel matrix. The mode of separation may resemble more closely a gel filtration effect in these instances, and therefore be dependent on the minimum tube size required for movement through the gel. In the calibration molecules presented here, the observed change in mode of migration coincides with a change in the placement of long and short axes in the molecule. This is illustrated in Figure 6, where it can be seen that for bends centered on the molecule and up to 120", the long axis lies parallel to the end-to-end vector, and the short axis is perpendicular to the long axis. For bend angles of 120", the long axis is parallel to either side of the DNA molecule. The longest dimension in molecules with bend angles above 120" (the angle in the figure is the comple\
\
\
\
\
\
\ \
\
\ \
L\
\
\ '-\
\
90"
\
\
\ \
\
\ \
\
\
\
\
\
\
\
\
\ \ \
\
\
\ \
\
Figure 6. Illustration of the change in the long axis of DNA molecules with increasing bend angle. The angles in the figure are the complements of the bend angles as defined in the text. For a bend angle of go", the long axis of the molecule lies parallel to the end-to-end vector. For a bend angle of 120", the molecule is symmetric and has a longest dimension along any side of the triangdar figure. For a bend angle greater than 120", the longest dimension of the molecule parallels one side and is nearly perpendicular to the end-to-end vector.
COMPARATIVE GEL ELECTROPHORESIS
ment t o what we have defined as the bend angle) is parallel to one of the sides of the acutely bent DNA and nearly perpendicular to the end-to-end vector. Thus the predicted axis change a t 120" corresponds t o the bend induced by 6 A tracts of 20" bend each,'oy'l and coincides with the observed point a t which a plateau is reached in the dependence of R , on number of A tracts. The exact angle of the crossover is predicted to shift if the bend is not centered on the DNA molecule. Recently, Calladine et al. (1988)30 proposed a quantitative scheme for explaining the anomalous electrophretic mobility of repeating sequence DNA. The basic feature of the model is that such DNA adopts a superhelical configuration, and that the diameter of the superhelix determines the tube size required for migration and hence sets the limiting R,, value for the molecule. Applying this model to our data, one predicts that the maximum tube size is required when the bend angle is 120" (see Figure 6). Since more than 6 A tracts yield no further increase in R,, we would conclude that the bend per A tract is about 20", in reasonable agreement with other estimates. However, this value is roughly twice as large as deduced by Calladine et al.30 using the same logic on other molecules. Clearly, these simplified models of gel electrophoretic behavior are semiquantitative a t best.
Measurement of the DNA Bend Angle induced by CAP
The gel mobility of the DNA molecule containing a CAP-induced bend was measured by placing the CAP binding site in the center of a DNA molecule of similar length to the calibration molecules. The bend angle in A tract equivalents was then calculated from the calibration curve by extrapolation. The values in A tract equivalents were: 5.6 for a 4% gel and 5.7 for a 5% gel (Table I). When CAP was bound to a site that is not centered, but one-third of the distance from the end of the molecule, the measured bend angles were 5.3 A tracts for 4% and 5% gels, and 5.6 A tracts for 8% gels. These values are equivalent to within the estimated error of 0.3 A tracts, and therefore the method appears to be independent of gel concentration within the range tested. From the cyclization experiments on ligations of duplex oligonucleotides harboring runs of A's repeated a t 10.5-bp intervals, the bend angle for an A tract has been estimated to be 18", f 10%.lo~'l Using this value, the CAP bend angle is 101", k12".
37
Model building studies based on a crystal structure of CAP7 have predicted a bend angle of 150". The model was built by wrapping the DNA around a ramp of positive electrostatic potential on the surface of the CAP protein, thus yielding an upper limit to the possible CAP bend angle. In solution, it is probable that the DNA has some degree of flexibility due to thermal motion and one might expect to observe a lower bend angle on a gel.
-
Comparison with the Results of Thompson and Landy
T h e CAP-induced bend angle obtained by Thompson and Landys is equivalent to 7-8 A tracts compared to our value of 5.6. Their analysis relies on variation of gel mobility when the bend is moved from the end to the center of the molecule and compares molecules of quite different gel mobilities. In our approach we attempted to match, to first order, the gel mobilities of test and comparison molecules by including a protein binding site on both. In spite of these differences, the results from the two approaches are similar. A likely source of the residual disagreement is the difference in comparison bends. Phasing a t 10.5 bp, as is the case in our experiments, yields significantly greater anomaly in electrophoretic mobility because the curved molecules remain planar. Hence it should take fewer A tracts in our system to mimic the CAP bend than in the experiments of Thompson and Landy.
Possible Nonequivalent Features of Intrinsic and Protein-Induced Bends
The theory of gel electrophoresis is not sufficiently developed for us to set rigorous limits on the accuracy of our underlying assumption that the electrophoretic influence of DNA bends is independent of their source. It is likely that the CAP-induced bend has a somewhat smaller radius of curvature than the intrinsic bend, an influence whose importance is difficult to assess. In general, it appears that the major effect of DNA bends on mobility is exerted through their influence on the angle between large flanking DNA segments, in which case the radius of curvature should have only minor consequences. In addition, the segment of DNA bound tightly to CAP ( - 26 bp) is probably substantially less flexible than the remainder of the chain. This may modify electrophoretic mobility if
38
ZINKEI. AND CROTHERS
flexure of the molecule is important during gel migration (S. D. Levene and B. H. Zimm personal communication), although the region of increased rigidity is a minor fraction of the total DNA length in the present case. General Consideration
The frequency with which protein-induced DNA bending occurs in DNA regulatory domain^^,^^- 27 suggests a role for this structural motif in the regulation of DNA replication and transcription. Such bends provide the potential for storing a considerable amount of energy, which may then be used to overcome the activation energy to various steps in these pr~cesses.~ An important step in understanding the relevance of DNA bending to these biological processes is an estimation of the extent of the bend. Our method does not require large quantities of highly purified material and should therefore be accessible to a number of systems where sample material is limited. An estimation of the extent of DNA bending involved in a variety of systems should be useful in the elucidation of the function of DNA bending in biological processes.
REFERENCES 1. Fried, M. G. & Crothers, D. M. (1983) Nucleic Acids Res. 11, 141-158. 2. Kolb, A., Spassky, A., Chapon, C., Blazy, B. & Buc, H. (1983) Nucleic Acids Res. 11,7833-7852. 3. Wu, H. M. & Crothers, D. M. (1984) Nature 308, 509- 513. 4. Majors, J. (1977) Ph.D. thesis, Harvard University,
Cambridge, MA. 5. Liu-Johnson, H. N., Gartenberg, M. R. & Crothers,
D. M. (1986) Cell 47,995-1005. 6. Weber, I..T. & Steitz, T. A. (1984) Proc. Natl. Acad. Sci. USA 81, 3973-3977. 7. Warwicker, J., Engelman, B. P. & Steitz, T. A. (1987) Proteins 2, 283-289.
8. Porschke, D., Hillen, W. & Takahashi, M. (1984) EMBO J . 3, 2873- 2878. 9. Thompson, J. F. & Landy, A. (1988) Nucleic Acids Res. 16, 9687-9705. 10. Koo, H. S., Drak, J., Rice, J. A. & Crothers, D. M. (1989), submitted for publication. 11. Kunke, G., Fritz, H. J. & Ehring, R. (1987) EMBO J. 6, 507-513. 12. Zinkel, S. S. & Crothers, I). M. (1987) Nature 328, 178-181. 13. Hanahan, D. (1983) J . Mol. Bwl. 166, 557-580. 14. Sanger, F., Nicklen, S. & Coulson, A. R. (1977) Proc. Natl. Acad. Sci. USA 74, 5463-5467. 15. Clewell, D. B. & Helinski, D. R. (1969) Proc. Natl. Acad. Sci. USA 62, 1159-1166. 16. Clewell, D. B. (1972) J . Bacterial. 110,667-676. 17. Maniatis, T., Fritsch, E. F., Sambrook, J. (1982)
Molecular Cloning: A Zuboratory manuul, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. 18. Koo, H. S. & Crothers, I). M. (1988) Proc. Natl. Acad. Sci. USA 85, 1763-1767. 19. Gartenberg, M. R. & Crothers, D. M. (1988) Nature 333, 824- 829. 20. Shuey, D. J. & Parker, C. S. (1986) Nature 323, 459-461. 21. Kunke, G., Fritz, H. J. & Ehring, R. (1987) EMBO J . 6, 507-513. 22. Mukhejee, S., Parel, I. & Bastia, D. (1985) Cell 43, 189-197. 23. Ryder, K., Silver, S., Delucia, A. L., Fanning, E. & Tegtmeyer, P. (1986) Cell 44, 719-725. 24. Zahn, K. & Blattner, F. R. (1987) Science 236, 416-422. 25. Hatfull, G. F., Noble, S. Z. & Grindley, N. G. F. (1987) Cell 49, 103-110. 25. Richmond, T. J., Finch, J. T., Rushton, B., Rhodes, D. & Klug, A. (1984) Nature 311, 532-537. 27. Anderson, J. E., Ptashne, M. & Harrison, S. C. (1987) Nature 326, 846-852. 28. Lerman, L. S. & Frisch, H. L. (1982) 3wpoZymers 21, 995-997. 29. Lumpkin, 0. J. & Zimm, B. H. (1982) Biopolymers 21, 2315-2316. 30. Calladine, C. R., Drew, H. R. & McCall, M. J. (1988) J . Mol. Biol. 201, 127-137.
Received April 25, 1989 Accepted June 9, 1989
Departments of Molecular Biophysics and Biochemistry and Chemistry, Yale University, New Haven, Connecticut 06512
SYNOPSIS
We describe a method to detennine the magnitude of protein-induced DNA bends relative t o a set of standard A tract bends using comparative gel electrophoresis. The DNA bend of interest was that induced by the catabolite activator protein (CAP), the transcriptional activator protein of the lac operon. The set of comparison molecules contained both bends of known magnitude and a bound CAP. The electrophoretic influence of the bound protein was accounted for by placing its binding site at the end of the molecule where its induced bend has little influence. Standard bends at the DNA center were introduced by 10.5 base-pair phasing. The mobility of these control incorporating 3-9 A, tracts at molecules was compared to the mobility of a test molecule of comparable length containing a central CAP-induced DNA bend. The CAP bend angle was found to be 5.6 f 0.3 A tract loo", independent of the concentration of the gel used within the range equivalents, or tested. The dependence of gel retardation on DNA end-bend distance was found to break down for A tract bend angles above 120". corresponding roughly to the angle beyond which the long axis of the molecule is no longer parallel to the end-to-end vector. We speculate that this may reflect a switch in the mode of migration of molecules through the gel.
-
-
INTRODUCTION Gene expression in prokaryotes is mediated primarily through the specific interaction of proteins with DNA sequences. An understanding of the mechanisms by which these proteins act is therefore central to the elucidation of transcriptional control. A classic gene regulatory system is the lac operon of Escherichia coli, for which transcription of the genes for three proteins involved in lactose metabolism is stimulated by the catabolite activator protein or CAP, also known as the CAMP receptor protein or CRP. Gel electrophoresis studhave indicated that CAP induces a bend
0 1990 John Wiley & Sons, Inc. CCC 0006-3525/90/010029-10 $04.00 Biopolymers, Vol. 29, 29-38 (1990)
upon binding to DNA. Additional evidence in support of a CAP-induced DNA bend arises from the finding that a large binding site [28-30 base pairs (bp)] is necessary for strong complex f ~ r m a t i o n , ~ . ~ and from molecular modeling, which predicts a sharply bent DNA conformation in contact with a ramp of positive electrostatic potential on three sides of the pr~tein.~,' The hydrodynamic properties of CAP-DNA complexes also support substantial bending.8 It has been proposed that the energy stored in the DNA bend may be released to do mechanical work during transcription initiati~n,~ but the role of the DNA bend in the activation of transcription is not well understood. In view of these considerations, measurement of the magnitude of the CAP-induced DNA bend is an important step in reaching an understanding of its role in biological function. Thompson and Landyg recently reported an estimate of the CAP-
30
ZINKEL AND CROTHERS
induced bend by comparing the relative mobility of molecules that have a bend respectively in the middle or a t an end of the molecule. Standard bends were supplied by A tracts, as in ow experiments; our approach differs from theirs in that our comparison molecules contain both A tracts and bound protein. In addition, the standard A tracts 10.5 in the molecules we studied were phased a t bp rather than 10 bp as in the Thompson and Landy experiments, and were of sequence essentially identical to that used for determination of the A tract bend angle by cyclization kinetics.","
-
MATERfALS AND METHODS Construction of Calibration DNA The parent DNA for these experiments12consisted of an isomeric set of DNA molecules containing a protein-induced bend (CAP) flanking a sequencedirected bend, the latter deriving from a segment of kinetoplast DNA (kDNA) from the parasite Leishmunia tarentohe. The phasing between the bends was shifted over one helical turn by the addition of linkers between them. The calibration DNA was constructed by replacing the kDNA from the parent molecules with runs of from 3-9 A tracts phased a t 10.5-bp intervals. To accomplish this, the parent DNA was restricted with EcoRI, treated with calf intestinal alkaline phosphatase (Roehringer-Mannheim), and run on a 4% polyacrylamide gel to separate the vector from the kDNA insert. The vector was then visualized by uv shadowing, cut from the gel, and electroeluted into TAE (40 m M tris-acetate, pH 8.0,2 m M EDTA) a t 4 mA for 12 h. The inserts that contained from 3-9 A tracts phased a t 10.5-bp intervals were constructed by ligation of two duplex oligonucleotidesof 21 and 32 bp, of the following sequence:
ligase (New England Biolabs) a t room temperature ( - 20°C). The ligation produced a ladder of DNA
molecules containing increasing numbers of A tracts. Aliquots of 12 pL were removed a t 10, 15, and 20 min, and loaded directly onto an 8%TBE (89 m M Tris . Borate pH 8.0,2 m M EDTA) gel. The gel was run a t 200 V until the bromophenol blue had migrated about 12 cm on the 16-cm gel, stained with ethidium bromide, and the desired lengths of DNA (3-9 A tracts) were excised from the gel and electroeluted as above. The 5' overhanging ends of the inserts were filled in using the large subunit of E. coli DNA polymerase (Klenow fragment, New England Biolabs), deoxycytidine triphosphate (dCTP), and deoxyguanosine triphosphate (dGTP). The molecules were extracted with phenol/CHCl, and precipitated in ethanol. Ten base pair EcoRl linkers (synthesized on an Applied Biosystems DNA synthesizer) were ligated to the insert at an insert :linker ratio of 1:5. The DNA was then phenol/CHCl extracted, ethanol precipitated, and digested with a 10 X excess of EcoR1. These reactions were loaded directly onto an 8% TBE gel. In general, three bands were obtained for each ligation, containing zero, one, and two EcoRI linkers on the ends of the oligonucleotide. The DNA that contained two linkers was excised and purified as above. One-half of the purified insert was ligated to the vector in a 3 :1 molar ratio of insert:vector, and a volume of 25 pL. For each insert, all six vectors (with linkers varying by 2-bp intervals over one helical turn between the two bend sites) were ligated and cloned. One-half of each ligation was then transformed into AG, cells using the method of Hanahan (1983).13 Minipreparations of the plasmid DNA (minipreps) were performed using a standard alkaline lysis procedure. The orientation of the insert was verified by sequencing of the miniprep DNA using the procedure of Sanger et al.,14 as modified for plasmid DNA by Zagursky. Plasmid DNA was purified using the technique of Clewell et al.I5*l6
5'GGGCAAAAAACGGCAAAAAAC CG'MTMTGCCGTT'ITTTGCC 5' S'GGGCAAAAAACGGCAAAAAACGGGCAAAAAAAC
CGT'T"MT"GCCG'MTMTGCCCGTM"MTGCC 5'
Ten micrograms of each oligonucleotide were incubated together in a 40 pL reaction volume with 3 mJ.4 ATP, 50 m M HC1, PH 7.8, 10 m M MgCl,, 20 m M DT", and 400 units of T4 DNA
Purification of Restriction Fragments
Plasmid DNA was restricted with PvuII and RsaI (New England Biolabs), ethanol precipitated, and run on a 4% TBE gel. The fragment containing the lac operon was excised, and the DNA was electroeluted and purified as above. DNA was then restricted with BstNI, phenol/CHCl extracted, ethanol precipitated, and resuspended in 10 m M Tris . HC1, pH 8.0,1 m M EDTA.
31
COMPARATIVE GEL ELECTROPHORESIS
Purification of Oligonucleotides
Each strand of the two oligonucleotides was synthesized on an Applied Biosystems DNA synthesizer. The crude DNA was purified on a 15% polyacrylamide gel, 20 : 1acrylamide :bis, 8M urea. The main product was visualized by uv shadowing, excised from the gel, and soaked in TAE a t 37°C overnight. The buffer was dialyzed against T E to remove the urea and loaded onto a DEAE-Sephacel (Whatman DE-52) column that had been equilibrated according to the procedure of Maniatis et al.17 The column was rinsed with three column volumes of 10 m M Tris . HC1, pH 8.0,O.lM NaC1, and the DNA was eluted in 1M NaC1,lO m M Tris . HC1,pH 8.0,O.l m M EDTA (TE/10). The DNA was then lyophylized to reduce the volume 10 x.
-
Construction of Test DNA
T o obtain a DNA molecule of comparable length to the calibration DNA with a CAP site in the center, we used DNA that contained the lac promoter region oriented such that the CAP site was distal t o the kDNA. A complete digestion of this DNA with HinPI, followed by a partial restriction digest with BamHI, produced, as one product of this digestion, a 220-bp DNA molecule with a central CAP site. This molecule was excised from the gel and purified as above.
Construction of Control DNA
T o measure the gel retardation due to CAP bound a t the end of a straight DNA molecule, we digested pHW104 (four consecutive lac 203 fragments cloned into pJW37 by Hen-Ming Wu) with HinP1, thereby obtaining a 203-bp lac promoter fragment, which commences with a CAP site. Formation of CAP - DNA complexes
The DNA fragment of interest was incubated with CAP (kindly provided by Dr. Abraham Brown) a t a molar ratio of protein: DNA of 1: 1 (5.5 x 1W "A4 CAP, 5.2 x lO-'*M DNA), in 10 m M Tris . HCl, pH 8.0, 1 m M EDTA, 100 p M CAMP,and 40 m M NaCl and a volume of 10 pL for 20 min a t room temperature ( - 20°C). The protein was 30% active, as judged by DNA-binding gel assays. One-tenth volume of 10 x loading buffer was then added (60% sucrose,0.1% xylene cyanol, 0.1%
-
bromophenol blue) and the reaction mixtures were loaded onto a TBE gel of the desired percentage. Cyclic AMP was added to 10 p M to the running buffer that was recirculated. The acrylamide :bis ratio for all gels was 39: 1. Gels were run in a constant temperature gel box (Hoeffer Scientific) a t 20°C in order to approximate the conditions under which the measurement of the A tract bending angle was The gels were run a t 250 V until the xylene cyanol had migrated 12 cm on the 16-cm gel. Gels were stained with ethidium bromide, visualized by uv light, and photographed using a Polaroid camera and type 667 film.
-
Measurement of Gel Mobilities
The mobilities of the DNA and protein-DNA complexes were measured from a photograph of the gel using a ruler. All measurements were made from the bottom of the well. For each DNA molecule and DNA-protein complex, we computed an R , value, equal to the apparent length of the molecule (from its mobility relative to the GX174 HaeIII digest standards) divided by its actual length.
RESULTS Relationship Between the Bend Angle of D N A and Anomalies in Gel Mobility Design of the Experiment. The basic idea of the experiment was to calibrate the gel assay to the retardation of DNA molecules due to bends in the appropriate range of magnitudes. Once a calibration curve was constructed, the gel retardation due to the CAP was measured and the bend angle (in A tract equivalents) was extrapolated from the calibration curve. The calibration molecules consisted of a set of DNA fragments harboring sequenceinduced bends comprised of from 3 to 9 A tracts phased a t 10.5-bp intervals. The A tracts were placed in the center of the molecule, and a CAP binding site was placed on the end, in order to allow for the frictional contribution of bound protein. The test bend was a DNA fragment of similar length with a CAP site in the center. Figure 1 depicts the set of standard bends and the test bend. The CAP is shown both cis and trans to the A tract bends on the calibration molecules. The entire set of isomers (varying the orientation between the A tract bend and the CAP binding site
32
ZINKEL AND CROTHERS
Standard Bends
Test Bend
Figure 1. Design of the experiment. The standard bends consist of a .set of DNA molecules containing runs of from3 to 9 A tracts phased at 10.5-bp intervals,and in the center of the molecule. A CAP site at the end of theae DNA fragments allows a correction for any gel retardation due to the CAP protein. ‘fietest bend is a DNA of similar length with a centrally located CAP site. CAP protein is shown as two circles. The A tracts are shown as a bold line. CAP protein is shown both cis and trans to the A tracts on the calibration molecules to indicate that the entire set of isomers was constructed for each bend angle, thereby facilitating a correction for any gel mobility changes due to the orientation of CAP protein with respect to the A tract bends.
over one helical turn in 2-bp increments) was constructed for each bend angle to provide a reasonable basis by which to correct for any gel irregularities due to the orientation of the CAP with respect to the A tract bends.
Separation of Gel Retardation E f f e a s due to P r e fein Binding vs DNA Bending. The validity of these comparisons depended on an ability to separate the gel retardation effect of the test molecule due to CAP from that due to the D N A bend induced by CAP. We have shown in a previous paper12 that the orientation of lac repressor with respect to the kDNA bend had no effect on gel mobility of the protein-DNA compIex. Furthermore, the fractional variation of gel mobility in the set of phasing mutants, which arises from intrinsic bends in the promoter fragment, was the same in the free DNA and protein-DNA compkxcs. In the present experiment, we separated the gel retardation due to CAP from that due to the bend by placing the CAP site as dose to the end of the calibration m o l ~ ~ ~asl epoesible, s thus minimizing the effect of the b e d 3 (The restriction site that we used is 21 bp from the center of the CAP site, resulting in a CAP site very close to the minimum size required for tight binding.5) The bend effect cancellation was verified by comparing the value of R , (the apparent number of base pairs judged from electrophoretic mobility divided by the actual number) for all of the phasings of the calibration molecules with a fixed number of A tracts. The standard
-
deviation for R I Avalues was 3%for the calibration molecules. Figure 2 shows a typical gel from which the data were obtained. I t can be readily seen that the gel retardation due to CAP binding was significantly smaller for the molecules that contained the standard bends in the center and a CAP site on the end than for the molecules that harbored the test bend. It is also apparent from lanes 2,4,6, and 9 that the gel mobility decreased in a uniform manner as the number of A tracts was increased. The relationship between the relative curvature of DNA molecules and the gel mobility has been determined for ligated multimers of duplexed oligonucleotides containing A tracts.” For these molecules, the R, value was a quadratic function of the curvature of the molecule (number of A tracts per helical repeat). A calculation of curvature w a s not possible in the present study due to the fact that these molecules contain a substantial percentage of straight DNA. However, by analogy we chose to plot R, values vs the square of the number of A tracts. Figure 3 shows a plot of the (number of A tracts)2 vs R, value for the free DNA. The advantage of using R, value. instead of mobility was that i t was independent of slight variations in the running time of the gel as well as slight variations in the length of different DNA molecules. The data were fit to a quadratic function on a VAX computer, using a least-squares program based on a combination of the Marquardt algorithm and the method of steepest descents (written by S. D.
COMPARATIVE GEL ELECTROPHORESIS
33
Figure 2. A typical gel from which the data were obtained. The percentage of acrylamide used in this gel was 4%, with a ratio of acrylamide :bis of 39 :1. Lanes 1 and 2: calibration molecule with 3 A tracts, - and + CAP,respectively. The band of importance is the middle band in lane 1, which is seen to move to a lower mobility upon the addition of CAP in lane 2. The other two bands that remain unchanged are contaminating vector DNA, Lanes 3 and 4: calibration molecule with 4 A tracts,- and CAP, respectively. Lanes 5 and 6: calibration molecule with 5 A tracts,- and CAP,respectively. Lane 7: HaeIII digest of +X174 DNA markers. Lanes 8 and 9: calibration molecule containing 6 A tracts,- and + CAP,respectively. Lane 10: HinPI digest of wt 203 fragment of the 2ac operon + CAP (control for mobility of CAP bound on the end of a straight piece of DNA).Lanes 11 and 12: test bend (CAP site in the center of a DNA fragment) - and + CAP, respectively. The gel mobility increases in a uniform manner as the number of A tracts is increased. The gel retardation due to CAP binding is significantly smaller for the calibration molecules than for the test molecule.
+
Levene). The data show a very good fit to a quadratic polynomial (quartic in the number of A tracts) for molecules containing up to 6 A tracts. The shape of the curve leveled off after 6 A tracts for all gel percentages employed. Figure 4 shows a plot of the (number of A tracts)2 vs R , value for the CAP-DNA complexes. It was not possible to calculate the gel retardation due to the CAP molecule alone from an extrapolation to zero bend of a plot of RuCAP)/RLFD due to the shape of the curve. Instead, we used the R , value of a straight DNA molecule (derived from the lac 203 fragment) with a CAP molecule bound
+
at the end. The data show a very good fit to a quadratic polynomial up to the point of 6 A tracts, where the curve began to plateau. Although the absolute R , values varied with the percentage of acrylamide, the shape of the curve remained that of a second-order polynomial. Choice of Calibration Curve for the Determination of the CAP Bend Angle. The irregular shape of the plots of Figure 4 precluded a simple choice for the
calibration curve. Up to the point of seven A tracts, the curves were quite regular, after which some competing factor began to dominate the gel mobil-
34
ZINKEL AND CROTHERS
A Tracts
A Tracts
2w
R
t
L
3
4"/0
2
3.2'
L 3.2"
1
0
4c
570
4
L 3
20
CAP
J
R i 0
+
60
80
100
2
'i 0
20
40
80
60
100
(# A Tracts)
Figure 3. Plot of (number of A tracts)2 vs R , for the free DNA. The five curves show different gel percentages on which the DNA was run.As graphed, the data show a very good fit to a quadratic for molecules containing up to 6 A tracts for all gel percentages tested, after which it levels off dramatically. The point at which the plot plateaus is independent of gel concentration.
ity and the curve became flat. In the absence of a clear explanation of all of the factors involved, or a reasonable means to describe the whole curve, we focused on the portion of the curve that was still regular in shape (corresponding to the data points from 3 to 6 A tracts) as a calibration curve for the gel mobility of bent DNA (Figure 5). Since the R , value for the test bend was within the regular region of the curve (between the R, values for 5 and 6 A tracts), the mobility of the CAP bend should conform to that expected for a calibration molecule containing a bend of similar magnitude. Additional support for the validity of this choice comes from the data of Gartenberg and Crothers (1988)." They showed that a positive or negative change in the CAP-induced DNA bend of magnitude equal t o 1 A tract, due to mutations in the CAP binding site, results in a large and linear change of gel mobility. A corresponding increase in the bend angle that we calculate for CAP would place this bend around the magnitude of 7 A tracts. This indicates that for CAP-DNA complexes, the
2
(# A Tracts)
Figure 4. Plot of (number of A tracts)' vs R , for CAP-DNA complexes. The data show the same effect as the corresponding plot for free DNA (Figure 3), fitting well to a quadratic polymanial up to the point of 6 A tracts for all gel percentages tested, and then leveling off. The point for 0 A tracts was measured directly from the gel retardation of a straight fragment of DNA with a CAP site on the end.
gel mobility should continue to conform to the behavior of the calibration curve, and should not level off with increasing bend angle in the same manner as was seen for large A tract induced bends. Estimate of Error. Several factors must be considered in the calculation of the error of these measurements. First, there was some degree of error in the accuracy of the measurement of gel mobilities. We estimate this uncertainty to be approximately 0.5 times the bandwidth ( - 0.1 cm) divided by the total distance migrated, or about 1%.Some additional uncertainty arose from the uncertainty in the extrapolation of the test point from the curve, and from the different radii of curvature of the CAP bend vs an equivalent bend directed by A tracts. We estimated the total error, therefore, to be on the order of 0.3 A tracts.
COMPARATIVE GEL ELECTROPHORESIS
36
Table I Effect of Gel Concentration on Estimation of Bend Angle" Calibration Equation % Acrylamide 4
(Ax2 4.04885
+ Bx + C )
1.85003
x ~ o - X~ 5
1.12871
8
1.92409
1.43097
R , of CAP
R , of CAP
A Tract
(Centered)
(33% to end)
Equivalents
2.409 2.262
~ O - ~
1.54366
1.75145
3.486
x ~ o - XIO-~ ~ 3.2633
3.065 5.44
2.49508
5.6 5.3 5.6 5.3 5.6
5 0.3
i 0.3 k 0.3 k 0.3 i 0.3
In terms of A tract equivalents.
5% Calibration Curve
different acrylamide concentrations to determine the effect of pore size on the apparent bend angle. The data for these molecules as well as the equations for the calibration curves a t the three different concentrations of acrylamide are shown in Table I. The bends angles calculated for CAP bound to wt 203 fragments were 5.3 A tracts for a 4% and a 5% gel, and 5.6 A tracts for an 8% gel. Although these values showed a trend toward a greater CAP bend angle relative to A tract bend angles a t high gel concentrations, they were identical to within experimental error, which indicated that the method is effectively independent of gel concentration.
DISCUSSION 0
20
40
60
80
2 (# A Tracts) Figure 5. Calibration curve for a 5% gel. We have chosen to fit the first five points of the plot of (number of A tracts)' vs R , , for the CAP-DNA complexes to a quadratic polynomial for the purposes of a calibration curve. The R , , value for the test bend falls within this range. Lack of Dependence of Caicutated Angte on Get Concentration. Although the absolute R , values
varied with acrylamide concentration, when the bend angle of CAP was determined from the R , value of the test bend and the calibration curve from the corresponding acrylamide concentration, the bend angles in A tract equivalents were 5.6 A tracts for a 4% gel and 5.7 A tracts for a 5% gel. The CAP site was located approximately one-third of the way from one end of the wild-type lac 203 fragment when it was restricted with EcoRI. We measured the bend angle of this fragment when CAP was bound in A tract equivalents a t three
The induction of a bend upon binding to DNA is a common feature of many DNA-binding prot e i n ~ . ~An , ~important ~ - ~ ~ first step in understanding the relevance of DNA bending to the biological function of these proteins is an estimate of the magnitude of the bend. Measurements of the extent of protein-induced DNA bends present some unique problems due to the fact that many protein-DNA complexes are not stable under the conditions required for physical techniques. In addition, many of these complexes are difficult to prepare in quantities large enough and pure enough to be amenable to study by such methods. Gel electrophoresis has been the primary technique used to study DNA bending, both sequencedirected and protein-induced. The anomaly in gel mobility is an increasing function of the extent of bending of the DNA molecule, and has been suggested to be proportional to the mean square endto-end distance of the molecule on the basis of theoretical calculations.8~9An empirical relationship between the gel mobility and the relative curvature of bent DNA molecules has been determined for the case of sequence-induced bends."
36
ZINKEL AND CROTHERS
This relationship was determined for the case of DNA bends that are evenly distributed along the helix axis and well phased with the helix screw, and is useful for estimating the curvature of DNA fragments based on their gel mobility. However, this method is not directly applicable to the problem posed by protein-induced DNA bending where there is an additional contribution to gel retardation from the protein molecule. Calibration Molecules
The basic approach of our experiment was to calibrate the gel retardation of bent DNA to the magnitude of the bend using runs of from 3 to 9 A tracts repeated a t 10.5-bp helical phasing. Each of these standard molecules also contained a CAP binding site centered a t 20 bp from the end of the molecule, thus providing a control for the gel retardation due t o CAP protein while minimizing any contribution of the CAP-induced bend. A plot of the relative mobility vs the square of the number of A tracts (Figures 3 and 4) was fit by a second-order polynomial up to 6 A tracts. For larger numbers of A tracts, the R , values did not continue to increase, but leveled off. The point a t which the curve plateaus was rather abrupt, was
the same for all gel percentages employed and was independent of the presence of CAP bound a t the molecular end. This result is not predicted by the current theories of gel electrophoresis; it implies that the generally observed dependence of mobility anomaly on end-to-end distance breaks down for centrally located bends above the magnitude of 6 A tracts. One interpretation of these results is that for highly bent molecules, the reptation mode of gel migration becomes less favorable since it becomes increasingly difficult for the molecule to untangle itself from the gel matrix. The mode of separation may resemble more closely a gel filtration effect in these instances, and therefore be dependent on the minimum tube size required for movement through the gel. In the calibration molecules presented here, the observed change in mode of migration coincides with a change in the placement of long and short axes in the molecule. This is illustrated in Figure 6, where it can be seen that for bends centered on the molecule and up to 120", the long axis lies parallel to the end-to-end vector, and the short axis is perpendicular to the long axis. For bend angles of 120", the long axis is parallel to either side of the DNA molecule. The longest dimension in molecules with bend angles above 120" (the angle in the figure is the comple\
\
\
\
\
\
\ \
\
\ \
L\
\
\ '-\
\
90"
\
\
\ \
\
\ \
\
\
\
\
\
\
\
\
\ \ \
\
\
\ \
\
Figure 6. Illustration of the change in the long axis of DNA molecules with increasing bend angle. The angles in the figure are the complements of the bend angles as defined in the text. For a bend angle of go", the long axis of the molecule lies parallel to the end-to-end vector. For a bend angle of 120", the molecule is symmetric and has a longest dimension along any side of the triangdar figure. For a bend angle greater than 120", the longest dimension of the molecule parallels one side and is nearly perpendicular to the end-to-end vector.
COMPARATIVE GEL ELECTROPHORESIS
ment t o what we have defined as the bend angle) is parallel to one of the sides of the acutely bent DNA and nearly perpendicular to the end-to-end vector. Thus the predicted axis change a t 120" corresponds t o the bend induced by 6 A tracts of 20" bend each,'oy'l and coincides with the observed point a t which a plateau is reached in the dependence of R , on number of A tracts. The exact angle of the crossover is predicted to shift if the bend is not centered on the DNA molecule. Recently, Calladine et al. (1988)30 proposed a quantitative scheme for explaining the anomalous electrophretic mobility of repeating sequence DNA. The basic feature of the model is that such DNA adopts a superhelical configuration, and that the diameter of the superhelix determines the tube size required for migration and hence sets the limiting R,, value for the molecule. Applying this model to our data, one predicts that the maximum tube size is required when the bend angle is 120" (see Figure 6). Since more than 6 A tracts yield no further increase in R,, we would conclude that the bend per A tract is about 20", in reasonable agreement with other estimates. However, this value is roughly twice as large as deduced by Calladine et al.30 using the same logic on other molecules. Clearly, these simplified models of gel electrophoretic behavior are semiquantitative a t best.
Measurement of the DNA Bend Angle induced by CAP
The gel mobility of the DNA molecule containing a CAP-induced bend was measured by placing the CAP binding site in the center of a DNA molecule of similar length to the calibration molecules. The bend angle in A tract equivalents was then calculated from the calibration curve by extrapolation. The values in A tract equivalents were: 5.6 for a 4% gel and 5.7 for a 5% gel (Table I). When CAP was bound to a site that is not centered, but one-third of the distance from the end of the molecule, the measured bend angles were 5.3 A tracts for 4% and 5% gels, and 5.6 A tracts for 8% gels. These values are equivalent to within the estimated error of 0.3 A tracts, and therefore the method appears to be independent of gel concentration within the range tested. From the cyclization experiments on ligations of duplex oligonucleotides harboring runs of A's repeated a t 10.5-bp intervals, the bend angle for an A tract has been estimated to be 18", f 10%.lo~'l Using this value, the CAP bend angle is 101", k12".
37
Model building studies based on a crystal structure of CAP7 have predicted a bend angle of 150". The model was built by wrapping the DNA around a ramp of positive electrostatic potential on the surface of the CAP protein, thus yielding an upper limit to the possible CAP bend angle. In solution, it is probable that the DNA has some degree of flexibility due to thermal motion and one might expect to observe a lower bend angle on a gel.
-
Comparison with the Results of Thompson and Landy
T h e CAP-induced bend angle obtained by Thompson and Landys is equivalent to 7-8 A tracts compared to our value of 5.6. Their analysis relies on variation of gel mobility when the bend is moved from the end to the center of the molecule and compares molecules of quite different gel mobilities. In our approach we attempted to match, to first order, the gel mobilities of test and comparison molecules by including a protein binding site on both. In spite of these differences, the results from the two approaches are similar. A likely source of the residual disagreement is the difference in comparison bends. Phasing a t 10.5 bp, as is the case in our experiments, yields significantly greater anomaly in electrophoretic mobility because the curved molecules remain planar. Hence it should take fewer A tracts in our system to mimic the CAP bend than in the experiments of Thompson and Landy.
Possible Nonequivalent Features of Intrinsic and Protein-Induced Bends
The theory of gel electrophoresis is not sufficiently developed for us to set rigorous limits on the accuracy of our underlying assumption that the electrophoretic influence of DNA bends is independent of their source. It is likely that the CAP-induced bend has a somewhat smaller radius of curvature than the intrinsic bend, an influence whose importance is difficult to assess. In general, it appears that the major effect of DNA bends on mobility is exerted through their influence on the angle between large flanking DNA segments, in which case the radius of curvature should have only minor consequences. In addition, the segment of DNA bound tightly to CAP ( - 26 bp) is probably substantially less flexible than the remainder of the chain. This may modify electrophoretic mobility if
38
ZINKEI. AND CROTHERS
flexure of the molecule is important during gel migration (S. D. Levene and B. H. Zimm personal communication), although the region of increased rigidity is a minor fraction of the total DNA length in the present case. General Consideration
The frequency with which protein-induced DNA bending occurs in DNA regulatory domain^^,^^- 27 suggests a role for this structural motif in the regulation of DNA replication and transcription. Such bends provide the potential for storing a considerable amount of energy, which may then be used to overcome the activation energy to various steps in these pr~cesses.~ An important step in understanding the relevance of DNA bending to these biological processes is an estimation of the extent of the bend. Our method does not require large quantities of highly purified material and should therefore be accessible to a number of systems where sample material is limited. An estimation of the extent of DNA bending involved in a variety of systems should be useful in the elucidation of the function of DNA bending in biological processes.
REFERENCES 1. Fried, M. G. & Crothers, D. M. (1983) Nucleic Acids Res. 11, 141-158. 2. Kolb, A., Spassky, A., Chapon, C., Blazy, B. & Buc, H. (1983) Nucleic Acids Res. 11,7833-7852. 3. Wu, H. M. & Crothers, D. M. (1984) Nature 308, 509- 513. 4. Majors, J. (1977) Ph.D. thesis, Harvard University,
Cambridge, MA. 5. Liu-Johnson, H. N., Gartenberg, M. R. & Crothers,
D. M. (1986) Cell 47,995-1005. 6. Weber, I..T. & Steitz, T. A. (1984) Proc. Natl. Acad. Sci. USA 81, 3973-3977. 7. Warwicker, J., Engelman, B. P. & Steitz, T. A. (1987) Proteins 2, 283-289.
8. Porschke, D., Hillen, W. & Takahashi, M. (1984) EMBO J . 3, 2873- 2878. 9. Thompson, J. F. & Landy, A. (1988) Nucleic Acids Res. 16, 9687-9705. 10. Koo, H. S., Drak, J., Rice, J. A. & Crothers, D. M. (1989), submitted for publication. 11. Kunke, G., Fritz, H. J. & Ehring, R. (1987) EMBO J. 6, 507-513. 12. Zinkel, S. S. & Crothers, I). M. (1987) Nature 328, 178-181. 13. Hanahan, D. (1983) J . Mol. Bwl. 166, 557-580. 14. Sanger, F., Nicklen, S. & Coulson, A. R. (1977) Proc. Natl. Acad. Sci. USA 74, 5463-5467. 15. Clewell, D. B. & Helinski, D. R. (1969) Proc. Natl. Acad. Sci. USA 62, 1159-1166. 16. Clewell, D. B. (1972) J . Bacterial. 110,667-676. 17. Maniatis, T., Fritsch, E. F., Sambrook, J. (1982)
Molecular Cloning: A Zuboratory manuul, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. 18. Koo, H. S. & Crothers, I). M. (1988) Proc. Natl. Acad. Sci. USA 85, 1763-1767. 19. Gartenberg, M. R. & Crothers, D. M. (1988) Nature 333, 824- 829. 20. Shuey, D. J. & Parker, C. S. (1986) Nature 323, 459-461. 21. Kunke, G., Fritz, H. J. & Ehring, R. (1987) EMBO J . 6, 507-513. 22. Mukhejee, S., Parel, I. & Bastia, D. (1985) Cell 43, 189-197. 23. Ryder, K., Silver, S., Delucia, A. L., Fanning, E. & Tegtmeyer, P. (1986) Cell 44, 719-725. 24. Zahn, K. & Blattner, F. R. (1987) Science 236, 416-422. 25. Hatfull, G. F., Noble, S. Z. & Grindley, N. G. F. (1987) Cell 49, 103-110. 25. Richmond, T. J., Finch, J. T., Rushton, B., Rhodes, D. & Klug, A. (1984) Nature 311, 532-537. 27. Anderson, J. E., Ptashne, M. & Harrison, S. C. (1987) Nature 326, 846-852. 28. Lerman, L. S. & Frisch, H. L. (1982) 3wpoZymers 21, 995-997. 29. Lumpkin, 0. J. & Zimm, B. H. (1982) Biopolymers 21, 2315-2316. 30. Calladine, C. R., Drew, H. R. & McCall, M. J. (1988) J . Mol. Biol. 201, 127-137.
Received April 25, 1989 Accepted June 9, 1989
