43

Virus Research, 16 (1990) 43-58 Elsevier

VIRUS 00565

Comparative analysis of vaccinia virus promoter activity in fowlpox and vaccinia virus recombinants Christopher

T. Prideaux

‘, Sharad Kumar

2 and David B. Boyle 2

’ Department of Microbiology, John Curtin School of Medical Research, Au~tralian National University, Canberra, ACT, 2601, Australia and 2 Commonwealth Scientific and Industrial Research Organisation, Australian Animal Health L.uboratov, Geelong, Victoria, 3220, Australia (Accepted 6 December 1989)

A quantitative and qualitative comparison of vaccinia virus (VV) promoter activity in fowlpox virus (FPV) and W recombinants was performed. The W PLll late promoter was used to express P-galactosidase from the E. coli LacZ gene in FPV (FPV-LacZ) and W (W-LacZ) recombinants. Time courses of FPV-LacZ /3-galactosidase expression in chicken embryo skin (CES) cells demonstrated temporal regulation of the PLll promoter with maximum enzyme activity nine- and four-fold lower than those obtained in W-LacZ infected 143B and CES cells, respectively. The level of fi-galactosidase activity per LacZ DNA gene copy was determined for each recombinant and found to be greater for W-LacZ than FPV-LacZ. The W P7.5 early/late promoter was used to express the E. coli xanthine-guanine phosphoribosyl transferase (Ecogpt) gene in FPV and W recombinants. Northern blot analysis showed early Ecogpt RNA transcripts to be of defined lengths. Transcript size estimations mapped the termination sites to regions containing sequences associated with W early transcript termination, providing supportive evidence for a common poxvirus early transcript termination signal. Late LacZ and Ecogpt transcripts were heterogeneous in length. Sl nuclease mapping of the 5’-ends of early and late Ecogpt RNA transcripts produced by FPV and W recombinants showed transcription initiation occurred at the same sites in both poxviruses and corresponded to the regions previously identified as the early and late start sites of the P7.5 promoter. These results would indicate a high level of conservation in the expression and regulation of genes by poxviruses. Fowlpox virus; Vaccinia virus; Promoter activity

Correspondence

to: D.B. Boyle, CSIRO, AAHL, P.O. Bag 24, Geelong, 3220, Victoria, Australia.

016%1702/90/$03.50

0 1990 Elsevier Science Publishers B.V. (Biomedical Division)

Introduction Recombinant DNA technology has made possible the expression of a wide variety of heterologous genes in vaccinia virus (VV), a member of the orthopox virus group (Mackett and Smith, 1986; Moss and Flexner, 1987). The wide host range of W provides the potential for delivery of foreign vaccine antigens to a variety of species, including man, but also presents a risk of spread outside the intended species. An alternative to the widespread use of W is the utilisation of host-specific poxviruses, such as fowlpox virus (FPV) a member of the avipox virus group, which has a host range restricted to avian species, in the construction of recombinant vaccines. The construction of recombinant FPV based vaccines will require considerable understanding of the molecular biology of the virus, including identification of suitable promoters and knowledge of gene expression and regulation. Non-genetic reactivation between genera of the Poxviridae suggests that some of the essential mechanisms of replication are conserved within the family (Hanafusa et al., 1959; Fenner and Woodroofe, 1960). The ability of the thymidine kinase (TK) promoter of FPV to express and regulate TK activity in W (Boyle and Coupar, 1986) and W promoters to express foreign genes in recombinant FPV (Boyle and Coupar, 1988b), together with the suggestion that FPV may share the same early gene transcription termination signal as W (Binns et al., 1987) would indicate that the mechanisms of avipox virus gene expression and regulation are closely related to those of the orthopox virus group. To date the majority of information on the molecular biology of poxviruses is based on W studies, and as yet little information is available on gene expression and regulation of other poxviruses. In this communication we report the construction of FPV and W recombinants expressing the E. coli LacZ gene, encoding P-galactosidase, under the transcriptional control of the W PLll late promoter, and the E. coli xanthine-guanine phosphoribosyl transferase (Ecogpt) gene under the control of the W P7.5 early/late promoter. These recombinants were used to make a quantitative and qualitative comparison of W promoter activity in FPV and W recombinants.

Materials and Methods Virus and cells

FPV (mild vaccine strain, Arthur Webster Pty. Ltd., Northmead, 2152, Australia) was propagated on monolayers of chicken embryo skin (CES) cells as previously described (Prideaux and Boyle, 1987). Primary CES cells were prepared as described by Silim et al. (1982) with the modification that collagenase at 100 pg/rnl (Sigma C2139) was used to digest the skin of 13-day-old specific pathogen-free embryos (CSIRO, SPF Poultry Isolation Unit, Maribyrnong, Victoria and CSIRO, AAHL, Geelong, Victoria) in place of trypsin. W-WR-L929 and W recombinant stocks were prepared in CV-1 cells grown in Eagle’s Minimum Essential Medium (Gibco

45

Laboratories) supplemented with 5% fetal calf serum (FCS) and 10 mM HEPES. Human 143B cells, a thymidine kinase negative variant of cell line R970-5 (Rhim et al., 1975) were prepared and used as previously described by Boyle et al. (1987). Enzymes

and chemicals

Restriction enzymes and other DNA modifying enzymes were obtained from various sources and used according to manufacturers’ instructions or as outlined by Maniatis et al. (1982). o-Nitrophenyl-P-D-galactoside (ONPG) and 5-bromo-4chloro-3-indoyl-/3-D-galactopyranoside (X-Gal) were obtained from Sigma Chemical Company. Nick translation and dideoxy sequencing kits were from BRESA (Australia). All radioisotopes were from Amersham. Plasmid

constructs

The E. coli LacZ gene was excised from pGHlO1 (Herman et al., 1986) by BamHI restriction enzyme digestion. The isolated LacZ gene was inserted into W and FPV using the plasmid vehicles pBCB08 and pDB22, respectively. Both plasmid vehicles contain the W late promoter PLll flanked by TK gene sequence. The construction of pBCB08 has been described previously by Coupar et al. (1986). pDB22, a cloning vehicle suitable for the insertion of foreign genes into the FPV TK gene, contains the Ecogpt gene under the control of the W P7.5 promoter, acting as a co-expressed selectable marker as previously described by Boyle and Coupar (1988a). The P7.5 promoter was in the opposite orientation to the PLll promoter to prevent read through into the LacZ gene. The LacZ gene was. introduced into BamHI sites of both plasmids (Fig. 1) in such a way that the LacZ gene product was identical in both FPV and W constructs. The PLll gene product translation initiation codon was in frame with the initiation codon of the LacZ gene, producing a /3-galactosidase fusion gene product with nine amino acids upstream of codon nine of P-galactosidase (Fig. 1B). Construction

and isolation of recombinant

virus

Recombinant W was constructed as described previously by Boyle et al. (1985) using marker-rescue-recombination techniques and selection for TK- virus. FPV recombinants were constructed as described by Boyle and Coupar (1988b) using the co-expressed Ecogpt gene for recombinant virus selection. The co-expression of the Ecogpt gene enables recombinant virus to replicate in medium containing MXHAT (MXHAT: 2 pg/ml mycophenolic acid, 250 pg/ml xanthine, 100 PM hypoxanthine, 0.4 PM aminopterin and 30 PM thymidine) selective conditions (Boyle and Coupar, 1988a). Recombinant viruses expressing /?-galactosidase were selected by plaquing under non-selective conditions and staining with X-Gal (200 pg/rnl) in growth medium containing 1% agar. Recombinants expressing /3-galactosidase produced characteristic blue plaques (Chakrabarti et al., 1985; Panicali et al., 1986). Blue colour

46

pGH101 Barn Hl I

__

Lac Z

1 FPV-LacZ

VV-Ecogpt

VV-LacZ

B

BamHl

Fig. 1. Structure of recombinant plasmids for insertion of the LacZ and F.cogpt genes into the TK gene of FPV and W. The E. coli LacZ gene was isolated from pGHlO1 by BnmHI digestion and inserted into BumHI sites contained within the multiple cloning sites (MCS) of pBCBO8 and pDB22 in front of the PLll promoter (A). The PLll LacZ junction region is identical in both pBCBO8-LacZ and pDB2ZLacZ (B). In both plasmids the ATG of the PLll promoter is in phase with the ATG of the LacZ gene and separated by 15 bp.

developed in approximately 4 h with W-LacZ recombinants, and after overnight incubation with FPV-LacZ recombinants at 37” C. Recombinants viruses were plaque purified three times. Restriction enzyme digests and Southern-blot analysis of purified virus DNAs were used to confirm the predicted genomic structure of the LacZ recombinants. The construction of the W-Ecogpt recombinant using pGpt07/14 (Fig. 1) has been described previously by Boyle and Coupar (1988a).

Assay of P-galactosidase activity Confluent monolayers of 143B and CES cells were infected at a multiplicity of 20 pfu per cell with recombinant W or FPV containing the E. coli LacZ gene under

41

the transcriptional control of the W PLll promoter, as described in Fig. 1. Virus was allowed to absorb for 1 h at 37 o C, after which the inoculum was removed by gentle washing with 2 ml of growth medium to minimise background levels of /3-galactosidase activity, and incubated at 37 o C. When cytosine arabinoside (Ara-C) was used to inhibit virus DNA replication the medium was removed from cells and replaced with fresh growth medium, containing Ara-C (45 pg/ml) 25 min prior to infection. Estimations of P-galactosidase activity were made at various times post-infection (p.i.), on a minimum of two plates, using the method of Miller (1972). Cells were resuspended in growth medium using a rubber policeman, and then lysed by vortexing in the presence of sodium dodecyl sulfate (SDS) and chloroform. This procedure was shown to lyse cells, by trypan blue exclusion and microscopy. Growth medium was assayed together with cells as a previous report (Chakrabarti et al., 1985) has shown that significant amounts of j3-galactosidase were lost into the growth medium from W LacZ recombinant infected cells, late in infection, as a result of cell lysis. A number of dilutions of lysates were assayed for P-galactosidase activity to ensure ONPG was in excess and readings were made within the linear range of the assay. Enzyme assays were performed over 30 min at 28” C using ONPG as the substrate. A,,, readings were recorded and the enzyme activity expressed as pmoles of o-nitrophenol (ONP) produced in 30 min at 28 o C per lo6 cells. DNA copy number Cells infected with wild-type or LacZ recombinant virus at a multiplicity of 10 pfu/cell, maintained in the presence or absence of Ara-C, were harvested as soon as maximum /3-galactosidase activity was reached to maximise activity with minimum release of DNA through cell lysis. Samples were prepared as described by Prideaux and Boyle (1987) for DNA dot-blot analysis. Serial 4-fold dilutions were prepared in 10 x SSC (1 x SSC: 0.15 M NaCl, 0.015 M sodium citrate) commencing at 5 X lo5 cells/ml. Samples (100 ~1) were applied to Amersham Hybond-N membrane using a hybri-dot manifold. After passing excess 10 X SSC through each well the membrane was washed in 2 X SSC, prehybridised, hybridised with nick-translated 32P-labelled LacZ DNA, isolated from pGH101, and washed according to the manufacturer’s specifications. Spot intensity was compared using a Hoefer Scientific Instruments GE300 scanning densitometer, and related to the level of fi-galactosidase activity present in infected cells. Isolation of RNA and northern blot analysis CES and 143B cells were infected at a multiplicity of 10 pfu/cell with FPV and W, respectively. Early RNA was prepared from cells infected with FPV, 24 h p.i., and after overnight infection with W, in the presence of Ara-C (25 pg/ml). Late RNA was isolated from cells after 12-16 h p.i. in the case of W and 48 h p.i. in the

48

case of FPV. Total cellular RNA was isolated using the method of Plumb et al. (1984). Twenty microgram samples of total RNA were resolved electrophoretically on 1.2% agarose, 5.4% formaldehyde denaturing gels as described by Maniatis et al. (1982). RNA was transferred to Amersham Hybond-N membrane by capillary blotting using 20 x SSC as transfer medium. Prehybridisation and hybridisation with nick-translated 32P-labelled LacZ or Ecogpt DNA, were carried out according to the manufacturer’s instructions.

N&ease

SI mapping

Nuclease Sl mapping was carried out using the method described by Davis et al. (1986). Briefly, a fifteenmer oligonucleotide primer complementary to the region 9 bp downstream of the ATG of the Ecogpt gene was extended on Ml3 single-stranded DNA, containing the P7.5-Ecogpt junction region, using DNA polymerase I (Klenow fragment) in the presence of [ 32P]dCTP (Fig. 5C). The probe was excised using P.stI digestion and purified on a 4% acrylamide/8M urea gel. Thirty-five micrograms of RNA sample, together with 32P-labelled DNA probe, was dissolved in 40 ~1 of 80% formamide, 1 mM EDTA, 0.4 M NaCl, 40 mM PIPES (piperazine-N’-bis[2-ethanesulfonic acid] pH 6.4) and hybridised overnight at 37 o C. Nuclease Sl digestion was carried out in 0.4 ml of Sl buffer (250 mM NaCl, 30 mM sodium acetate, 1 mM ZnCl,, 10 pg of calf thymus DNA/ml) with 200 U of Sl nuclease/ml at 25 o C for 1 h. The nuclease-resistant DNA was analysed by electrophoresis on 6% sequencing gels alongside sequencing ladders prepared using the same primer and Ml3 clones.

Results

Expression

of /3-galactosidase

Levels of /3-galactosidase activity were determined at various times postinfection for FPV-LacZ and W-LacZ infected cells (Fig. 2), as well as for uninfected and wild-type infected cells. FPV-LacZ P-galactosidase expression commenced approximately 12 h p.i. in CES cells and continued until 72 h p.i. at which time enzyme activity was at a maximum of approximately 8.4 pmol 0NP/106 CES cells/30 min at 28 o C. The expression of P-galactosidase by W-LacZ commenced between 4 and 5 h p.i. in 143B cells and continued until 22 h p.i. A maximum enzyme activity of approximately 74 pmol 0NP/106 143B cells/30 rnin at 28°C was reached, approximately 9-fold higher than that observed with FPV-LacZ in CES cells. Cells infected with recombinants in the presence of Ara-C, a potent inhibitor of DNA synthesis, showed no P-galactosidase activity above that resulting from the inoculum. /3-Galactosidase activity was not detected in uninfected or wild-type infected cells (results not shown).

49

TIME

COURSE

OF /3-GALACTOSIDASE

I&J,

( .

0

10

20

,

,

. ,

,

30

40

50

60

HOURS

0

10

I,

I.

20

30

EXPRESSION

b.

40

,.

60

p.i.

I.

I,

I,

I

50

60

70

60

HOURS

,

70

I

I

90

*I

100

p.i.

Fig. 2. Times course of expression of /3-galactosidase by FPV and W LacZ recombinants. Cells were infected at a multiplicity of 20 pfu with LacZ recombinants. At the times indicated cells were harvested and lysates assayed for /I-galactosidase activity. W-LacZ (0) and FPV-LacZ (0) P-galactosidase activity was assayed in both 143B (A) and CES cells (B).

Expression

of /3-galactosidase

in CES cells by VV-L.acZ recombinant

To investigate the effect of cell type on the expression of /3-galactosidase by W-LacZ, the recombinant was adapted to growth in CES cells by passaging twice at low multiplicities of infection and a stock produced. Adaption of W to growth in CES cells was evident from the ability of W to grow to high titres, cause extensive cytopathic effects and plaque on CES cells. The expression of P-galactosidase by both FPV and W LacZ recombinants in CES cells was measured in parallel time courses (Fig. 2B). The W-LacZ recombinant commenced expression of P-galactosidase 6-8 h p.i. approximately 2 h later than in 143B cells, reaching a maximum

50

enzyme activity of 29.4 pmol 0NP/106 CES cells/30 min at 28” C. The maximum /3-galactosidase enzyme activity reached for the W-LacZ recombinant in CES cells was approximately 4-fold higher than FPV-LacZ but was considerably less than that reached in 143B cells (2 l/2-fold reduction). The FPV-LacZ recombinant /3-galactosidase expression time course was similar to that shown in a number of separate experiments. FPV does not replicate in any non-avian cell, therefore it was not possible to adapt FPV to replication in 143B cells. Attempts to measure &galactosidase in FPV-LacZ infected 143B cells gave activity levels marginally above background (Fig. 2). Comparison of LucZ DNA levels Variations in the number of transcriptionally active LacZ genes per cell may influence the comparative levels of P-galactosidase activity observed for FPV and W LacZ recombinants. To examine the relative levels of LacZ gene copies present in W-LacZ infected 143B cells, and in W-LacZ and FPV-LacZ-infected CES cells, cell samples were harvested when maximum /3-galactosidase enzyme activity was first reached 24, 72 and 48 h p.i., respectively, and assayed for P-galactosidase activity and comparative levels of LacZ DNA as described under Materials and Methods. Cells infected with LacZ recombinants in the presence of Ara-C, as well as wild-type-infected cells, were also assayed for fi-galactosidase activity and relative levels of LacZ DNA. Fig. 3 together with Table 1 show the results obtained, the ratio of LacZ gene copy in W-LacZ/143B:W-LacZ/CES:FPV-LacZ/CES was 16 : 1: 4. When the DNA ratio was taken into account /3-galactosidase production per DNA copy was greater in the W-LacZ recombinant in both CES and 143B cells than for the FPV-LacZ recombinant. Northern blot analysis of recombinant RNA transcripts Termination of early gene transcription in W is signalled by the cis-acting sequence TTTTTNT, with termination occurring, in vitro, approximately 50 bp downstream (Yuen and Moss, 1987), resulting in early mRNAs of defined lengths. Late W genes 3’ termination signals have not been identified and transcripts of heterologous lengths are produced. Sequence data on the FPV DNA polymerase gene (Binns et al., 1987) suggest that FPV may use the same early gene transcription termination signals as W. Ecogpt and LacZ mRNA transcripts from FPV and W recombinants were examined by northern-blot analysis (Fig. 4). Early Ecogpt expression under the transcriptional control of the W P7.5 promoter produced mRNA transcripts of defined lengths for both FPV and W recombinants. As the Ecogpt gene contains no poxvirus transcription signals, termination of transcription occurs in the 3’ flanking DNA. Estimation of mRNA transcript size from the FPV-LacZ recombinant, indicates that termination of transcription occurs in the TK flanking sequence in close proximity to TTTTTAT, a possible transcription

51

FPV/CES

I

FPV-LacZICES FPV/CES FPV-LacZ/CES WI 1438 VV-LacZI 1438 VV-LacZ/CES VV~ 1438 VV-LacZ/

1438

VV-LacZICES

ppp*tSUr;f O-rUl

d

ng pGH101

Fig. 3. Comparative La& DNA level. DNA from uninfected, wild type and LacZ recombinant infected cells, serially diluted four-fold, probed with 32P-labelled nick-translated LacZ gene.

termination signal. Based on transcript size estimations, the W Ecogpt transcript terminates within the W TK flanking DNA at a site untying the tr~sc~ption termination signal TIYTTCT. The W Ecogpt transcript also contains sequences complementary to the SV40 DNA, which is located between the Ecogpt and W TK genes. This flanking sequence is responsible for an increase in the size of the W

TABLE 1 &Galactosidase DNA present

W-LacZ 143B w-Lacz CES FPV-LacZ CES

activity detected in the recombinant infected cells is related to the relative IeveI of LacZ LacZ DNA ratio

/3-Galactosidase activity *

16

91.5

5.7

1

16.7

16.7

4

8.4

2.1

* /3-Galactosidase activity is expressed as pmol ONP produced/lo6

j%Galactosidase per LacZ DNA

cells/30 min.

52

LLlL

>>

8.8 . -

0.24

-

Fig. 4. Northern-blot analysis of early and late RNA transcripts produced by fowlpox and vaccinia viruses. The recombinant poxviruses described in Fig. 1 were used to compare early (A) and late (B) Ecogpt, as well as late LacZ (C), RNA transcripts produced by W and FPV recombinants. Cytoplasmic RNA from recombinant, and wild-type (FPV, VV), infected cells was isolated early and late in infection and resolved electrophoretically on a 1.2% agarose, 5.4% formaldehyde denaturing gel. The resolved RNA was transferred to nylon membrane and hybridised to ‘*P-1abelled Ekogpt (A and B) or LacZ (C) DNA.

Ecogpt transcript compared to the FPV transcript, and also contains a termination site which results in a second minor W Ecogpt transcript. Late Ecogpt and LacZ gene expression produced RNA transcripts of undefined lengths. The early gene transcription termination signals, which terminated Ecogpt transcripts early in infection, were not recognised late in infection in either poxvirus recombinant. Nuclease SI mapping The W P7.5 early/late promoter has two distinct sites of transcription initiation. The late initiation site is located 55 bp 5’ to the early start site in wild-type virus (Co&ran et al., 1985). The P7.5/Ecogpt early and late transcription start sites in FPV and W recombinants were identified by Sl nuclease mapping (Fig. 5). Both early and late transcripts from each recombinant mapped to the previously reported early and late transcription initiation regions identified in wild-type W (Cochran et al., 1985). RNA isolated from W wild-type infected cells protected a fragment of approximately 270 bp of the Sl probe. The Sl probe used contains a 270 bp DNA fragment from W containing the P7.5 promoter. The protected fragment in W wild-type RNA is probably the product of late RNA produced from the P7.5 promoter region by readthrough of a late gene 5’ to the P7.5 promoter in wild type

53

virus. Considerable quantities of early RNA transcripts remained in late RNA preparations, possibly as a result of incomplete shut-off of early promoter function or residual early transcripts. Early transcripts were also observed in late RNA by Co&ran et al. (1985) in Sl mapping studies using the P7.5 promoter.

Discussion Fowlpox virus and W recombinants have been constructed which express E. coli genes under the transcriptional control of W promoters. The LacZ gene was inserted into both poxviruses using the PLll promoter of W to regulate expression. In wild type W the PLll promoter is responsible for the expression of a 11 kDa major structural polypeptide produced late in infection (Wittek et al., 1984; Bertholet et al., 1985). The expression of P-galactosidase, from the E. coli LacZ gene, has been used previously to compare promoter activities in W recombinants (Chakrabarti et al., 1985; Panicali et al., 1986). The W P7.5 promoter, which contains signals for the production of both early and late transcripts (Cochran et al., 1985) was used to express the Ecogpt gene in FPV and W recombinants. In FPV the Ecogpt gene was inserted together with the LacZ gene to act as a co-expressed selectable marker (Boyle and Coupar, 1988a, b). Expression of P-galactosidase using the PLll promoter in W and FPV recombinants showed an approximately nine-fold higher enzyme activity in W-LacZ infected 143B cells than that observed in FPV-LacZ infected CES cells. The temporal regulation of the PLll promoter was maintained in both virus constructs, with P-galactosidase activity commencing late in virus infection, and being totally inhibited by the presence of Ara-C. We have previously reported (Prideaux and Boyle, 1987) the temporal regulation of expression of FPV polypeptides and demonstrated that FPV DNA replication in CES cells commences between 12 and 16 h p.i. FPV LacZ /3-galactosidase expression in CES cells commenced at approximately 12 h p.i., as is the case with FPV late polypeptides. This would indicate that the W PLll promoter regulation of expression in FPV coincides with expression of native FPV genes. The possibilities that different cell types and variations in the level of LacZ gene copy per cell were responsible for differing levels of P-galactosidase activity in FPV and W recombinant infected cells were considered. The level of P-galactosidase activity in W-LacZ infected CES cells was reduced in comparison to the level observed in 143B cells, but was still greater than that of the FPV-LacZ recombinant. The reduced rate of &galactosidase production, and the lower maximum activity observed for W-LacZ in CES cells compared to 143B cells possibly reflects a reduced ability of W to replicate in CES cells compared to 143B cells. When LacZ gene copy number was taken into consideration P-galactosidase activity was greater for W-LacZ in both CES and 143B cells than for the FPV-LacZ recombinant. Surprisingly the level of P-galactosidase activity per LacZ DNA copy was greater in CES than 143B cells infected with W-LacZ. This may reflect variation in the actual percentage of LacZ DNA detected which is transcriptionally active.

54

A

C

c1a1 ATCG iATGAAT TCCCGACATA

TACTATATAG

TM

TATCATGTGG

GTAATGTXT

CGATGTCGAA

CTAATTCCAA

ACCCACCCGC

‘ITTlTATAGT

ACTCAAGACT

ACGAAACTGA

TACAATCTCT 70

TAGCCATA’lC

CCGGTAGTN

CGATATACAT

AAACTGATCA 140

AAGlTlTTCA

LATE CCCATAAATA ATUTACAA

,Tl

LAT

TMlTMTTT 210

KARLY -~ AT’lCCACGGT

CTCGTAAAAG

TAGAAAATAT

ATTCTAATTl’

ATCTCTATAA

TCTCGCGCAA

CCTATTTTCC

AClTCAas

PRIHKR AG CGAAAAATACATCGTCACCTGGGACATG

CGACTGATGC

CTTCTGAACA

ATGGAAAGGC

CCTCGAACAC

ATTATTGCCG

MGGAAGTAG

ATCATAAAGA

ACAGTGACG: 280

-MGCC

GTAGATAAAC

AGGCTGGGAC 350

TTGCAGATCC

ATGCACGTM

ACTCGCAAGC 420

TMGCCGTGG

Kpnl CGGTCTGGTA 480

55

The increased &galactosidase activity in W-LacZ recombinants compared to FPV-LacZ may result from differences in virus-cell interactions, such as post-transcriptional modifications of transcripts by W to increase the efficiency of translation. Bertholet et al. (1987) and Schwer et al. (1987) demonstrated modifications of the 5’-end of mRNAs of two strongly expressed late W genes. The modification consists of a poly(A) leader sequence not complementary to the sequence upstream of the coding region. Results in our laboratory have demonstrated the presence of 5’ poly(A) leader sequences on FPV mRNA transcripts (Kumar and Boyle, manuscript in preparation), though the possibility does exist that additional post-transcriptional modifications occur to W, but not FPV, RNA transcripts. Infection of a number of cell lines with high multiplicities of W results in a rapid cessation of host protein synthesis (Moss and Salzman, 1968). In contrast, infection with FPV leads to only limited inhibition of host polypeptide synthesis (Prideaux and Boyle, 1987). This extensive alteration of host-cell metabolism by W compared to FPV, may also increase the translational efficiency of W transcripts in comparison to FPV mRNA. Though Chen et al. (1983) observed that infection of chicken embryo fibroblasts with W does not result in a drastic early inhibition of host protein synthesis, and therefore this explanation would not appear to hold true for variation of expression levels obtained in CES cells. FPV mRNA produced from the Ecogpt and LacZ genes showed characteristics typical of W mRNA when examined by northern-blot. FPV Ecogpt transcripts expressed by the P7.5 promoter early in infection had defined lengths, terminating in the proximity of TTMTAT (Yuen and Moss, 1987) a sequence known to signal transcription termination in W. This provides additional evidence for a common early gene transcription termination signal in W and FPV, as first proposed by Binns et al. (1987) based on the DNA sequence of the FPV DNA polymerase gene. FPV mRNA produced from the Ecogpt and LacZ gene late in infection using the P7.5 and PLll promoters, respectively, were of undefined lengths. All previously reported late mRNAs of W genes are also of undefined lengths, due to heterogeneous 3’-ends (Cooper et al., 1981; Mahr and Roberts, 1984; Weir and Moss, 1984). In contrast, Pate1 and Pickup (1987) have reported a late gene of cowpox virus which produces mRNA with homogeneous 3’-ends. Initiation of transcription of the Ecogpt gene in both FPV and W recombinants mapped to the early and late regions previously reported for transcription initiation using the P7.5 promoter (Co&ran et al., 1987). These transcription initiation sites identified may not represent the true 5’-ends of mRNAs, as Sl nuclease mapping will not detect the

Fig. 5. Sl nuclease mapping the 5’-ends of Ecogpt transcripts. Early (A) and late (B) RNA was hybridised to labelled DNA probe and digested with Sl nuclease. The nuclease-resistant DNA was analysed, by electrophoresis on 6X polyacrylamide/SM urea gels, alongside sequencing ladders prepared using the same primer and Ml3 clone used to produce the DNA probe. The RNA-like strand DNA sequence surrounding the Sl nuclear resistant bands is shown, and the positions of the major bands are indicated (w). A CluI-KpnI fragment (C) containing the P7.5 Ecogpt junction (v), was isolated from pDB22 and cloned into M13. The labelled DNA probe was prepared from the Ml3 clone using a synthetic oligonucleotide primer complementary to the RNA-like strand, as was the sequencing ladder.

56

presence of modifications to the 5’-ends of transcripts, such as the addition of poly(A) leader sequences. Vaccinia virus transcription initiation signals were accurately recognised by FPV, and supportive evidence for a common FPV and W early transcription termination signal was obtained.

Acknowledgement

The work of C.T. Prideaux was supported Research Award.

by a Commonwealth

Postgraduate

References Bertholet, C., Drillien, R. and Wittek, R. (1985) One hundred base pairs of 5’ flanking sequence of a vaccinia virus late gene are sufficient to temporally regulate late transcription. Proc. Nat]. Acad. Sci. USA 82, 2096-2100. Bertholet, C., Van Meir, E., ten Heggeler-Bordier, B. and Wittek, R. (1987) Vaccinia virus produces late mRNAs by discontinuous synthesis. Cell 50, 153-162. Binns, M.M., Stenzler, L., Tomley, F.M., Campbell, J. and Boursnell, M.E.G. (1987) Identification by a random sequencing strategy of the fowlpoxvirus DNA polymerase gene, its nucleotide sequence and comparison with other viral DNA polymerases. Nucleic Acids Res. 15, 6563-6573. Boyle, D.B., Coupar, B.E.H. and Both, G.W. (1985) Multiple-cloning-site plasmids for the rapid construction of recombinant poxviruses. Gene 35,169-177. Boyle, D.B. and Coupar, B.E.H. (1986) Identification and cloning of the fowlpox virus thymidine kinase gene using vaccinia virus. J. Gen. Virol 67, 1591-1600. Boyle, D.B., Coupar, B.E.H., Gibbs, A.J., Seigman, L.J. and Both, G.W. (1987) Fowlpox virus thymidine kinase: nucleotide sequence and relationship to other thymidine,kinases. Virology 156, 355-365. Boyle, D.B. and Coupar, B.E.H. (1988a) A dominant selectable marker for the construction of recombinant poxviruses. Gene 65, 123-128. Boyle, D.B. and Coupar, B.E.H. (1988b) Construction of recombinant fowlpox viruses as vectors for poultry vaccines. Virus Res. 10, 343-356. Chakrabarti, S., Brechling, K. and Moss, B. (1985) Vaccinia virus expression vector: coexpression of P-galactosidase provides visual screening of recombinant virus plaques. Mol. Cell. Biol. 5, 3403-3409. Chen, X., Rijsel, J., Dunker, R., Goldschmidt, R., Maurer-Schultze, B. and Jungwirth, C. (1983) Reversible inhibition of poxvirus replication by cycloheximide during the early phase of infection. Virology 124, 308-317. Co&ran, M.A., Puckett, C. and Moss, B. (1985) In vitro mutagenesis of the promoter region for a vaccinia virus gene: evidence for tandem early and late regulatory signals. J. Virol. 54, 30-37. Cooper, J.A., Wittek, R. and Moss, B. (1981) Hybridization selection and cell-free translation of mRNA’s encoded within the inverted terminal repetition of the vaccinia virus genome. J. Virol. 37, 284-294. Coupar, B.E.H., Andrew, M.E., Both, G.W. and Boyle, D.B. (1986) Temporal regulation of influenza hemagglutinin expression in vaccinia virus recombinants and effects on the immune response. Eur. J. Immunol. 16, 1479-1487. Davis, L.G., Dibner, M.D. and Battey, J.F. (1986) Basic Methods in Molecular Biology. Elsevier Science Publishers, New York. Fenner, F. and Woodroofe, G.M. (1960) The reactivation of poxviruses II. The range of reactivating viruses. Virology 11, 185-201. Hanafusa, H., Hanafusa, T. and Kamahora, J. (1959) Transformation phenomena in the pox group virus II. Transformation between several members of pox group. Biken J. 2, 85-91.

57 Herman, G.E., O’Brien, W.E. and Beaudet, A.L. (1986) An E. coli P-galactosidase cassette suitable for study of eukaryotic expression. Nucleic Acids Res. 14, 7130. Mackett, M. and Smith, G.L. (1986) Vaccinia virus expression vectors. J. Gen. Virol. 67, 2067-2082. Mahr, A. and Roberts, B.E. (1984) Arrangement of late RNAs transcribed from a 7.1 kilobase EcoRI vaccinia virus DNA fragment. J. Virol. 49, 510-520. Maniatis, T., Fritsch, E.F. and Sambrook, J. (1982) Molecular Cloning: a Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. Miller, J.H. (1972) Experiments in molecular genetics. Cold Spring Harbor Laboratories, Cold Spring Harbor, New York. Moss, B. and Flexner, C. (1987) Vaccinia virus expression vectors. AMU. Rev. Immunol. 5, 305-324. Moss, B. and Salzman, N.P. (1968) Sequential protein synthesis following vaccinia virus infection. J. Virol. 2, 1016-1027. Panicali, D., Grzelecki, A. and Huang, C. (1986) Vaccinia virus vectors utilizing the P-galactosidase assay for rapid selection of recombinant viruses and measurement of gene expression. Gene 47, 193-199. Patel, D.D. and Pickup, D.J. (1987) Messenger RNAs of a strongly-expressed late gene of cowpox virus contain 5’ terminal poly(A) sequences. Eur. Mol. Biol. Organ. J. 6, 3787-3794. Plumb, M., Marashi, F., Green, L., Zimmerman, A., Zimmerman, S., Stein, J. and Stein, G. (1984) Cell cycle regulation of human histone Hl mRNA. Proc. Natl. Acad. Sci. USA 81, 434-438. Prideaux, C.T. and Boyle, D.B. (1987) Fowlpox virus polypeptides: sequential appearance and virion associated polypeptides. Arch. Virol. 96, 185-199. Rhim, J.S., Cho, H.Y. and Huebner, R.J. (1975) Non-producer human cells induced by murine sarcoma virus. Int. J. Cancer 15, 23-29. Schwer, B., Vista, P., Vos, J.C. and Stunnenberg, H.G. (1987) Discontinuous transcription or RNA processing of vaccinia virus late messengers results in a 5’ poly(A) leader. Cell 50, 163-169. Silim, A., El Azhary, M.A. and Roy, R.S. (1982) A simple technique for preparation of chicken-embryoskin cell cultures. Avian Dis. 26, 182-185. Weir, J.P. and Moss, B. (1984) Regulation of expression and nucleotide sequence of a late vaccinia virus gene. J. Virol. 51, 662-669. Wittek, R., Hanggi, M. and Hiller, G. (1984) Mapping of a gene coding for a major late structural polypeptide on the vaccinia virus genome. J. Virol. 49, 371-378. Yuen, L. and Moss, B. (1987) Oligonucleotide sequence signalling transcriptional termination of vaccinia virus early genes. Proc. Natl. Acad. Sci. USA 84, 6417-6421. (Received

18 August

1989; revision

received

6 December

1989)