Molecular Microbiology (2014) 93(3), 505–520 ■

doi:10.1111/mmi.12675 First published online 6 July 2014

Comparative analysis of the secretion capability of early and late flagellar type III secretion substrates Hanna M. Singer,1 Marc Erhardt1,2* and Kelly T. Hughes3** 1 Microbiologie, Département de Médecine, Université de Fribourg, Fribourg, Switzerland. 2 Helmholtz Centre for Infection Research, Inhoffenstraße 7, 38124 Braunschweig, Germany. 3 Department of Biology, University of Utah, 257 South 1400 East, Salt Lake City, UT 84112, USA.

Summary A remarkable feature of the flagellar-specific type III secretion system (T3SS) is the selective recognition of a few substrate proteins among the many thousand cytoplasmic proteins. Secretion substrates are divided into two specificity classes: early substrates secreted for hook-basal body (HBB) construction and late substrates secreted after HBB completion. Secretion was reported to require a disordered N-terminal secretion signal, mRNA secretion signals within the 5′-untranslated region (5′-UTR) and for late substrates, piloting proteins known as the T3S chaperones. Here, we utilized translational β-lactamase fusions to probe the secretion efficacy of the N-terminal secretion signal of fourteen secreted flagellar substrates in Salmonella enterica. We observed a surprising variety in secretion capability between flagellar proteins of the same secretory class. The peptide secretion signals of the early-type substrates FlgD, FlgF, FlgE and the late-type substrate FlgL were analysed in detail. Analysing the role of the 5′-UTR in secretion of flgB and flgE revealed that the native 5′-UTR substantially enhanced protein translation and secretion. Based on our data, we propose a multicomponent signal that drives secretion via the flagellar T3SS. Both mRNA and peptide signals are recognized by the export apparatus and together with substrate-specific chaperones allowing for targeted secretion of flagellar substrates.

Accepted 13 June, 2014. For correspondence. *E-mail [email protected]; Tel. (+49) 531 6181 4800; Fax (+49) 531 6181 5709. **E-mail [email protected]; Tel. (+1) 801 587 3367; Fax (+1) 801 585 9735.

© 2014 John Wiley & Sons Ltd

Introduction Motility of bacteria, like Salmonella enterica and Escherichia coli is dependent on a complex nanomachine, the flagellum. The structure of the flagellum is composed of (i) a basal body, spanning the inner membrane and the cell wall; (ii) a flexible hook that acts as a universal joint; and (iii) a long, external filament structure (Macnab, 2003; Chevance and Hughes, 2008). Flagellar production utilizes self-assembly processes, which occur in a step-wise manner starting with the cell-embedded basal body, followed by the external hook, and finally the long, external filament structure. Flagellum assembly is coupled to flagellar gene expression and protein secretion. A flagellar master regulator complex, FlhD4C2, which is encoded within the flhDC operon, controls the initiation of flagellar gene expression. The FlhD4C2 transcriptional activator complex directs σ70-bound RNA polymerase to flagellar class 2 promoters for the transcription of genes needed for the structure and assembly of the hook-basal body (HBB), which acts as the flagellar motor (Wang et al., 2006). Upon completion of the HBB, an alternative, flagellar-specific transcription factor, σ28, directs RNA polymerase to transcribe genes whose products are needed late in flagellum assembly and the genes of the chemosensory system. Flagellum assembly begins with the assembly of the MS-ring in the cytoplasmic membrane and an attached rotor structure, called the C-ring in the cytoplasm. Membrane-embedded components of the flagellar type III secretion system (fT3SS, made of FlhAB FliOPQR) assemble within the MS-ring (Fan et al., 1997; Minamino and Macnab, 1999). Soluble cytosolic components of the fT3SS include an ATPase/unfoldase/cargo-delivery shuttle complex (FliH, FliI, FliJ) (Minamino and Macnab, 1999; Akeda and Galan, 2005; Stafford et al., 2007). Unfolded proteins are translocated from the cytoplasm via the fT3SS and assemble at the tip of the growing structure. The proton motive force (PMF) provides the energy source that drives protein secretion (Minamino and Namba, 2008; Paul et al., 2008). During HBB assembly, the fT3SS is in an ‘earlytype’ secretion mode that is specific for protein subunits that make up the HBB, such as the rod cap (FlgJ), the proximal rod subunits (FliE, FlgB, FlgC and FlgF), the distal rod (FlgG), the hook cap (FlgD), the hook (FlgE) and the hook-length control protein FliK. Once the HBB structure is

506 H. M. Singer, M. Erhardt and K. T. Hughes ■

completed and the hook reaches its physiological length of > 40 nm (Hirano et al., 1994; Erhardt et al., 2011; Uchida and Aizawa, 2014), a switch in secretion specificity occurs within the type III export apparatus allowing secretion of late-type substrates (Williams et al., 1996). Among the late secretion substrates are the anti-σ28 factor FlgM, the hookfilament junction proteins (FlgK and FlgL), the filament cap (FliD), as well as the filament subunits FliC or FljB. A regulatory interaction between flagellar gene regulation and protein secretion occurs at the level of FlgM secretion (Hughes et al., 1993; Chadsey et al., 1998; Chadsey and Hughes, 2001). During initial HBB assembly, the anti-σ28 factor FlgM binds σ28 and prevents transcription of late flagellar genes. FlgM itself is recognized as a late-type secretion substrate. Therefore, upon HBB completion and the switch in substrate specificity, FlgM is secreted from the cell. FlgM secretion results in the release of σ28, which is then able to direct late flagellar gene transcription. Although intensively studied, the secretion signals of flagellar substrates are not well understood. Type III secretion substrates share neither a conserved amino acid signal sequence for secretion, nor do they possess a cleavable signal-sequence at the N-terminus. It has been shown that the N-terminus of type III secretion substrates including FliC, FlgD and FlgM harbours a peptide secretion signal (Kuwajima et al., 1989; Chilcott and Hughes, 1998; Végh et al., 2006; Weber-Sparenberg et al., 2006). Accordingly, it is presumed that the N-terminus of all fT3SS substrates includes a secretion signal. One common feature of fT3S substrates is a disordered N-terminus suggesting that the secretion signal may be structural in nature (Namba, 2001). This also corresponds to results obtained for the closely related virulence-associated T3SS found in pathogenic Salmonella and Yersinia (Sory et al., 1995; Lloyd et al., 2001; Karavolos et al., 2005; Warren and Young, 2005). A critical role of a N-terminal peptide sequence in type III secretion (T3S) is supported by in silico experiments (Arnold et al., 2009; Löwer and Schneider, 2009; Samudrala et al., 2009; Wang et al., 2011; 2013). Computational sequence analysis of a variety of T3S effectors from animal pathogens, plant pathogens and symbiotic bacteria revealed a subtle, but unique N-terminal position-specific amino acid composition (Aac) with a biased amino acid distribution towards amino acids like serine, threonine and proline (Arnold et al., 2009; Wang et al., 2011). According to further in silico analysis, the secretion signal is presumed to be located within the first 60 amino acids of the T3S substrate, with the most critical region at position 6–10 (Wang et al., 2013). Additionally, unstructured, coiled sequences within the first 30 residues are apparently preferred for T3S substrates in comparison to helices for non-T3S sequences (Wang et al., 2013).

Another study by Majander et al. (2005) highlighted the importance of the substrate’s untranslated regions (UTRs) in directing substrate secretion. Fusions of the 5′-UTR to fliC fragments as well as sandwich fusions of the 5′- and 3′-UTR of fliC to fibronectin-binding protein A or the adhesin Peb1 were secreted into the growth medium. Taken together with observations by Anderson and Schneewind (1997), this suggested that an mRNAencoded signal played a role in the T3S process. It has also been proposed that both mRNA sequences and N-terminal peptide sequences provide a multicomponent T3S signal (Karlinsey et al., 2000). In this study, we performed a comparative analysis of the N-terminal 100 amino acids of fourteen flagellar secretion substrates as we presumed that altered secretion efficiency of flagellar substrates plays a regulatory role in assembly of the extracytoplasmic parts of the flagellum. To this end, we uncoupled expression of the respective substrate from the individual native promoter by expressing translational substrate fusions to β-lactamase from the identical arabinose-inducible promoter (ParaBAD). In additional experiments, we investigated the possible combination of a protein and mRNA signals driving secretion. We observed that the secretion efficiency of the fT3SS for a certain secretion specificity class depended on both the N-terminal amino acid sequence and the 5′-UTR.

Results Comparison of secretion efficiency of early-type flagellar type III secretion substrates In order to analyse the secretion capability of early-type flagellar secretion substrates, the 100 N-terminal amino acids of various secretion substrates were individually expressed from the arabinose-inducible promoter ParaBAD. In order to exclude potential mRNA localization signals within the 5′-untranslated region (5′-UTR) of the respective substrates, chromosomal fusion constructs were designed to retain the arabinose 5′-UTR of the otherwise deleted arabinose genes araBAD. Specific type III secretion chaperones are known to exist for late secretion substrates FlgM (σ28), FlgK-FlgL (FlgN), FliD (FliT) and FliC-FljB (FliS), but not for early-type fT3S substrates. To exclude both effects of secretion chaperones binding to the C-terminal region of substrates and potential 5′-UTR effects, we focused on the contribution of the N-terminal amino acid region to the secretion process. In order to quantify secretion, we employed a translational β-lactamase (bla) fusion, deleted for its type II (Sec) secretion signal, in a background missing components of the proximal rod (ΔflgBC) to determine the secretion efficiency of individual substrates across the cytoplasmic membrane and into the periplasm (Lee and Hughes, 2006; Erhardt © 2014 John Wiley & Sons Ltd, Molecular Microbiology, 93, 505–520

Characterization of flagellar secretion substrates 507 A

B

Fig. 1. Secretion efficiency of early-type substrates. A. Secretion of β-lactamase (Bla) fusion proteins into the periplasmic space was analysed in a background deleted for the proximal rod components (ΔflgBC). Secretion efficiencies for flagellar substrate secretion signals were determined by measuring resistance against ampicillin conferred by exported β-lactamase. The minimal inhibitory concentration (MIC) is shown in μg ml−1 ampicillin. The first 100 amino acids of the early flagellar substrates FlgB, FlgC, FlgD, FlgE, FlgF, FlgG, FliK and FlgJ, as well as the full-length sequence of FliE (encoding 104 aa) were fused to β-lactamase (bla) without its N-terminal Sec secretion signal and expressed from the chromosomal arabinoseinducible promoter (labelled Para). B. Secretion assay of early-type substrates in a ΔflgE background. Secreted β-lactamase fusion proteins were detected using antibodies against β-lactamase (Bla). Cellular maltose-binding protein (MBP) and extracellular FliK were detected as loading controls. A non-secreting fusion of eGFP and a secretion deficient strain background (ΔfliF) were used as negative controls. C. Schematic overview of the analysed early-type substrates. MIC levels and protein levels (TL, total lysate; C, cellular fraction; SN, supernatant fraction) are summarized relative to the FlgD100–Bla fusion construct. NA, not available.

C

and Hughes, 2010). Secretion of the Bla-fusion proteins via the flagellar secretion apparatus into the periplasm confers resistance against ampicillin. The quantifiable resistance (minimal inhibitory concentration = MIC) correlates with the secretion efficiency of the respective substrate. This © 2014 John Wiley & Sons Ltd, Molecular Microbiology, 93, 505–520

Bla system measures the secretory capacity of the flagellar T3S apparatus and does not rely on the assembly of structural components of the flagellum after completion of the T3S. As shown in Fig. 1A and summarized in 1C, the N-terminal 100 amino acids of all early-type secretion

508 H. M. Singer, M. Erhardt and K. T. Hughes ■

A

B

Fig. 2. Analysis of secretion efficiency into the culture supernatant (late-type substrates). A. The first 100 amino acids of the late substrates FliC, FliD, FlgK, FlgL and the 97 amino acid full-length protein FlgM were C-terminally fused to β-lactamase lacking its Sec secretion signal. A protein fusion of eGFP to β-lactamase was used as a non-secreted control. Secretion was analysed in a background missing the hook-associated proteins FlgK and FlgL (ΔflgKL). Antibodies against β-lactamase (Bla) were used to detect fusion proteins in the cellular and supernatant fraction. Intracellular maltose binding protein (MBP) and the secreted flagellar ruler protein FliK served as loading controls. B. Summary of analysed late-type substrates. Relative levels of secreted (SN, supernatant fraction) and non-secreted (C, cellular fraction) fusion proteins are shown. Quantified protein levels were normalized against the cellular control maltose-binding protein (MBP) and the secreted protein control FliK respectively. Cellular and secreted fusion protein levels relative to FlgM–Bla are shown. NA, not available.

substrates except for FlgB directed secretion of the Bla reporter albeit to highly varying degrees. In case of FliE, the full-length sequence of 104 amino acids was used for the fusion construct. The highest secretion levels were obtained with FlgC100–Bla and FlgD100–Bla. In case of FlgB100–Bla, we did not detect any significant export; the MIC for FlgB100–Bla was the same as the background MIC (not shown). To confirm these results, we analysed secretion in a hook-minus (ΔflgE) background, where flagellar early-type substrates are secreted through the flagellar channel into the extracellular environment (Fig. 1B). Separation of the cellular and the supernatant fractions allowed us to detect fusion constructs secreted into the cultural supernatant and non-secreted substrate that remained inside the cell. We observed a strong correlation between secreted and cellular levels and the MIC levels in Fig. 1A indicating a wide range in either expression or stability of the different fusion constructs. Secretion was detected for the FlgC100–Bla, FlgD100–Bla, FliK100–Bla, FlgJ100–Bla and FliE–Bla fusion constructs. In case of FlgJ100–Bla, the fusion protein was detected at intermediate cellular levels; however, we did not detect equivalent levels of secreted FlgJ100–Bla. In the case of FlgB100–Bla and FlgE100–Bla, neither fusion was detected within the cytoplasmic nor in the extracellular fraction, which could be a result of protein degradation or inefficient translation. A fusion of the cytoplasmic eGFP protein to β-lactamase was

not recognized by the flagellar type III secretion apparatus as a secretion substrate and was used as a negative control for secretion. Comparison of late flagellar type III secretion substrate secretion signals Fusions of the N-terminal 100 amino acids of late-type flagellar secretion substrates to β-lactamase, deleted for its Sec secretion signal, were constructed under control of the same ParaBAD chromosomal expression system and analysed for secretion into the culture supernatant (Fig. 2). We utilized deletions of the flagellar hook-filament junction proteins FlgK and FlgL to prevent assembly of the flagellar filament by the abundant flagellin subunits FliC and FljB. Preventing filament self-assembly would bypass any potential slow-down of secretion of other flagellar substrates. Separation of the cellular and supernatant fractions showed secretion of FlgM–Bla (using the 97 amino acid full-length sequence), FliD100–Bla and FlgL100–Bla. Cellular FliC100–Bla protein was only weakly detected and probably accounts for the absence of secreted FliC100– Bla in Fig. 2A. FliD100–Bla and FlgL100–Bla showed higher cellular levels than FliC100–Bla, but secreted levels were significantly less than for FlgM–Bla. Virtually no cellular and no secreted FlgK100–Bla was detected. It has been previously reported that at least for FliC and FlgK the © 2014 John Wiley & Sons Ltd, Molecular Microbiology, 93, 505–520

Characterization of flagellar secretion substrates 509

first 100 amino acids might be able to drive some export if overexpressed (Végh et al., 2006; Stafford et al., 2007). However, we conclude that a combination of low expression levels and the absence of the native 5′-UTR and chaperone binding domain of FliC, FliD, FlgK and FlgL resulted in our inability to detect substantial export. Dissection and optimization of secretion efficiency of selected early- and late-type substrates In order to analyse the secretion efficiency of early and late flagellar secretion substrates, we dissected the early-type substrates FlgD, FlgF and FlgE (Figs 3 and 4) and the late-type substrate FlgL (Fig. 5) into peptide segments of increasing lengths. Determination of the minimal inhibitory concentration with FlgD peptide secretion signals showed that the first 50 amino acids of FlgD (FlgD50–Bla) conferred an MIC of 68 μg ml−1 that was significantly higher than the fusion construct with the first 10 amino acids of FlgD (8 μg ml−1). The MIC increased substantially, to almost 600 μg ml−1, in a construct where the first 100 amino acids of FlgD were fused to Bla (Fig. 3A). Surprisingly, the MIC level of the full-length (232 amino acid) FlgD protein fused to Bla (FlgD232–Bla) was substantially lower compared to the MIC level observed for the shorter FlgD100– Bla construct. This effect was not due to lower expression levels of full-length FlgD232–Bla. The increased secretion efficiency of FlgD100–Bla was confirmed in a ΔflgE secretion assay (Fig. 3B), arguing for the importance of the first 100 amino acid segment as a secretion determinant. A region in FlgD after amino acid 100 might confer an inhibitory effect on secretion. A secretion-defective ΔfliF background was used to determine the stability of select fusion constructs in the cytoplasm. In contrast, amino acid segments 1–50 and 1–100 of FlgF fused to Bla resulted in a low MIC value, which, unlike the FlgD constructs, correlated to their cellular levels (Fig. 3D). A significant level of FlgF50–Bla was detected in the cytoplasm, whereas the level of cytoplasmic FlgF100–Bla was much lower. Neither FlgF50–Bla nor FlgF100–Bla was detected in the secreted fraction Western blot (Fig. 3E). For the full-length FlgF secretion signal, both cellular and secreted levels were detected at a significantly increased level. The MIC levels of Bla fusions using FlgE peptide secretion signals increased in correspondence with the length of the peptide secretion signal (Fig. 4A). Below the critical length of 40 amino acids, no secretion of FlgE–Bla into the periplasm was detected. Fusions of amino acids 1–50, 1–100, 1–200, 1–300 and full-length 1–403 showed increasing levels of ampicillin resistance, respectively, although cellular FlgE50–Bla and FlgE100–Bla were not detected (Fig. 4A, lower panel). These results are in agreement with the findings of Kornacker and Newton (1994) © 2014 John Wiley & Sons Ltd, Molecular Microbiology, 93, 505–520

and Moriya et al. (2013) who showed in a deletion analysis of FlgE that a region comprising residues 30–58 is important for export of FlgE. For the late-type substrate FlgL, secretion into the supernatant was analysed in a ΔflgKL background as described above. In accordance with our previous results for FlgF and FlgE, we also observed a correlation between secretion efficiency and increasing substrate length (Fig. 5A). Total protein expression levels for FlgL50–Bla, FlgL100–Bla and FlgL317–Bla were comparable (considering the combined cellular and supernatant fractions). FlgL50–Bla was not secreted, despite a high cellular level. FlgL100–Bla was weakly secreted and full-length FlgL fused to Bla (FlgL317–Bla) was strongly secreted. A strain deleted for the MS-ring subunit FliF served as a non-secreting control with FlgL100–Bla. As expected, neither the early-type substrate FliK, nor the FlgL100–Bla was exported in the ΔfliF background. Detailed dissection of the N-terminal secretion signal of the hook cap protein FlgD Our results indicated that high levels of Bla secretion could be obtained using the first 100 amino acids of FlgD as a secretion signal. To further analyse the role of individual regions within this 100 amino acid segment, we designed several FlgD–Bla fusion constructs to divide the N-terminal 100 amino acids in different – partly overlapping – fragments (Fig. 6). The well-secreted FlgD100 fragment was split using amino acids 1–10 and 10–100 as secretion signals. Both secretion signals, when fused to the Bla reporter, resulted in MIC levels close to the background level. Correspondingly, expression of FlgD10–Bla was not detected while secretion of FlgD(10–100)–Bla was barely detected (Fig. 6A). The truncated fragments FlgD25–100 and FlgD25–75 fused to Bla resulted in reduced, but significant cellular protein levels that did not show any secretion above background (Fig. 6A and B). Only FlgD1– 50, FlgD50–100 and full-length FlgD (aa 1–232) fused to Bla were well expressed and exhibited equivalent MIC levels. In comparison, FlgD100–Bla showed the same cellular level as full-length FlgD–Bla with substantially more secretion. Our results indicate that at least the region 1–50 is necessary for secretion of FlgD. This region includes residues 36–40 which have recently been shown to be important for FlgD secretion (Evans et al., 2013). It is important to note that MIC levels in Fig. 6A were assayed in a ΔflgBC background that detects secretion into the periplasm. This was compared to export of the various FlgD fragments fused to Bla into the extracellular medium by Western blot detection of the Bla fusion (Fig. 6B). Of all constructs tested, Western blotting against Bla revealed that only fusion constructs to FlgD1–100 and 1–232 (fulllength) were secreted into the culture supernatant (Fig. 6B,

510 H. M. Singer, M. Erhardt and K. T. Hughes ■

A

B

C

E D

F

© 2014 John Wiley & Sons Ltd, Molecular Microbiology, 93, 505–520

Characterization of flagellar secretion substrates 511

Fig. 3. Secretion efficiency of early-type substrates FlgD and FlgF. A and D. Export efficiencies of different-sized FlgD (A) and FlgF (D) secretion-signal variants were analysed in a ΔflgBC background by determining the minimal inhibitory concentrations. The N-terminal regions of the respective proteins were fused to β-lactamase lacking its Sec secretion signal. Whole cell lysates were obtained in the same experimental setting and analysed by Western blotting in order to visualize the overall amount of expression. The non-secreting ΔfliF control was used to determine the basal MIC level. B and E. Secretion of the respective β-lactamase fusions into the culture supernatant. Strains expressing FlgD (B) and FlgF (E) fusions were deleted for the hook protein FlgE (ΔflgE). Absence of the hook resulted in an early-phase locked type III secretion apparatus and export of the FlgD and FlgF fusions into the culture supernatant. Cellular maltose-binding protein (MBP) and extracellular FliK served as loading controls. C and F. Overview of the experimental outcome of different N-terminal FlgD (C) and FlgF (F) fusions. The minimal inhibitory concentration (MIC), protein levels in the whole cell lysate (TL, total lysate), as well as detected protein levels in the cellular (labelled C) and supernatant (labelled SN) fractions are summarized relative to FlgD100–Bla and full-length FlgF–Bla respectively.

lanes 3 and 8). All other constructs were not detected in the extracellular fraction, in spite of substantial expression levels that were comparable to Bla fused to FlgD1–100 and 1–232 secretion signals (with the exception of 1–10 and 10–100). Bla fusions with FlgD1–10 and 10–100 peptide A

B

© 2014 John Wiley & Sons Ltd, Molecular Microbiology, 93, 505–520

secretion signals were either less expressed or less stable, which would contribute to their non-secreting phenotype (Fig. 6A). Interestingly, FlgD50–100 fused to Bla was well expressed and positive for secretion in the MIC experiment (Fig. 6A, column 6). However, in the secretion assay, no Fig. 4. Secretion efficiency of early-type substrate FlgE. A. Export of FlgE–Bla fusion constructs across the inner membrane (ΔflgBC). Fusions of increasing length were analysed for their minimal inhibitory concentration against ampicillin. Total protein is detected in the whole cell lysate using antibodies against β-lactamase (Bla) and maltose binding protein (MBP). B. Schematic summary of analysed fusion constructs, relative MIC values and relative protein levels in the whole cell lysate normalized against the full-length FlgE fusion construct. TL, total lysate; C, cellular fraction; SN, supernatant fraction.

512 H. M. Singer, M. Erhardt and K. T. Hughes ■

A

Fig. 5. Secretion efficiency of late-type substrate FlgL. A. Detection of the secreted and non-secreted protein by Western blotting. Antibodies against β-lactamase (Bla) were used for detection of FlgL–Bla fusion proteins. Intracellular maltose binding protein (MBP) and secreted FliK served as reference proteins. The late substrate fusion FlgL–Bla was expressed in a strain lacking the hookfilament junction proteins FlgKL. B. Schematic summary of the tested FlgL–Bla length variants and resulting secretion levels relative to FlgL1-317–Bla. TL, total lysate; C, cellular fraction; SN, secreted supernatant fraction.

B

protein could be detected outside the cell (Fig. 6B, column 6). FlgD(50–100)–Bla could therefore be secreted into the periplasm, but if secreted across the outer membrane it was degraded. It was possible that secretion of FlgD50– 100 into the periplasm occurred independent of the flagellar type III secretion system and therefore was analysed further. Removal of the MS-ring located within the cytoplasmic membrane (ΔfliF) prevents assembly of the flagellar type III secretion system. Accordingly, we analysed the secretion efficiency of the different sized FlgD–Bla fusions in the presence and absence of the MS-ring component FliF. As shown in Fig. 7A, secretion of all FlgD variants was diminished in a ΔfliF background, with the exception of the FlgD50–100 Bla fusion. For FlgD50–100, we detected the same minimal inhibitory concentration in the presence and absence of FliF. This observation demonstrated that the FlgD50–100 fusion is indeed secreted across the inner membrane via an fT3SS-independent pathway. All other secretion competent mutants were presumably secreted via the fT3SS since their secretion was abolished in a ΔfliF background. The flagellum-independent secretion mechanism of FlgD50–100 was additionally shown in a mutant background missing the flagellar ATPase complex FliHIJ (Fig. 7B). Under conditions where the flagellar-specific ATPase/unfoldase/cargo-delivery shuttle complex made of FliI, FliH and FliJ was missing, secretion via the flagellar

type III secretion system was completely abolished. Secretion of FlgD50–100, however, was not affected by the absence of the soluble export apparatus components. To further characterize the various FlgD–Bla variants, we analysed MIC levels in mutant backgrounds affecting different components related to the flagellar export machinery. The absence of the C-ring components FliGMN, which act as an affinity cup for the fT3SS substrates, had a slightly less pronounced effect compared to the absence of the ATPase complex FliHIJ (compare Fig. 7B and C). The role of the ATPase complex therefore appears to be more important for an efficient secretion process than the contribution of the C-ring affinity cup. In order to analyse the effect of increased type III export system copy numbers on the secretion process, we utilized a PflhDC promoter-up mutation (changing the PflhDC promoter 1 and promoter 4 to an optimal −10 TATAAT box) (Erhardt and Hughes, 2010). An elevated level of flagellar secretion systems resulted in increased secretion of FlgD50–Bla and full-length FlgD–Bla, but did not have an additional effect on the well-secreted FlgD100–Bla (Fig. 7D). These results suggested that in case of FlgD1–100, the amount of substrate protein was rate-limiting for secretion and not the export system copy number. We conclude that the secretion signal of FlgD1–50 and of full-length FlgD are less efficiently recognized by the export apparatus and that the © 2014 John Wiley & Sons Ltd, Molecular Microbiology, 93, 505–520

Characterization of flagellar secretion substrates 513 A

B

C

Fig. 6. Detailed dissection of FlgD secretion. A. Secretion efficiency of various regions within the N-terminal 100 amino acids of FlgD fused to β-lactamase in comparison to full length FlgD–Bla fusion by determining the minimal inhibitory concentration. Intracellular levels of FlgD variants were detected by anti-Bla Western blotting. For the whole cell lysate, all replicates were pooled from the 96-well MIC assay plate. B. Separation of the cellular and extracellular fractions using the secretion assay protocol described in Experimental Procedures. FlgD–Bla fusions were detected using antibodies against β-lactamase. MBP: Maltose binding protein; FliK: molecular ruler of the bacterial flagellum. C. Schematic overview of dissected FlgD–Bla fusion proteins. Experimental results are summarized as following: relative MIC values; relative protein levels in the total lysate (TL), the cellular (C) and supernatant (SN) fraction. Values are normalized against FlgD100–Bla.

peptides FlgD1–10, FlgD10–100, FlgD25–100, FlgD50– 100 and FlgD25–75 are not recognized by the flagellarspecific type-III secretion system at all. Finally, we analysed whole cell lysates of FlgD–Bla fusion constructs in the presence and absence of clpXP to determine whether the impaired secretory capacity of the FlgD fragments was due to protein degradation via ClpXP protease. As shown in Fig. 7E, the absence of ClpXP did not change the total amount of detectable fusion proteins. This suggests that non-secreted FlgD–Bla variants are not subject to ClpXP-dependent degradation. ClpXP is also known to proteolytically degrade the flagellar master regulator FlhD4C2 (Tomoyasu et al., 2003). Thus, the absence of ClpXP and the resulting increased stability of FlhD4C2 did not result in a significant change in secretion levels (Fig. 7E). © 2014 John Wiley & Sons Ltd, Molecular Microbiology, 93, 505–520

Determining the role of the 5′-UTR of flagellar secretion substrates for substrate-protein stability and recognition by the export apparatus We next analysed the role of the 5′-untranslated region (5′-UTR) in the export process. We replaced the 5′-UTR of the arabinose promoter with the 5′-UTR sequence of the respective secretion substrate genes (Fig. 8). The transcriptional start-sites were identified by analysing RNA-sequencing and mutagenesis data of Salmonella Typhimurium provided by Kroger et al. (2012) and Lee and Hughes (2006). As shown in Fig. 1, we were not able to detect a significant MIC with the FlgB100–Bla fusion when expressed from the Para promoter using the araBAD 5′-UTR. Strikingly, replacing the 5′-UTR from the araBAD operon with the flgB 5′-UTR resulted in a complete

514 H. M. Singer, M. Erhardt and K. T. Hughes ■

A

B

C

D

E

© 2014 John Wiley & Sons Ltd, Molecular Microbiology, 93, 505–520

Characterization of flagellar secretion substrates 515

Fig. 7. Comparative analysis of FlgD mutants. Secretion of FlgD–Bla fusions were analysed in the presence and absence of the following components: the inner membrane MS-ring component FliF (A), the ATPase complex FliHIJ (B), the C-ring components FliGMN (C), the promoter mutation PflhDC7793 (D), which encodes a consensus PflhDC promoter 1 and promoter 4 −10 box (TATAAT) and results in increased motility (Erhardt and Hughes, 2010), as well as ClpXP, a protease degrading FlhD4C2 (E). Protein levels of MBP and Bla were obtained from whole cell lysates and visualized as described before.

recovery of flgB100-bla expression and FlgB100–Bla secretion (Fig. 8A and B, column 3). In the presence of flgB 5′-UTR, FlgB100–Bla was well-expressed and the MIC level resulting from FlgB100–Bla secretion into the periplasm increased at least 20-fold. For the 5′-UTRflgBflgB100-bla construct, proteolytic degradation of FlgB100– Bla to a smaller peptide occurred due to the export into the periplasm since the degradation product was not visible in a ΔfliF secretion-deficient strain (Fig. 8A, column 4). Degradation was also not visible when FlgB100–Bla was secreted from the cell or when it remained in the cytosol (supernatant and cellular fraction of Fig. 8B; empty blot regions below 40 kDa not shown). Similar results were obtained for FlgE100–Bla. To dissect the contribution of various 5′-UTR sequences on expression and secretion of FlgE100–Bla, we compared the following four 5′-UTR sequences, individually fused to flgE100-bla: (i) araBAD 5′-UTR, (ii) the 5′-UTR of the flgB-L operon, (iii) a 29 bp (equivalent to the TAA stop codon of flgD plus the non-coding region between flgD and flgE), and (iv) a 53-bp-long segment of 5′-UTR immediately upstream of the flgE coding sequence within the flgB-L operon, which was shown to be important for normal flgE expression by Lee and Hughes (2006). The presence of either the 29-bp or 53-bp-long segments of flgE 5′-UTR significantly recovered FlgE– Bla secretion resulting in a 10- to 17-fold increase in MIC levels (Fig. 8A, columns 8 and 9) and substantially higher secretion levels in a ΔflgD secretion assay (Fig. 8B, columns 10 and 11). To analyse whether the recovered secreted levels of the 5′-UTRflgE-flgE100-bla constructs were specific to the 5′-UTR immediately upstream of flgE, we exchanged the 5′-UTR of flgE with the 5′-UTR of the flgB-L operon. The 5′-UTR of flgB-L indeed had an effect on periplasmic FlgE100–Bla secretion leading to a twofold increase in MIC compared to the 5′-UTRara-flgE100-bla construct (Fig. 8A, column 7). However, no effect was detected for secretion on FlgE100–Bla from the cell (Fig. 8B, column 9). We next examined the secretion efficiency of the previously non-secreted late-type substrate FlgK100–Bla. Secretion analysis in a ΔflgKL background showed no change in expression and secretion when replacing the araBAD 5′-UTR with the flgK 5′-UTR (Fig. 8B, column 4–6). The observed defects in protein expression and subsequent secretion levels could be explained by a defect in (i) © 2014 John Wiley & Sons Ltd, Molecular Microbiology, 93, 505–520

transcription, (ii) mRNA stability, or (iii) protein translation/ stability. To rule out defects in transcription, we utilized expression of all constructs from the identical ParaBAD promoter, as explained above. To determine the amount of the transcribed mRNA available for translation, bla mRNA levels of all flgB100-bla, flgE100-bla and flgK100-bla 5′-UTR constructs was analysed by quantitative real-time PCR. As shown in Fig. S1, β-lactamase mRNA of the flgB100-bla construct could not be detected when using the 5′-UTR of araB. However, bla mRNA levels recovered upon replacement with the 5′-UTR of flgB. We thus observed a 5′-UTR-specific effect on mRNA stability rather than transcription of flgB100-bla. Meanwhile, we could not detect a role of the 5′-UTR on the stability of flgE100-bla and flgK100-bla mRNA. Here, a 5′-UTR effect had previously been described for FlgE translation within the context of the flgB–flgL operon (Lee and Hughes, 2006). For other substrates, e.g. FlgG, FlgD, FlgL or FliC, it has been reported that export can occur in the absence of protein translation, indicating that the importance of a potential mRNA signal varies between different secretion substrates (Hirano et al., 2003). Taken together, these results indicate an important role of the 5′-untranslated region at least for some early-type flagellar secretion substrates. However, a potential 5′-UTR signal is unlikely to act as the sole secretion determinant. The 5′-UTR of flgB-L had a pronounced effect on expression (and subsequent secretion) of the early-type substrate FlgB100–Bla, but did not affect secretion of the late substrate FlgK100–Bla.

Discussion The majority of flagellar secretion substrates are exported via the flagellar specific T3SS located at the base of the flagellum. Regarding the secretion signal, different models have been proposed, suggesting (i) a variable N-terminal secretion signal within the unstructured region of the substrate, (ii) a mRNA-based signal located within the 5′-untranslated region of the substrate mRNA, (iii) T3S-chaperone facilitated secretion for latetype substrates, or (iv) a combination of one or more RNA, peptide, and T3S-chaperone secretion signal. In this work we first uncoupled effects of the 5′-UTR, the T3S-chaperone signal, and the peptide sequence by analysing secretion efficiency of early-type T3S substrates, a class of substrate that is secreted without the

B

C

Fig. 8. 5′ UTR-effect of FlgB100, FlgK100 and FlgE100. A. Possible effects of the 5′-untranslated region (5′-UTR) on FlgB and FlgE secretion were analysed by determining the minimal inhibitory concentrations of the respective Bla fusion proteins. N-terminal 100 amino acids fusions of FlgB and FlgE were expressed from the arabinose-inducible promoter ParaBAD carrying the original 5′-UTR of the araBAD locus (labelled ‘araB’). Furthermore, the 5′-UTR from araBAD was replaced with the 5′-UTR of the native or an alternative gene locus (5′-UTR(flgB)-flgB100, 5′-UTR(flgB)-flgE100, 5′-UTR(flgE 29bp)-flgE100 and 5′-UTR(flgE 53 bp)-flgE100). Secreted levels of the 5′-UTR variants were compared to full-length constructs of FlgB and FlgE and to the secretion deficient background (labelled ΔfliF). Total Bla fusion protein and MBP were determined by Western blot detection of whole cell lysates. B. Secretion of 5′-UTR variants into the culture media. Secretion of FlgB constructs was analysed in a ΔflgE, FlgK constructs [5′-UTR(araB)-flgK100, 5′-UTR(flgB)-flgK100 and 5′-UTR(flgK)-flgK100] in a ΔflgKL, and FlgE constructs in a ΔflgD background. Proteins remaining inside the cell were detected by Western blot using antibodies against MBP and Bla. Levels of secreted FliK and Bla were detected accordingly. Detection of MBP in the supernatant was used to exclude cell lysis. C. Schematic overview of the analysed 5′-UTR fusion constructs. Resulting relative MIC levels and protein levels are summarized. TL, total lysate; C, cellular fraction; SN, supernatant fraction. In a ΔflgBC background the substrate-specificity switch has not yet occurred and the T3S system is in its early-secretion mode. Therefore, MIC analysis of the late secretion substrate FlgK was not performed (NA).

A

516 H. M. Singer, M. Erhardt and K. T. Hughes ■

© 2014 John Wiley & Sons Ltd, Molecular Microbiology, 93, 505–520

Characterization of flagellar secretion substrates 517

aid of T3S-chaperones. Initially, we characterized secretion of β-lactamase fusions to flagellar early-type peptide secretion signals that were expressed from ParaBAD using the ParaBAD 5′-UTR in order to separate peptide contributions to secretion from the flagellar 5′-UTR region. Under such conditions, we could detect a clear difference in secretion capability of early-type substrates, as shown in Figs 1, 3 and 4. We next tested whether the 5′-UTR, the T3Schaperone binding site and the peptide sequence were important for secretion of late-type substrates. The N-terminal 100 amino acids of late-type secretion substrates fused to Bla was transcribed from ParaBAD using the ParaBAD 5′-UTR. Only FlgM retained its T3S-chaperone binding domain. FlgM–Bla was well secreted and we detected residual secretion for FlgL and FliD, indicating that a peptide signal, by itself, might be sufficient for secretion of late-type substrates (Fig. 2) although it appears clear that secretion efficiency strongly varies from substrate to substrate. A dissection of the FlgD secretion signal identified amino acids 1–100 to be sufficient for secretion (Fig. 3A– C). Within this region, amino acids 1–9 appeared to have a substantial role for FlgD stability. Truncated FlgD1–10 or FlgD10–100 variants fused to Bla were unstable and probably degraded (Fig. 6). Thus, the secondary/tertiary structure of the secretion signal of FlgD might be important for detection by the export gate or potential interaction with unidentified chaperones. For FlgE and FlgL peptides, secretion increased with increasing length of the FlgE (Fig. 4) and FlgL fragments (Fig. 5) respectively. For FlgF, only the full-length protein functioned as a secretion signal for Bla, indicating that amino acids between 100 and 251 contributed to the secretion process (Fig. 3D and E). For the dissected FlgD secretion signals, we analysed the contribution of the ATPase complex FliHIJ (Fig. 7B), the C-ring FliGMN (Fig. 7C), fT3SS copy number (Fig. 7D) and potential proteolytic degradation by ClpXP (Fig. 7E). Our data indicate that the rate-limiting factor during the secretion process was the peptide secretion signal and secretion was dependent on both, the presence of the C-ring affinity site and the ATPase/secretion shuttle complex FliHIJ, rather than the number of flagellar secretion systems. This was in accordance with results obtained in the presence and absence of ClpXP protease. ClpXP protease is a known negative regulator of FlhD4C2 (Tomoyasu et al., 2003). As observed for the flhDC promoter-up mutation (which increased the total number of hook-basal bodies and thus fT3SS), increased stability of FlhD4C2 in the absence of ClpXP did not result in a significant change in secretion efficiency. We also observed that the presence of the ATPase complex played a more pronounced role than the pres© 2014 John Wiley & Sons Ltd, Molecular Microbiology, 93, 505–520

ence of the C-ring, which was suggested to function as an affinity site for localized sequestration of secretion substrates prior to their export (Erhardt and Hughes, 2010). However, the analysed FlgD secretion signal variants apparently did not affect FliHIJ-dependent unfolding or recognition via the C-ring. Regarding a potential role of the 5′-UTR in the flagellar T3S process, we observed that the 5′-UTR is important for the expression and secretion of only one early-type T3S substrate, FlgB. We observed dramatically reduced bla mRNA levels for the 5′-UTRaraBAD-flgB100-bla construct. However, replacing the 5′-UTR of araBAD with the 5′-UTR of flgB restored the transcript mRNA level. Figure S2 shows a comparison of the predicted secondary structures containing the 5′-UTR of araBAD (Fig. S2A) and flgB (Fig. S2B) respectively. The secondary structure of the araBAD 5′-UTR with the lowest free energy (initial ΔG = −12.40 kcal mol−1) predicted base-pairing within the region containing the Shine-Dalgarno sequence upstream of the flgB start codon. It appears therefore possible that the 5′-UTR of araBAD interfered with efficient translation initiation and it has been shown previously that translating ribosomes can shield mRNA from degradation (Har-El et al., 1979; Bjornsson and Isaksson, 1996; Braun et al., 1998; Joyce and Dreyfus, 1998). Another possible role of the 5′-untranslated region could be in targeting the secretion substrate mRNA to the vicinity of the export gate prior to translation. Such a localized translation mechanism might ensure high substrate abundance within the vicinity of the secretion apparatus. An incorrect 5′-UTR could interfere with binding of a factor that would be involved in targeting the secretion substrate mRNA to the export gate. As published by Karlinsey et al. (2000), our laboratory previously suggested a combination of three secretion signals. Thus, the flagellar T3S system would recognize the N-terminal peptide sequence, while translational regulators recognize a 5′-UTR mRNA signal. An additional anti-diffusion signal would be recognized by the substrate T3S-chaperone. Recognition of all three signals might maximize secretion of the substrate or contribute to timing of substrate secretion during assembly. However, one of the signals alone was proposed to be sufficient for secretion. Here, we show that for certain substrates (e.g. FlgB and FlgE) apparently more than one signal is needed for secretion via the fT3SS. Remarkably, our results presented here indicate a complex, multicomponent secretion signal that evolved to be specific for each substrate. Different substrates will ultimately have different requirements regarding their targeting and secretory capacity that might add an additional layer of regulation to ensure correct spatiotemporal export of flagellar building blocks to facilitate the assembly of the bacterial flagellum.

518 H. M. Singer, M. Erhardt and K. T. Hughes ■

Experimental procedures Bacterial strains and media Bacterial strains used in this study are listed in Table S1. Cells were grown in lysogeny broth (LB) media. Kanamycin sulphate (50 μg ml−1), tetracycline-HCl (15 μg ml−1) or anhydrotetracycline (1 μg ml−1) were added as needed. The arabinose promoter was induced by addition of 0.2% L-arabinose. For all transductions, the generalized transducing phage of Salmonella enterica servovar Typhimurium P22 HT105/1 int-201 was used (Sanderson and Roth, 1983).

Construction of 5′-UTR variants We made the following changes to the 5′-untranslated region (5′-UTR) of the arabinose promoter. The sequence downstream of the transcriptional start site (+1) was replaced with the 5′-UTR of the respective flagellar secretion substrates. The transcriptional start sites of flgK (24 bp upstream of ATG) and flgB (26 bp upstream of ATG) were identified according to Kroger et al. (2012) using the respective sequence of Salmonella Typhimurium LT2. Previous results by Lee and Hughes (2006) demonstrated that the 24 bp of the 3′ end of the flgD gene, upstream of the flgE coding sequence, was required for normal flgE expression. We therefore tested two different constructs – (i) a 29 bp 5′-UTR of flgE, containing the ribosomal binding site (RBS) upstream of flgE and the stop codon of flgD; and (ii) a 53 bp 5′-UTR spanning the last 24 bp of flgD and the 26 bp intergenic region between flgD and flgE, containing the flgE RBS. The latter construct was published to result in 100% of wild-type motility contrary to shorter flgD truncations, which significantly decreased motility (Lee and Hughes, 2006). The following 5′-UTR sequences were used for the 100 amino acid secretion substrate-β-lactamase fusions under control of the arabinose promoter ParaBAD: (i) 5′-UTR of flgK (attgaaggattaaaaggaaccatcATG) fused to flgK, (ii) 5′-UTR of flgB (tgaattttgccatttgcggaggagatATG) fused to flgB and flgK, (iii) 53 bp 5′-UTR of flgE (CTCGACGAAGTTCGGCAAAT AATCTAAgcccttacacttatcaggagtcagtcATG), and (iv) 29 bp 5′-UTR of flgE (TAAgcccttacacttatcaggagtcagtcATG) fused to flgE.

Minimal inhibitory concentration and whole cell lysates Analysis of the ampicillin resistance resulting from the export of β-lactamase-fusion proteins was analysed as described by Lee and Hughes (2006) with modification to suite a 96-well format. Briefly, multiple independent replicates were grown overnight at 37°C in a 96-well plate in LB medium. The following day, cells were diluted 1:100 in fresh LB-Ara medium and grown to mid-log phase for 2.5 h with shaking. Afterwards, an additional 1:5 dilution step was performed in LB-Ara medium. Twenty microlitres of cells was then transferred in 180 μl of LB-Ara supplemented with increasing concentrations of fresh ampicillin (0–768 μg ml−1). Replicate plates were stacked on top of each other and cells were grown for 4.5 h at 37°C in a shaking incubator. Plates were shaken for 5.0 s (0.10 mm shaking diameter, double orbit shaking type) using a

PerkinElmer 2030 microplate reader and absorbance was measured for 0.1 s at OD595. MIC values were determined as follows using R for Mac OS X (R-Development-Core-Team, 2008) and a modified version of package ‘stinepack’. Relative growth values were calculated by normalization of the measured OD595 values of any ampicillin (Amp) concentration to the zero Amp control. Next, a Stineman interpolation was used for a smooth curve fit of the relative growth values. A root finding was performed to determine the MIC of any given strain by calculating the interception with a threshold set at 5% of residual growth of the zero Amp control. Error bars represent the standard error of the mean (SEM). To detect to overall amount of expressed β-lactamase fusion protein, whole cell lysates were analysed, containing the intracellular, as well as the secreted periplasmic protein fractions. Equal volumes of the respective replicates were pooled from the 96-well MIC plates. To exclude loss of cells due to pelleting, cells were resuspended by pipetting prior to transfer to a fresh reaction tube. The optical density was measured at OD600 and cells were pelleted by centrifugation. The supernatant was removed and the pellet was resuspended in 2× SDS loading buffer with a yield of 20 OD600 units per μl. Equal amounts were loaded on precast 4–20% MiniPROTEAN TGX Precast gels (Bio-Rad) and analysed by Western blotting using antibodies against β-lactamase and maltose binding protein.

Secretion assays Secretion into the culture supernatant was analysed as published previously (Singer et al., 2012). Briefly, secreted protein was separated from the cellular fraction and precipitated using a final concentration of 10% trichloroacetic acid (TCA).

SDS-PAGE and Western blotting Protein levels of whole cell lysate, cellular and secreted fractions were analysed using SDS polyacrylamide gel electrophoresis and immunoblotting. Antibodies against β-lactamase (mouse, Abcam), maltose-binding protein (rabbit, NEB) and FliK (rabbit) were used for detection. Protein signals were detected using a dual-mode Imaging system Odyssey Fc (LI-COR), a Fuji FLR-9000 Phosphoimager or a Bio-Rad ChemiDoc system. Fluresence of antibodies against MBP and FliK were detected using secondary α-rabbit700, α-rabbit800 and α-mouse700 (LI-COR). For β-lactamase, fluorescence was detected using α-mouse800 (LI-COR) or, in the case of Figs 2, 4A and 8, by detection of chemiluminescence using goat α-mouse antibodies conjugated with horseradish peroxidase (Bio-Rad) and an ECL detection kit (Amersham Biosciences). Densiometric measurements were performed using ImageJ 1.44gs for Mac OS X (Abramoff et al., 2004).

RNA isolation and quantitative real-time PCR RNA isolation and quantitative real-time PCR were performed as described previously (Singer et al., 2013). Briefly, the RNeasy Mini Kit (Qiagen) was used for RNA isolation, the DNA-Free RNA kit 79254 (Qiagen) for removal of genomic DNA and the RevertAid First Strand cDNA Synthesis Kit © 2014 John Wiley & Sons Ltd, Molecular Microbiology, 93, 505–520

Characterization of flagellar secretion substrates 519

(Fermentas) for reverse transcription of RNA samples. Quantitative real-time PCR reactions were performed using the EvaGreen qPCR master mix (Bio-Rad) and primers AAGC CATACCAAACGACGAG and AATTGTTGC-CGGGAAGC TAG (bla), 5′-ACGCTCTGTCGCAAAAACTG and 5′-ACCAT CGTGCCG-GTTTTATC (gyrB), 5′-ACACCATCAAAGCGAAA GGC and 5′-TCATCACGCGCATA-CTGTTG (rpoD), 5′-TTTT GCCGCCGTCAAAGATC and 5′-ATGGCTCATTTCTGCAACCG (gmk). Experiments were carried out on a Rotor-Gene Q 2plex real-time PCR system (Qiagen). Relative changes in mRNA levels were analysed according to the method of Pfaffl (2001) and normalized against the transcript levels of the reference genes rpoD, gyrB and gmk.

Acknowledgements We thank Beat Schwaller for access to his luminometer. H.M.S. gratefully acknowledges scholarship support of the Boehringer Ingelheim Fonds. This work was supported by grant FN-7626 subside No. 31003A_132947/1 from the Swiss National Science Foundation and Grant No. GM056141 from the National Institutes of Health to K.T.H. and funding of the Helmholtz Association under the Helmholtz Young Investigator Grant No. VH-NG-932 and the People Programme (Marie Curie Actions) of the European Unions’s Seventh Framework Programme (FP7/2007-2013) under REA grant agreement No. 300718 and 334030 to M.E. The authors have no conflict of interest to declare.

References Abramoff, M.D., Magelhaes, P.J., and Ram, S.J. (2004) Image processing with Image J. Biophotonics Int 11: 36–42. Akeda, Y., and Galan, J.E. (2005) Chaperone release and unfolding of substrates in type III secretion. Nature 437: 911–915. Anderson, D.M., and Schneewind, O. (1997) A mRNA signal for the type III secretion of Yop proteins by Yersinia enterocolitica. Science 278: 1140–1143. Arnold, R., Brandmaier, S., Kleine, F., Tischler, P., Heinz, E., Behrens, S., et al. (2009) Sequence-based prediction of type III secreted proteins. PLoS Pathog 5: e1000376. Bjornsson, A., and Isaksson, L.A. (1996) Accumulation of a mRNA decay intermediate by ribosomal pausing at a stop codon. Nucleic Acids Res 24: 1753–1757. Braun, F., Le Derout, J., and Regnier, P. (1998) Ribosomes inhibit an RNase E cleavage which induces the decay of the rpsO mRNA of Escherichia coli. EMBO J 17: 4790–4797. Chadsey, M.S., and Hughes, K.T. (2001) A multipartite interaction between Salmonella transcription factor σ28 and its anti-sigma factor FlgM: implications for σ28 holoenzyme destabilization through stepwise binding. J Mol Biol 306: 915–929. Chadsey, M.S., Karlinsey, J.E., and Hughes, K.T. (1998) The flagellar anti-sigma factor FlgM actively dissociates Salmonella typhimurium σ28 RNA polymerase holoenzyme. Genes Dev 12: 3123–3136. Chevance, F.F.V., and Hughes, K.T. (2008) Coordinating assembly of a bacterial macromolecular machine. Nat Rev Microbiol 6: 455–465. Chilcott, G.S., and Hughes, K.T. (1998) The type III secretion © 2014 John Wiley & Sons Ltd, Molecular Microbiology, 93, 505–520

determinants of the flagellar anti-transcription factor, FlgM, extend from the amino-terminus into the anti-σ28 domain. Mol Microbiol 30: 1029–1040. Erhardt, M., and Hughes, K.T. (2010) C-ring requirement in flagellar type III secretion is bypassed by FlhDC upregulation. Mol Microbiol 75: 376–393. Erhardt, M., Singer, H.M., Wee, D.H., Keener, J.P., and Hughes, K.T. (2011) An infrequent molecular ruler controls flagellar hook length in Salmonella enterica. EMBO J 30: 2948–2961. Evans, L.D., Poulter, S., Terentjev, E.M., Hughes, C., and Fraser, G.M. (2013) A chain mechanism for flagellum growth. Nature 504: 287–290. Fan, F., Ohnishi, K., Francis, N.R., and Macnab, R.M. (1997) The FliP and FliR proteins of Salmonella typhimurium, putative components of the type III flagellar export apparatus, are located in the flagellar basal body. Mol Microbiol 26: 1035–1046. Har-El, R., Silberstein, A., Kuhn, J., and Tal, M. (1979) Synthesis and degradation of lac mRNA in E. coli depleted of 30S ribosomal subunits. Mol Gen Genet 173: 135–144. Hirano, T., Yamaguchi, S., Oosawa, K., and Aizawa, S. (1994) Roles of FliK and FlhB in determination of flagellar hook length in Salmonella typhimurium. J Bacteriol 176: 5439–5449. Hirano, T., Minamino, T., Namba, K., and Macnab, R.M. (2003) Substrate specificity classes and the recognition signal for Salmonella type III flagellar export. J Bacteriol 185: 2485–2492. Hughes, K.T., Gillen, K.L., Semon, M.J., and Karlinsey, J.E. (1993) Sensing structural intermediates in bacterial flagellar assembly by export of a negative regulator. Science 262: 1277–1280. Joyce, S.A., and Dreyfus, M. (1998) In the absence of translation, RNase E can bypass 5′ mRNA stabilizers in Escherichia coli. J Mol Biol 282: 241–254. Karavolos, M.H., Roe, A.J., Wilson, M., Henderson, J., Lee, J.J., Gally, D.L., and Khan, C.M. (2005) Type III secretion of the Salmonella effector protein SopE is mediated via an N-terminal amino acid signal and not an mRNA sequence. J Bacteriol 187: 1559–1567. Karlinsey, J.E., Lonner, J., Brown, K.L., and Hughes, K.T. (2000) Translation/secretion coupling by type III secretion systems. Cell 102: 487–497. Kornacker, M.G., and Newton, A. (1994) Information essential for cell-cycle-dependent secretion of the 591-residue Caulobacter hook protein is confined to a 21-amino-acid sequence near the N-terminus. Mol Microbiol 14: 73–85. Kroger, C., Dillon, S.C., Cameron, A.D., Papenfort, K., Sivasankaran, S.K., Hokamp, K., et al. (2012) The transcriptional landscape and small RNAs of Salmonella enterica serovar Typhimurium. Proc Natl Acad Sci USA 109: E1277–E1286. Kuwajima, G., Kawagishi, I., Homma, M., Asaka, J., Kondo, E., and Macnab, R.M. (1989) Export of an N-terminal fragment of Escherichia coli flagellin by a flagellum-specific pathway. Proc Natl Acad Sci USA 86: 4953–4957. Lee, H.J., and Hughes, K.T. (2006) Posttranscriptional control of the Salmonella enterica flagellar hook protein FlgE. J Bacteriol 188: 3308–3316. Lloyd, S.A., Norman, M., Rosqvist, R., and Wolf-Watz, H.

520 H. M. Singer, M. Erhardt and K. T. Hughes ■

(2001) Yersinia YopE is targeted for type III secretion by N-terminal, not mRNA, signals. Mol Microbiol 39: 520–531. Löwer, M., and Schneider, G. (2009) Prediction of type III secretion signals in genomes of gram-negative bacteria. PLoS ONE 4: e5917. Macnab, R. (2003) How bacteria assemble flagella. Annu Rev Microbiol 57: 77–100. Majander, K., Anton, L., Antikainen, J., Lång, H., Brummer, M., Korhonen, T.K., and Westerlund-Wikström, B. (2005) Extracellular secretion of polypeptides using a modified Escherichia coli flagellar secretion apparatus. Nat Biotechnol 23: 475–481. Minamino, T., and Macnab, R.M. (1999) Components of the Salmonella flagellar export apparatus and classification of export substrates. J Bacteriol 181: 1388–1394. Minamino, T., and Namba, K. (2008) Distinct roles of the FliI ATPase and proton motive force in bacterial flagellar protein export. Nature 451: 485–488. Moriya, N., Minamino, T., Ferris, H., Morimoto, Y., Ashihara, M., Kato, T., and Namba, K. (2013) Role of the Dc domain of the bacterial hook protein FlgE in hook assembly and function. Biophysics (Oxf) 9: 63–72. Namba, K. (2001) Roles of partly unfolded conformations in macromolecular self-assembly. Genes Cells 6: 1–12. Paul, K., Erhardt, M., Hirano, T., Blair, D.F., and Hughes, K.T. (2008) Energy source of flagellar type III secretion. Nature 451: 489–492. Pfaffl, M.W. (2001) A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29: e45. R-Development-Core-Team (2008) R: A Language and Environment for Statistical Computing. Vienna: R Foundation for Statistical Computing. Samudrala, R., Heffron, F., and McDermott, J.E. (2009) Accurate Prediction of Secreted Substrates and Identification of a Conserved Putative Secretion Signal for Type III Secretion Systems. PLoS Pathog 5: e1000375. Sanderson, K.E., and Roth, J.R. (1983) Linkage map of Salmonella typhimurium, Edition VI. Microbiol Rev 47: 410– 453. Singer, H.M., Erhardt, M., Steiner, A.M., Zhang, M.M., Yoshikami, D., Bulaj, G., et al. (2012) Selective purification of recombinant neuroactive peptides using the flagellar type III secretion system. mBio 3: pii: e00115-12. doi: 10.1128/mBio.00115-12 Singer, H.M., Erhardt, M., and Hughes, K.T. (2013) RflM functions as transcriptional repressor in the autogenous control of the Salmonella flagellar master operon flhDC. J Bacteriol 195: 4274–4282. Sory, M.P., Boland, A., Lambermont, I., and Cornelis, G.R.

(1995) Identification of the YopE and YopH domains required for secretion and internalization into the cytosol of macrophages, using the cyaA gene fusion approach. Proc Natl Acad Sci USA 92: 11998–12002. Stafford, G.P., Evans, L.D.B., Krumscheid, R., Dhillon, P., Fraser, G.M., and Hughes, C. (2007) Sorting of early and late flagellar subunits after docking at the membrane ATPase of the type III export pathway. J Mol Biol 374: 877–882. Tomoyasu, T., Takaya, A., Isogai, E., and Yamamoto, T. (2003) Turnover of FlhD and FlhC, master regulator proteins for Salmonella flagellum biogenesis, by the ATP-dependent ClpXP protease. Mol Microbiol 48: 443–452. Uchida, K., and Aizawa, S. (2014) The Flagellar Soluble Protein FliK Determines the Minimal Length of the Hook in Salmonella enterica Serovar Typhimurium. J Bacteriol 196: 1753–1758. Végh, B.M., Gál, P., Dobó, J., Závodszky, P., and Vonderviszt, F. (2006) Localization of the flagellum-specific secretion signal in Salmonella flagellin. Biochem Biophys Res Commun 345: 93–98. Wang, S., Fleming, R.T., Westbrook, E.M., Matsumura, P., and McKay, D.B. (2006) Structure of the Escherichia coli FlhDC complex, a prokaryotic heteromeric regulator of transcription. J Mol Biol 355: 798–808. Wang, Y., Zhang, Q., Sun, M.A., and Guo, D. (2011) Highaccuracy prediction of bacterial type III secreted effectors based on position-specific amino acid composition profiles. Bioinformatics 27: 777–784. Wang, Y., Sun, M., Bao, H., Zhang, Q., and Guo, D. (2013) Effective identification of bacterial type III secretion signals using joint element features. PLoS ONE 8: e59754. Warren, S.M., and Young, G.M. (2005) An amino-terminal secretion signal is required for YplA export by the Ysa, Ysc, and flagellar type III secretion systems of Yersinia enterocolitica biovar 1B. J Bacteriol 187: 6075–6083. Weber-Sparenberg, C., Poplau, P., Brookman, H., Rochon, M., Mockel, C., Nietschke, M., and Jung, H. (2006) Characterization of the type III export signal of the flagellar hook scaffolding protein FlgD of Escherichia coli. Arch Microbiol 186: 307–316. Williams, A.W., Yamaguchi, S., Togashi, F., Aizawa, S.I., Kawagishi, I., and Macnab, R.M. (1996) Mutations in fliK and flhB affecting flagellar hook and filament assembly in Salmonella typhimurium. J Bacteriol 178: 2960–2970.

Supporting information Additional supporting information may be found in the online version of this article at the publisher’s web-site.

© 2014 John Wiley & Sons Ltd, Molecular Microbiology, 93, 505–520