Appl Microbiol Biotechnol DOI 10.1007/s00253-014-5851-z
APPLIED GENETICS AND MOLECULAR BIOTECHNOLOGY
Combination of heterogeneous catalase and superoxide dismutase protects Bifidobacterium longum strain NCC2705 from oxidative stress Fanglei Zuo & Rui Yu & Xiujuan Feng & Gul Bahar Khaskheli & Lili Chen & Huiqin Ma & Shangwu Chen
Received: 3 March 2014 / Revised: 21 May 2014 / Accepted: 22 May 2014 # Springer-Verlag Berlin Heidelberg 2014
Abstract Bifidobacteria are generally sensitive to oxidative stress caused by reactive oxygen species (ROS). To improve oxidative-stress tolerance, the superoxide dismutase (SOD) gene from Streptococcus thermophilus (StSodA) and the heme-dependent catalase (KAT) gene from Lactobacillus plantarum (LpKatL) were heterologously expressed in Bifidobacterium longum strain NCC2705. Three types of strain NCC2705 transformants were obtained: with transgenic SOD expression, with transgenic KAT expression, and with coexpression of the two genes. Intracellular expression of the genes and their functional role in oxidative-stress resistance were evaluated. In response to oxidative stress, B. longum NCC2705/pDP401-LpKatL (expressing LpKatL) and NCC2705/pDP-Kat-Sod (coexpressing LpKatL and StSodA) rapidly degraded exogenous H2O2 and the peroxides generated as a byproduct of aerobic cultivation, preventing oxidative damage to DNA and RNA. Individual expression of StSodA or LpKatL both improved B. longum NCC2705 cell viability. Survival rate of strain NCC2705 was further improved by F. Zuo : R. Yu : G. B. Khaskheli : L. Chen : S. Chen (*) Key Laboratory of Functional Dairy Science of Chinese Ministry of Education and Municipal Government of Beijing, College of Food Science and Nutritional Engineering, China Agricultural University, 17 Qinghua East Road, Haidian District, Beijing 100083, China e-mail: [email protected] X. Feng State Key Laboratory of Heavy Oil Processing, Unconventional Energy Research Center, New Energy Research Institute, China University of Petroleum, Beijing, 18 Fuxue Road, Changping District, Beijing 102249, China H. Ma College of Agriculture and Biotechnology, China Agricultural University, Beijing 100193, China
combining SOD and KAT expression. The two enzymes played complementary roles in ROS-scavenging pathways, and coexpression led to a synergistic beneficial effect under conditions of intensified oxidative stress. Our results illustrate that heterogeneous expression of heme-dependent KAT and Mn2+-dependent SOD is functional in the B. longum oxidative-stress response, and synergistic protection is achieved when their expressions are combined. Keywords Bifidobacteria . Oxidative stress . Reactive oxygen species . Catalase . Superoxide dismutase
Introduction Reactive oxygen species (ROS), including hydrogen peroxide (H2O2), superoxide anion (O2•−), and hydroxyl radical (•OH), are toxic to cells by virtue of their ability to damage DNA, protein, and membranes, leading to growth arrest and death (Storz and Imlay 1999). ROS are generated as a byproduct of normal respiratory processes or from an encounter with exogenous oxidants. In bacteria, both O2•− and H2O2 are primarily produced by the accidental autoxidation of nonrespiratory flavoproteins (Seaver and Imlay 2004; Korshunov and Imlay 2010). The formation of H2O2 from O2•−, catalyzed by the enzyme superoxide dismutase (SOD) (1), is a common source of intracellular H2O2 production in almost all organisms. In many bacteria, H2O2 can be detoxified by catalase (KAT) through a dismutation reaction that produces molecular O2 and H2O directly (2) (Whittenbury 1964). In the presence of Fe2+, however, H2O2 can generate the most reactive and deleterious of the ROS, • OH, by the nonenzymatic
Appl Microbiol Biotechnol
Fenton reaction (3; Halliwell and Gutteridge 1986). Hence, H2O2 removal is of the utmost importance for cell survival. SOD
þ 2 O•− 2 þ 2 H → H2 O2 þ O2 KAT
ð1Þ
2 H2 O2 → 2 H2 O þ O2
ð2Þ
2 H2 O2 þ Fe2þ →• OH þ HO− þ Fe3þ
ð3Þ
O2 þ NADðPÞH þ Hþ → H2 O2 þ NADðPÞþ
ð4Þ
NOXs
þ Hþ
NOXs;Ahp;TR
→
H2O
Bifidobacteria are obligate anaerobic bacteria, and their application in foods, particularly dairy products, is hindered by their high sensitivity to the oxidative stress encountered during processing (Boylston et al. 2004). Genome sequencing reveals that neither SOD nor KAT homologs are present in bifidobacteria. NADH oxidase (NOX), alkyl hydroperoxide reductase (Ahp), and thioredoxin reductase (TR) are suggested to be the major enzymes involved in the proposed NAD(P)H-dependent H 2 O 2 -scavenging pathway in bifidobacteria (4) (Schell et al. 2002; Xiao et al. 2011). One exception to this is Bifidobacterium asteroides, which contains an oxygen-inducible heme-KAT that enables its growth in 20 % O2 (Hayashi et al. 2013). Integration of exogenous KAT has also been shown to markedly improve Bifidobacterium longum’s tolerance of oxidative stress (He et al. 2012). Therefore, expression of KAT in bifidobacteria can result in H2O2 scavenging and consequent prevention of • OH formation, thereby reducing oxidative stress. However, another major ROS, O2•−, cannot be directly removed, and it inhibits KAT activity (Kono and Fridovich 1982; Shimizu et al. 1984). Coexpression of SOD and KAT in Lactobacillus rhamnosus enabled the growth of a facultative anaerobic lactic acid bacterial recombinant strain under higher oxidative-stress conditions than the strain expressing only KAT (An et al. 2011). In this study, we coexpressed a heme-dependent KAT gene from Lactobacillus plantarum (LpKatL) and a Mn2+-dependent SOD gene from Streptococcus thermophilus (StSodA) in B. longum strain NCC2705 to investigate the NAD(P)H-independent ROS-scavenging pathway and its functional contribution to the oxidative-stress response. The recombinant strains producing LpKatL and StSodA showed markedly reduced levels of peroxides and significantly less damage to DNA and RNA, resulting in higher survival rates compared to control strains. To the best of our knowledge, this is the first report of the establishment of a metabolic route comprising the heterogeneous heme-dependent KAT gene and Mn2+-dependent SOD gene in B. longum.
Materials and methods Bacterial strains, plasmids, and growth conditions The bacterial strains and plasmids used in this study are listed in Table 1. Bifidobacteria strains were generally grown at 37 °C in de Man, Rogosa, and Sharpe (MRS) broth supplemented with 0.05 % (w/v) L-cysteine HCl (MRSc) under 80 % N2–10 % H2–10 % CO2 unless otherwise noted. Escherichia coli strains were grown at 37 °C in Luria-Bertani (LB) medium with shaking at 200 rpm. Antibiotics (Sigma-Aldrich) were used at the following concentrations: 100 μg/ml ampicillin and 100 μg/ml spectinomycin for E. coli and 100 μg/ml spectinomycin for bifidobacteria. DNA manipulation and transformation rTaq DNA polymerase, restriction endonuclease, pMD19-T simple vector, and T4 DNA ligase used in vector construction were purchased from Takara (Dalian, China). The genes LpKatL and StSodA were PCR-amplified from L. plantarum strain NL42 and S. thermophilus strain XJ41 chromosomal DNA, respectively, using the gene-specific primers listed in Table 2. The PCR products were purified and cloned into vector pMD19-T simple; successful cloning was confirmed by nucleotide sequencing. To construct the LpKatL- and StSodA-expressing vector, a Pgap-IL10-Thup fragment was amplified using the bifidobacteria expression vector pESH93 (kindly provided by Dr. Andrei Nikolaevich Shkoporov, Russian State Medical University, Russian Federation) and two primers: Pgap-F and Pgap-R (Table 2). The PCR products were purified and cloned into the pMD19-T simple vector, generating plasmid pMD19-PIT. A synthetic double-stranded linker (NH-linker-F and NH-linker-R, Table 2) was cloned into the NcoI and HindIII sites of pMD19-PIT, generating plasmid pMD19-PmcsT with multiple cloning sites ClaI, KpnI, and XbaI. LpKatL was inserted into pMD19-PmcsT via NcoI and ClaI, generating pMD19-pKat. StSodA was inserted into pMD19-PmcsT via NcoI and XbaI, generating pMD19-pSod. The expression vectors pDP401-LpKatL and pDP401-StSodA were constructed by cloning the AccI–XhoI fragment of pMD19-pKat and pMD19-pSod in the vector pDP870 (kindly provided by Dr. D. Pridmore, Nestlé Research Center, Lausanne, Switzerland) digested with the same enzymes. To construct the coexpression vector, StSodA was inserted into pDP401-LpKatL behind LpKatL via ClaI and XbaI, generating pDP401-Kat-Sod. The coexpression vector pDP-Kat-Sod was constructed by inserting a Phup promoter, cloned from the genome of B. longum strain NCC2705, into pDP401-Kat-Sod behind LpKatL via ClaI; StSodA was under the control of Phup. Phup promoter orientation was confirmed by nucleotide sequencing.
Appl Microbiol Biotechnol Table 1 Bacterial strains and plasmids used in this study Strains and plasmids
Description
Sources or references
Strains Escherichia coli DH5a
φ80dlacZΔM15 Δ(lacZY-argF)U169 deoR recA1 endA1 hsdR17(rK−mK+) sup E44 thi-1 gyrA96 relA1 Lactobacillus plantarum NL42 Wild-type, isolated from cheese Streptococcus thermophilus XJ41 Wild-type, isolated from yogurt Bifidobacterium longum NCC2705 Isolated from adult human feces Plasmids pMD19-T simple 2.7-kb E. coli cloning vector, Ampr pESH93 7.5-kb E. coli-Bifidobacterium shuttle expression vector, Bifidobacterium longum gap gene promoter and hup gene terminator, Bifidobacterium breve Sec2 protein signal peptide coding region, human IL-10 encoding gene; Emr, Ampr pDP870 4.3-kb E. coli-B. longum shuttle cloning vector, Spr pMD19-LpKatL 4.2-kb pMD19-T simple derivate, containing a LpKatL gene from Lactobacillus plantarum NL42 pMD19-StSodA 3.3-kb pMD19-T simple derivate, containing a StSodA gene from Streptococcus thermophilus XJ41 pMD19-PIT 3.7-kb pMD19-T simple derivate, containing a 1.0-kb expression cassette DNA fragment amplified from pESH93 pMD19-PmcsT 3.1-kb pMD19-PIT derivate, a linker containing a multiple cloning site was substituted for Bifidobacterium breve Sec2 protein signal peptide-coding region and human IL-10-encoding gene pDP401 4.6-kb pDP870 derivate, containing PmcsT DNA fragment from pMD19-PmcsT pDP401-LpKatL 6.0-kb pDP870 derivate, containing Pgap-Kat-Thup expression cassette pDP401-StSodA 5.2-kb pDP870 derivate, contain Pgap-Sod-Thup expression cassette pDP401-Kat-Sod 6.7-kb pDP870 derivate, contain Pgap-Kat-Sod-Thup expression cassette pDP-Kat-Sod 6.9-kb pDP401-Kat-Sod derivate, insert Phup in front of StSodA gene
Transgene, Beijing, China This work This work Schell et al. 2002 Takara, Dalian, China Khokhlova et al. 2010
Klijn et al. 2006 This work This work This work This work
This work This work This work This work This work
Strains Lactobacillus plantarum NL42 and Streptococcus thermophilus XJ41 have been deposited in the China General Microbiological Culture Collection Center (CGMCC) collection (WDCM550), with the collection number of 8845 and 8846, respectively. Bifidobacterium longum NCC2705 was deposited in Nantes Culture Collection (WDCM 856)
All of these vectors were constructed in E. coli strain DH5α (Biomed, China). The resulting expression plasmids pDP401-LpKatL, pDP401-StSodA, and pDP-Kat-Sod were transformed into B. longum strain NCC2705 as described previously (Klijn et al. 2006). The empty vector pDP401, constructed by cloning the AccI–XhoI fragment of pMD19PmcsT in the vector pDP870, was used as a control. Transformants were confirmed by colony PCR and plasmid DNA extraction. Recombinant Bifidobacterium strains expressing KAT and SOD were detected by electrophoresis on a 15 % polyacrylamide gel. Total DNA isolation from recombinant Bifidobacterium and control strains for DNA damage analysis was according to Zuo et al. (2013). RNA isolation and semi-quantitative reverse transcription-polymerase chain reaction
spectrophotometry at 260 nm. The absence of residual DNA in the DNase I-digested total RNA was confirmed by PCR. Reverse transcription was carried out using M-MLV Reverse Transcriptase (Promega) in a 20-μl reaction volume containing 150 ng of random primers and 1 mM dNTP mix (Tiangen, China). Primers were designed with Primer Premier 5 software to amplify 100- to 250-bp regions of the chosen genes for semi-quantitative reverse transcription-polymerase chain reaction (sqRT-PCR) (Table 2). Relative expression values for three biological replicates were normalized to the expression values of an endogenous internal 16S ribosomal RNA control of B. longum strain NCC2705. The PCR products were resolved by electrophoresis in 2 % agarose gels which were then stained with ethidium bromide and analyzed with Quantity One software (Bio-Rad). Enzymatic activity assays
Total RNA from B. longum strains in the exponential growth phase (OD600nm =0.6) was isolated using TRIzol Reagent (Invitrogen) and then treated with RNase-free DNase I (Takara). RNA concentrations were determined by
B. longum strain NCC2705 and its transformants were grown in MRS medium supplemented with 10 μM hematin (Sigma-Aldrich) (He et al. 2012). Exponential-phase cells
Appl Microbiol Biotechnol Table 2 Oligonucleotides primers used in this study Oligonucleotides
Sequence, 5′→3′a
Restriction sites
Purpose
Pgap-F Pgap-R Kat-F1 Kat-R1 Sod-F1 Sod-F2 Sod-R1 NH-linker-F NH-linker-R BLr01-F BLr01-R Kat-rt-F1 Kat-rt-R1 Sod-rt-F1 Sod-rt-R1
CGTCTACCTGATGATTCGAGACATT GCTCGAGCTGAACTAGTCCGGAAT CCATGGAAATGACGGAAAAATTAACGACGGAAACCGGCCATCCGT CATCGATTTAATCACTGATAATATCAGCAAT CATCGATATGGCTATTATTCTTCCAGAT ACCATGGCTATTATTCTTCCAGAT TTTCTAGATTATTTAGCTTCTGCGTAAAG CATGGACGCGACTAGTATCGATGGTACCAGATCTAGA AGCTTCTAGATCTGGTACCATCGATACTAGTCGCGTC TCCTACGGGAGGCAGCAGT CCGCCTACGAGCCCTTTAC TGGGGGAATATACTAAGGCA CAGGAAATTTTAAAGGGTCG GCACTTTTCTGGGAACTTT GATTGGTTTTTTACCGTCTG
AccI XhoI NcoI ClaI ClaI NcoI XbaI ClaI, XbaI XbaI, ClaI – – – – – –
Vector construction Vector construction Vector constructionb Vector constructionb Vector constructionc Vector constructionc Vector constructionc Vector construction Vector construction RT-PCR RT-PCR RT-PCRb RT-PCRb RT-PCRc RT-PCRc
a
The added restriction enzyme sites are underlined
b
Primer designed for gene cloning according to GenBank accession no. AY375759.1 (Lactobacillus plantarum CNRZ 1228)
c
Primer designed for gene cloning according to GenBank accession no. AF538722.2 (Streptococcus thermophilus AO54)
(OD600nm =0.6) were used for enzymatic activity assay. KAT activity was examined by detecting bubble formation upon addition of 10 % H2O2 to the cell pellet. Quantitative activity was determined by a previously described assay (Sinha 1972; An et al. 2011). The pyrogallol autoxidation method was used to determine SOD activity (Marklund and Marklund 1974). Cell-free extract of each sample was prepared by ultrasonic treatment according to Xiao et al. (2011), and protein concentrations were determined by Bradford protein assay (Bradford 1976).
This assay was also used to measure the peroxides generated when control and recombinant B. longum NCC2705 strains were exposed to atmospheric oxygen. MRS-cultured cells (50 ml) in the exponential phase were transferred to a 200-ml Erlenmeyer flask and grown under aerobic conditions with shaking at 200 rpm. Peroxide concentration in the culture supernatant was determined at different intervals.
Quantification of peroxide levels in B. longum cell suspensions
The control and recombinant strains of B. longum NCC2705 were grown in MRS broth supplemented with 10 μM hematin. An aliquot of exponential-phase cells was treated with 2.5 mM H2O2 for 1 h or 10 mM methyl viologen (MV) for 6 h at 37 °C (MV treatment was under aerobic conditions). Then, H2O2 or MV was quickly removed by washing two times with 0.85 % (w/v) NaCl solution, and viable cells were counted by plating appropriate dilutions on MRS agar after 36–48 h in anaerobic culture at 37 °C. Cultures that were not treated with oxidizing agent were used as a reference to calculate survival rate. Presented values are the averages of three independent experiments. To investigate the oxygen-stress tolerance of B. longum strain NCC2705 and its transformants, cultures (50 ml each) were anaerobically grown in MRS medium supplemented with 10 μM hematin to the stationary phase (OD600 =2.0– 2.5). The cultures were transferred to a 200-ml Erlenmeyer flask sealed with a sterile porous sealing membrane. Oxygen-
The control and recombinant strains of B. longum NCC2705 were grown in MRS broth supplemented with 10 μM hematin under anaerobic conditions to the exponential phase. Exogenous H2O2 was added to a final concentration of 1 mM. Residual H2O2 concentration was determined at different intervals by ammonium ferrous sulfate/xylenol orange (FOX) colorimetric assay as described previously (Wolff 1994; Shea and Mulks 2002). Briefly, 500 μl of the culture was pelleted and 100 μl of cell-free supernatant was added to 400 μl of 25 mM sulfuric acid in a 1-ml cuvette. Then, 500 μl freshly prepared reaction buffer (containing 200 μM ammonium ferrous sulfate, 200 μM xylenol orange, and 25 mM sulfuric acid) was added to the mixture. During 30 min of incubation at room temperature, absorbance was read at 560 nm.
Determination of oxidative-stress tolerance
Appl Microbiol Biotechnol
LpKatL and StSodA genes from L. plantarum NL42 and S. thermophilus XJ41, respectively, were cloned with the gene-specific PCR primers (Table 2) (GenBank Accession numbers: KJ463409 and KJ463410, respectively), and sequence BLAST analysis showed 99 and 100 % identity with their respective registered homologs. The obtained LpKatL encoded a protein of 484 amino acids with a calculated molecular mass of 55.4 kDa, and a domain specific for hemeKAT was confirmed, similar to homologous genes in many other strains of Lactobacillus (Abriouel et al. 2004). The cloned StSodA encoded a protein of 201 amino acids with a calculated molecular mass of 22.6 kDa, belonging to the iron/manganese-SOD family. The expression cassettes of LpKatL and StSodA and serial recombinant plasmids based on pDP870 were constructed (Fig. 1) and then introduced into B. longum strain NCC2705. The control strain B. longum NCC2705/pDP401, LpKatL-expressing strain B. longum NCC2705/pDP401-LpKatL, StSodA-expressing strain B. longum NCC2705/pDP401-StSodA, and LpKatL– StSodA-coexpressing strain B. longum NCC2705/pDP-Kat-
Sod were obtained by electroporation. Heterologous expression of LpKatL and StSodA was confirmed by sqRT-PCR (Fig. 2a) with the specific sqRT-PCR primers (Table 2). The LpKatL transcript was detected in RNA isolated from B. longum NCC2705/pDP401-LpKatL and NCC2705/pDPKat-Sod cells, but not from B. longum NCC2705/pDP401 or NCC2705/pDP401-StSodA (Fig. 2a). Similarly, the StSodA transcript was detected in RNA isolated from B. longum NCC2705/pDP401-StSodA and NCC2705/pDP-Kat-Sod cells, but not from B. longum NCC2705/pDP401 or NCC2705/pDP401-LpKatL (Fig. 2a). StSodA transcript was 2.5-fold more abundant in B. longum NCC2705/pDP-Kat-Sod than in NCC2705/pDP401-StSodA (Fig. 2a). A protein band of 23.2 kDa, slightly larger than the predicted StSodA molecular mass of 22.6 kDa, was found upon SDS-PAGE of the NCC2705/pDP-Kat-Sod strain’s total proteins (Fig. 2b), whereas in the other expression cassette structures, no such new band was observed. In the lanes with LpKatL and the LpKatL-StSodA strain, a faint band presumed to match KAT appeared at around 55 kDa (Fig. 2b). KAT expression was biochemically supported by the heme-dependent KAT activity in the recombinant strains measured by O2 formation upon addition of H2O2 and hematin (Fig. 2c). As shown in Fig. 2c, heme-KAT activity was observed in both B. longum NCC2705/pDP401-LpKatL and NCC2705/pDP-Kat-Sod, but not in B. longum NCC2705/pDP401 or NCC2705/pDPStSodA. Table 3 lists the specific activities from hemedependent KAT and Mn2+-SOD assays in cell-free extracts of B. longum NCC2705/pDP401-LpKatL and NCC2705/ pDP-Kat-Sod. The highest KAT activity was 3,633 U/mg protein in the presence of Mn2+-SOD in the NCC2705/pDP-
Fig. 1 Structural map of vectors pDP401, pDP401-LpKatL, pDP401StSodA, and pDP-Kat-Sod. Spec, spectinomycin-resistance gene; Pgap, B. longum gap (encoding glyceraldehyde 3-phosphate dehydrogenase)
promoter; Phup, B. longum hup (encoding histone-like protein HU) promoter; Thup, hup terminator; pMB1, encoding pMB1 replication protein
stress tolerance of B. longum was investigated by monitoring survival at 0, 3, and 6 h with shaking at 200 rpm at 37 °C. The StSodA and LpKatL gene sequences have been deposited in GenBank with accession numbers KJ463409 and KJ463410, respectively.
Results Expression of LpKat and StSod in B. longum strain NCC2705
Appl Microbiol Biotechnol
Fig. 2 Molecular and biochemical assays of B. longum NCC2705 transformants. a Level of LpKatL and StSodA mRNA expression detected by sqRT-PCR. b SDS-PAGE of whole-cell extract of B. longum NCC2705 pDP401 (control), pDP401-StSodA (StSodA), pDP401LpKatL (LpKatL), and pDP-Kat-Sod (Kat-Sod, LpKatL, and StSodA)
grown in MRSc medium. Marker, 12 to 100 kDa molecular weight marker. c KAT activity assay of B. longum NCC2705 strains pDP401 (control), pDP401-StSodA (StSodA), pDP401-LpKatL (LpKatL), and pDP-Kat-Sod (Kat-Sod, LpKatL, and StSodA) with or without addition of 10 μM hematin
Kat-Sod strain, 2.4-fold that of the transformant with LpKatL alone. The elevated Mn2+-SOD activity in this strain, which was 1.3-fold that of the strain expressing StSodA alone
(Table 3), may be due to the stronger promoter of the hup cistron, as a very clear band was seen on the SDSpolyacrylamide gel (Fig. 2b). These results confirmed effective functional integration of active heme-dependent KAT and Mn 2+ -dependent SOD in the respective recombinant B. longum NCC2705 strains, as well as a synergistic interaction between the two enzymes.
Table 3 Enzyme activity in the cell-free extracts of B. longum NCC2705 and its recombinant strains Strains
pDP401 pDP401-StSodA pDP401-LpKatL pDP-Kat-Sod
Activities (U/mg crude protein) Superoxide dismutase (SOD)
Catalase (KAT)
N.D. 59.9±10.9 N.D. 78.4±3.2
N.D. N.D. 1,487.8±245.3 3,633.2±307.5
N.D. not detected (less than 0.1 U/mg crude protein)
Expression of LpKat and StSod alleviates oxidative stress The abilities of recombinant B. longum NCC2705 strains to scavenge exogenous H2O2 were determined by FOX assay. As shown in Fig. 3a, B. longum NCC2705 expressing LpKatL rapidly scavenged H2O2; 1 mM H2O2 was detoxified within 15 min by B. longum NCC2705/pDP401-LpKatL and
Appl Microbiol Biotechnol
Fig. 3 Ability of recombinant B. longum NCC2705 strains to degrade exogenous H2O2 (a) and endogenous peroxides generated by aerobic metabolism (b). The experiments were performed at least twice, and the average values are shown with calculated standard deviation. Asterisks indicate a statistically significant difference (*P
APPLIED GENETICS AND MOLECULAR BIOTECHNOLOGY
Combination of heterogeneous catalase and superoxide dismutase protects Bifidobacterium longum strain NCC2705 from oxidative stress Fanglei Zuo & Rui Yu & Xiujuan Feng & Gul Bahar Khaskheli & Lili Chen & Huiqin Ma & Shangwu Chen
Received: 3 March 2014 / Revised: 21 May 2014 / Accepted: 22 May 2014 # Springer-Verlag Berlin Heidelberg 2014
Abstract Bifidobacteria are generally sensitive to oxidative stress caused by reactive oxygen species (ROS). To improve oxidative-stress tolerance, the superoxide dismutase (SOD) gene from Streptococcus thermophilus (StSodA) and the heme-dependent catalase (KAT) gene from Lactobacillus plantarum (LpKatL) were heterologously expressed in Bifidobacterium longum strain NCC2705. Three types of strain NCC2705 transformants were obtained: with transgenic SOD expression, with transgenic KAT expression, and with coexpression of the two genes. Intracellular expression of the genes and their functional role in oxidative-stress resistance were evaluated. In response to oxidative stress, B. longum NCC2705/pDP401-LpKatL (expressing LpKatL) and NCC2705/pDP-Kat-Sod (coexpressing LpKatL and StSodA) rapidly degraded exogenous H2O2 and the peroxides generated as a byproduct of aerobic cultivation, preventing oxidative damage to DNA and RNA. Individual expression of StSodA or LpKatL both improved B. longum NCC2705 cell viability. Survival rate of strain NCC2705 was further improved by F. Zuo : R. Yu : G. B. Khaskheli : L. Chen : S. Chen (*) Key Laboratory of Functional Dairy Science of Chinese Ministry of Education and Municipal Government of Beijing, College of Food Science and Nutritional Engineering, China Agricultural University, 17 Qinghua East Road, Haidian District, Beijing 100083, China e-mail: [email protected] X. Feng State Key Laboratory of Heavy Oil Processing, Unconventional Energy Research Center, New Energy Research Institute, China University of Petroleum, Beijing, 18 Fuxue Road, Changping District, Beijing 102249, China H. Ma College of Agriculture and Biotechnology, China Agricultural University, Beijing 100193, China
combining SOD and KAT expression. The two enzymes played complementary roles in ROS-scavenging pathways, and coexpression led to a synergistic beneficial effect under conditions of intensified oxidative stress. Our results illustrate that heterogeneous expression of heme-dependent KAT and Mn2+-dependent SOD is functional in the B. longum oxidative-stress response, and synergistic protection is achieved when their expressions are combined. Keywords Bifidobacteria . Oxidative stress . Reactive oxygen species . Catalase . Superoxide dismutase
Introduction Reactive oxygen species (ROS), including hydrogen peroxide (H2O2), superoxide anion (O2•−), and hydroxyl radical (•OH), are toxic to cells by virtue of their ability to damage DNA, protein, and membranes, leading to growth arrest and death (Storz and Imlay 1999). ROS are generated as a byproduct of normal respiratory processes or from an encounter with exogenous oxidants. In bacteria, both O2•− and H2O2 are primarily produced by the accidental autoxidation of nonrespiratory flavoproteins (Seaver and Imlay 2004; Korshunov and Imlay 2010). The formation of H2O2 from O2•−, catalyzed by the enzyme superoxide dismutase (SOD) (1), is a common source of intracellular H2O2 production in almost all organisms. In many bacteria, H2O2 can be detoxified by catalase (KAT) through a dismutation reaction that produces molecular O2 and H2O directly (2) (Whittenbury 1964). In the presence of Fe2+, however, H2O2 can generate the most reactive and deleterious of the ROS, • OH, by the nonenzymatic
Appl Microbiol Biotechnol
Fenton reaction (3; Halliwell and Gutteridge 1986). Hence, H2O2 removal is of the utmost importance for cell survival. SOD
þ 2 O•− 2 þ 2 H → H2 O2 þ O2 KAT
ð1Þ
2 H2 O2 → 2 H2 O þ O2
ð2Þ
2 H2 O2 þ Fe2þ →• OH þ HO− þ Fe3þ
ð3Þ
O2 þ NADðPÞH þ Hþ → H2 O2 þ NADðPÞþ
ð4Þ
NOXs
þ Hþ
NOXs;Ahp;TR
→
H2O
Bifidobacteria are obligate anaerobic bacteria, and their application in foods, particularly dairy products, is hindered by their high sensitivity to the oxidative stress encountered during processing (Boylston et al. 2004). Genome sequencing reveals that neither SOD nor KAT homologs are present in bifidobacteria. NADH oxidase (NOX), alkyl hydroperoxide reductase (Ahp), and thioredoxin reductase (TR) are suggested to be the major enzymes involved in the proposed NAD(P)H-dependent H 2 O 2 -scavenging pathway in bifidobacteria (4) (Schell et al. 2002; Xiao et al. 2011). One exception to this is Bifidobacterium asteroides, which contains an oxygen-inducible heme-KAT that enables its growth in 20 % O2 (Hayashi et al. 2013). Integration of exogenous KAT has also been shown to markedly improve Bifidobacterium longum’s tolerance of oxidative stress (He et al. 2012). Therefore, expression of KAT in bifidobacteria can result in H2O2 scavenging and consequent prevention of • OH formation, thereby reducing oxidative stress. However, another major ROS, O2•−, cannot be directly removed, and it inhibits KAT activity (Kono and Fridovich 1982; Shimizu et al. 1984). Coexpression of SOD and KAT in Lactobacillus rhamnosus enabled the growth of a facultative anaerobic lactic acid bacterial recombinant strain under higher oxidative-stress conditions than the strain expressing only KAT (An et al. 2011). In this study, we coexpressed a heme-dependent KAT gene from Lactobacillus plantarum (LpKatL) and a Mn2+-dependent SOD gene from Streptococcus thermophilus (StSodA) in B. longum strain NCC2705 to investigate the NAD(P)H-independent ROS-scavenging pathway and its functional contribution to the oxidative-stress response. The recombinant strains producing LpKatL and StSodA showed markedly reduced levels of peroxides and significantly less damage to DNA and RNA, resulting in higher survival rates compared to control strains. To the best of our knowledge, this is the first report of the establishment of a metabolic route comprising the heterogeneous heme-dependent KAT gene and Mn2+-dependent SOD gene in B. longum.
Materials and methods Bacterial strains, plasmids, and growth conditions The bacterial strains and plasmids used in this study are listed in Table 1. Bifidobacteria strains were generally grown at 37 °C in de Man, Rogosa, and Sharpe (MRS) broth supplemented with 0.05 % (w/v) L-cysteine HCl (MRSc) under 80 % N2–10 % H2–10 % CO2 unless otherwise noted. Escherichia coli strains were grown at 37 °C in Luria-Bertani (LB) medium with shaking at 200 rpm. Antibiotics (Sigma-Aldrich) were used at the following concentrations: 100 μg/ml ampicillin and 100 μg/ml spectinomycin for E. coli and 100 μg/ml spectinomycin for bifidobacteria. DNA manipulation and transformation rTaq DNA polymerase, restriction endonuclease, pMD19-T simple vector, and T4 DNA ligase used in vector construction were purchased from Takara (Dalian, China). The genes LpKatL and StSodA were PCR-amplified from L. plantarum strain NL42 and S. thermophilus strain XJ41 chromosomal DNA, respectively, using the gene-specific primers listed in Table 2. The PCR products were purified and cloned into vector pMD19-T simple; successful cloning was confirmed by nucleotide sequencing. To construct the LpKatL- and StSodA-expressing vector, a Pgap-IL10-Thup fragment was amplified using the bifidobacteria expression vector pESH93 (kindly provided by Dr. Andrei Nikolaevich Shkoporov, Russian State Medical University, Russian Federation) and two primers: Pgap-F and Pgap-R (Table 2). The PCR products were purified and cloned into the pMD19-T simple vector, generating plasmid pMD19-PIT. A synthetic double-stranded linker (NH-linker-F and NH-linker-R, Table 2) was cloned into the NcoI and HindIII sites of pMD19-PIT, generating plasmid pMD19-PmcsT with multiple cloning sites ClaI, KpnI, and XbaI. LpKatL was inserted into pMD19-PmcsT via NcoI and ClaI, generating pMD19-pKat. StSodA was inserted into pMD19-PmcsT via NcoI and XbaI, generating pMD19-pSod. The expression vectors pDP401-LpKatL and pDP401-StSodA were constructed by cloning the AccI–XhoI fragment of pMD19-pKat and pMD19-pSod in the vector pDP870 (kindly provided by Dr. D. Pridmore, Nestlé Research Center, Lausanne, Switzerland) digested with the same enzymes. To construct the coexpression vector, StSodA was inserted into pDP401-LpKatL behind LpKatL via ClaI and XbaI, generating pDP401-Kat-Sod. The coexpression vector pDP-Kat-Sod was constructed by inserting a Phup promoter, cloned from the genome of B. longum strain NCC2705, into pDP401-Kat-Sod behind LpKatL via ClaI; StSodA was under the control of Phup. Phup promoter orientation was confirmed by nucleotide sequencing.
Appl Microbiol Biotechnol Table 1 Bacterial strains and plasmids used in this study Strains and plasmids
Description
Sources or references
Strains Escherichia coli DH5a
φ80dlacZΔM15 Δ(lacZY-argF)U169 deoR recA1 endA1 hsdR17(rK−mK+) sup E44 thi-1 gyrA96 relA1 Lactobacillus plantarum NL42 Wild-type, isolated from cheese Streptococcus thermophilus XJ41 Wild-type, isolated from yogurt Bifidobacterium longum NCC2705 Isolated from adult human feces Plasmids pMD19-T simple 2.7-kb E. coli cloning vector, Ampr pESH93 7.5-kb E. coli-Bifidobacterium shuttle expression vector, Bifidobacterium longum gap gene promoter and hup gene terminator, Bifidobacterium breve Sec2 protein signal peptide coding region, human IL-10 encoding gene; Emr, Ampr pDP870 4.3-kb E. coli-B. longum shuttle cloning vector, Spr pMD19-LpKatL 4.2-kb pMD19-T simple derivate, containing a LpKatL gene from Lactobacillus plantarum NL42 pMD19-StSodA 3.3-kb pMD19-T simple derivate, containing a StSodA gene from Streptococcus thermophilus XJ41 pMD19-PIT 3.7-kb pMD19-T simple derivate, containing a 1.0-kb expression cassette DNA fragment amplified from pESH93 pMD19-PmcsT 3.1-kb pMD19-PIT derivate, a linker containing a multiple cloning site was substituted for Bifidobacterium breve Sec2 protein signal peptide-coding region and human IL-10-encoding gene pDP401 4.6-kb pDP870 derivate, containing PmcsT DNA fragment from pMD19-PmcsT pDP401-LpKatL 6.0-kb pDP870 derivate, containing Pgap-Kat-Thup expression cassette pDP401-StSodA 5.2-kb pDP870 derivate, contain Pgap-Sod-Thup expression cassette pDP401-Kat-Sod 6.7-kb pDP870 derivate, contain Pgap-Kat-Sod-Thup expression cassette pDP-Kat-Sod 6.9-kb pDP401-Kat-Sod derivate, insert Phup in front of StSodA gene
Transgene, Beijing, China This work This work Schell et al. 2002 Takara, Dalian, China Khokhlova et al. 2010
Klijn et al. 2006 This work This work This work This work
This work This work This work This work This work
Strains Lactobacillus plantarum NL42 and Streptococcus thermophilus XJ41 have been deposited in the China General Microbiological Culture Collection Center (CGMCC) collection (WDCM550), with the collection number of 8845 and 8846, respectively. Bifidobacterium longum NCC2705 was deposited in Nantes Culture Collection (WDCM 856)
All of these vectors were constructed in E. coli strain DH5α (Biomed, China). The resulting expression plasmids pDP401-LpKatL, pDP401-StSodA, and pDP-Kat-Sod were transformed into B. longum strain NCC2705 as described previously (Klijn et al. 2006). The empty vector pDP401, constructed by cloning the AccI–XhoI fragment of pMD19PmcsT in the vector pDP870, was used as a control. Transformants were confirmed by colony PCR and plasmid DNA extraction. Recombinant Bifidobacterium strains expressing KAT and SOD were detected by electrophoresis on a 15 % polyacrylamide gel. Total DNA isolation from recombinant Bifidobacterium and control strains for DNA damage analysis was according to Zuo et al. (2013). RNA isolation and semi-quantitative reverse transcription-polymerase chain reaction
spectrophotometry at 260 nm. The absence of residual DNA in the DNase I-digested total RNA was confirmed by PCR. Reverse transcription was carried out using M-MLV Reverse Transcriptase (Promega) in a 20-μl reaction volume containing 150 ng of random primers and 1 mM dNTP mix (Tiangen, China). Primers were designed with Primer Premier 5 software to amplify 100- to 250-bp regions of the chosen genes for semi-quantitative reverse transcription-polymerase chain reaction (sqRT-PCR) (Table 2). Relative expression values for three biological replicates were normalized to the expression values of an endogenous internal 16S ribosomal RNA control of B. longum strain NCC2705. The PCR products were resolved by electrophoresis in 2 % agarose gels which were then stained with ethidium bromide and analyzed with Quantity One software (Bio-Rad). Enzymatic activity assays
Total RNA from B. longum strains in the exponential growth phase (OD600nm =0.6) was isolated using TRIzol Reagent (Invitrogen) and then treated with RNase-free DNase I (Takara). RNA concentrations were determined by
B. longum strain NCC2705 and its transformants were grown in MRS medium supplemented with 10 μM hematin (Sigma-Aldrich) (He et al. 2012). Exponential-phase cells
Appl Microbiol Biotechnol Table 2 Oligonucleotides primers used in this study Oligonucleotides
Sequence, 5′→3′a
Restriction sites
Purpose
Pgap-F Pgap-R Kat-F1 Kat-R1 Sod-F1 Sod-F2 Sod-R1 NH-linker-F NH-linker-R BLr01-F BLr01-R Kat-rt-F1 Kat-rt-R1 Sod-rt-F1 Sod-rt-R1
CGTCTACCTGATGATTCGAGACATT GCTCGAGCTGAACTAGTCCGGAAT CCATGGAAATGACGGAAAAATTAACGACGGAAACCGGCCATCCGT CATCGATTTAATCACTGATAATATCAGCAAT CATCGATATGGCTATTATTCTTCCAGAT ACCATGGCTATTATTCTTCCAGAT TTTCTAGATTATTTAGCTTCTGCGTAAAG CATGGACGCGACTAGTATCGATGGTACCAGATCTAGA AGCTTCTAGATCTGGTACCATCGATACTAGTCGCGTC TCCTACGGGAGGCAGCAGT CCGCCTACGAGCCCTTTAC TGGGGGAATATACTAAGGCA CAGGAAATTTTAAAGGGTCG GCACTTTTCTGGGAACTTT GATTGGTTTTTTACCGTCTG
AccI XhoI NcoI ClaI ClaI NcoI XbaI ClaI, XbaI XbaI, ClaI – – – – – –
Vector construction Vector construction Vector constructionb Vector constructionb Vector constructionc Vector constructionc Vector constructionc Vector construction Vector construction RT-PCR RT-PCR RT-PCRb RT-PCRb RT-PCRc RT-PCRc
a
The added restriction enzyme sites are underlined
b
Primer designed for gene cloning according to GenBank accession no. AY375759.1 (Lactobacillus plantarum CNRZ 1228)
c
Primer designed for gene cloning according to GenBank accession no. AF538722.2 (Streptococcus thermophilus AO54)
(OD600nm =0.6) were used for enzymatic activity assay. KAT activity was examined by detecting bubble formation upon addition of 10 % H2O2 to the cell pellet. Quantitative activity was determined by a previously described assay (Sinha 1972; An et al. 2011). The pyrogallol autoxidation method was used to determine SOD activity (Marklund and Marklund 1974). Cell-free extract of each sample was prepared by ultrasonic treatment according to Xiao et al. (2011), and protein concentrations were determined by Bradford protein assay (Bradford 1976).
This assay was also used to measure the peroxides generated when control and recombinant B. longum NCC2705 strains were exposed to atmospheric oxygen. MRS-cultured cells (50 ml) in the exponential phase were transferred to a 200-ml Erlenmeyer flask and grown under aerobic conditions with shaking at 200 rpm. Peroxide concentration in the culture supernatant was determined at different intervals.
Quantification of peroxide levels in B. longum cell suspensions
The control and recombinant strains of B. longum NCC2705 were grown in MRS broth supplemented with 10 μM hematin. An aliquot of exponential-phase cells was treated with 2.5 mM H2O2 for 1 h or 10 mM methyl viologen (MV) for 6 h at 37 °C (MV treatment was under aerobic conditions). Then, H2O2 or MV was quickly removed by washing two times with 0.85 % (w/v) NaCl solution, and viable cells were counted by plating appropriate dilutions on MRS agar after 36–48 h in anaerobic culture at 37 °C. Cultures that were not treated with oxidizing agent were used as a reference to calculate survival rate. Presented values are the averages of three independent experiments. To investigate the oxygen-stress tolerance of B. longum strain NCC2705 and its transformants, cultures (50 ml each) were anaerobically grown in MRS medium supplemented with 10 μM hematin to the stationary phase (OD600 =2.0– 2.5). The cultures were transferred to a 200-ml Erlenmeyer flask sealed with a sterile porous sealing membrane. Oxygen-
The control and recombinant strains of B. longum NCC2705 were grown in MRS broth supplemented with 10 μM hematin under anaerobic conditions to the exponential phase. Exogenous H2O2 was added to a final concentration of 1 mM. Residual H2O2 concentration was determined at different intervals by ammonium ferrous sulfate/xylenol orange (FOX) colorimetric assay as described previously (Wolff 1994; Shea and Mulks 2002). Briefly, 500 μl of the culture was pelleted and 100 μl of cell-free supernatant was added to 400 μl of 25 mM sulfuric acid in a 1-ml cuvette. Then, 500 μl freshly prepared reaction buffer (containing 200 μM ammonium ferrous sulfate, 200 μM xylenol orange, and 25 mM sulfuric acid) was added to the mixture. During 30 min of incubation at room temperature, absorbance was read at 560 nm.
Determination of oxidative-stress tolerance
Appl Microbiol Biotechnol
LpKatL and StSodA genes from L. plantarum NL42 and S. thermophilus XJ41, respectively, were cloned with the gene-specific PCR primers (Table 2) (GenBank Accession numbers: KJ463409 and KJ463410, respectively), and sequence BLAST analysis showed 99 and 100 % identity with their respective registered homologs. The obtained LpKatL encoded a protein of 484 amino acids with a calculated molecular mass of 55.4 kDa, and a domain specific for hemeKAT was confirmed, similar to homologous genes in many other strains of Lactobacillus (Abriouel et al. 2004). The cloned StSodA encoded a protein of 201 amino acids with a calculated molecular mass of 22.6 kDa, belonging to the iron/manganese-SOD family. The expression cassettes of LpKatL and StSodA and serial recombinant plasmids based on pDP870 were constructed (Fig. 1) and then introduced into B. longum strain NCC2705. The control strain B. longum NCC2705/pDP401, LpKatL-expressing strain B. longum NCC2705/pDP401-LpKatL, StSodA-expressing strain B. longum NCC2705/pDP401-StSodA, and LpKatL– StSodA-coexpressing strain B. longum NCC2705/pDP-Kat-
Sod were obtained by electroporation. Heterologous expression of LpKatL and StSodA was confirmed by sqRT-PCR (Fig. 2a) with the specific sqRT-PCR primers (Table 2). The LpKatL transcript was detected in RNA isolated from B. longum NCC2705/pDP401-LpKatL and NCC2705/pDPKat-Sod cells, but not from B. longum NCC2705/pDP401 or NCC2705/pDP401-StSodA (Fig. 2a). Similarly, the StSodA transcript was detected in RNA isolated from B. longum NCC2705/pDP401-StSodA and NCC2705/pDP-Kat-Sod cells, but not from B. longum NCC2705/pDP401 or NCC2705/pDP401-LpKatL (Fig. 2a). StSodA transcript was 2.5-fold more abundant in B. longum NCC2705/pDP-Kat-Sod than in NCC2705/pDP401-StSodA (Fig. 2a). A protein band of 23.2 kDa, slightly larger than the predicted StSodA molecular mass of 22.6 kDa, was found upon SDS-PAGE of the NCC2705/pDP-Kat-Sod strain’s total proteins (Fig. 2b), whereas in the other expression cassette structures, no such new band was observed. In the lanes with LpKatL and the LpKatL-StSodA strain, a faint band presumed to match KAT appeared at around 55 kDa (Fig. 2b). KAT expression was biochemically supported by the heme-dependent KAT activity in the recombinant strains measured by O2 formation upon addition of H2O2 and hematin (Fig. 2c). As shown in Fig. 2c, heme-KAT activity was observed in both B. longum NCC2705/pDP401-LpKatL and NCC2705/pDP-Kat-Sod, but not in B. longum NCC2705/pDP401 or NCC2705/pDPStSodA. Table 3 lists the specific activities from hemedependent KAT and Mn2+-SOD assays in cell-free extracts of B. longum NCC2705/pDP401-LpKatL and NCC2705/ pDP-Kat-Sod. The highest KAT activity was 3,633 U/mg protein in the presence of Mn2+-SOD in the NCC2705/pDP-
Fig. 1 Structural map of vectors pDP401, pDP401-LpKatL, pDP401StSodA, and pDP-Kat-Sod. Spec, spectinomycin-resistance gene; Pgap, B. longum gap (encoding glyceraldehyde 3-phosphate dehydrogenase)
promoter; Phup, B. longum hup (encoding histone-like protein HU) promoter; Thup, hup terminator; pMB1, encoding pMB1 replication protein
stress tolerance of B. longum was investigated by monitoring survival at 0, 3, and 6 h with shaking at 200 rpm at 37 °C. The StSodA and LpKatL gene sequences have been deposited in GenBank with accession numbers KJ463409 and KJ463410, respectively.
Results Expression of LpKat and StSod in B. longum strain NCC2705
Appl Microbiol Biotechnol
Fig. 2 Molecular and biochemical assays of B. longum NCC2705 transformants. a Level of LpKatL and StSodA mRNA expression detected by sqRT-PCR. b SDS-PAGE of whole-cell extract of B. longum NCC2705 pDP401 (control), pDP401-StSodA (StSodA), pDP401LpKatL (LpKatL), and pDP-Kat-Sod (Kat-Sod, LpKatL, and StSodA)
grown in MRSc medium. Marker, 12 to 100 kDa molecular weight marker. c KAT activity assay of B. longum NCC2705 strains pDP401 (control), pDP401-StSodA (StSodA), pDP401-LpKatL (LpKatL), and pDP-Kat-Sod (Kat-Sod, LpKatL, and StSodA) with or without addition of 10 μM hematin
Kat-Sod strain, 2.4-fold that of the transformant with LpKatL alone. The elevated Mn2+-SOD activity in this strain, which was 1.3-fold that of the strain expressing StSodA alone
(Table 3), may be due to the stronger promoter of the hup cistron, as a very clear band was seen on the SDSpolyacrylamide gel (Fig. 2b). These results confirmed effective functional integration of active heme-dependent KAT and Mn 2+ -dependent SOD in the respective recombinant B. longum NCC2705 strains, as well as a synergistic interaction between the two enzymes.
Table 3 Enzyme activity in the cell-free extracts of B. longum NCC2705 and its recombinant strains Strains
pDP401 pDP401-StSodA pDP401-LpKatL pDP-Kat-Sod
Activities (U/mg crude protein) Superoxide dismutase (SOD)
Catalase (KAT)
N.D. 59.9±10.9 N.D. 78.4±3.2
N.D. N.D. 1,487.8±245.3 3,633.2±307.5
N.D. not detected (less than 0.1 U/mg crude protein)
Expression of LpKat and StSod alleviates oxidative stress The abilities of recombinant B. longum NCC2705 strains to scavenge exogenous H2O2 were determined by FOX assay. As shown in Fig. 3a, B. longum NCC2705 expressing LpKatL rapidly scavenged H2O2; 1 mM H2O2 was detoxified within 15 min by B. longum NCC2705/pDP401-LpKatL and
Appl Microbiol Biotechnol
Fig. 3 Ability of recombinant B. longum NCC2705 strains to degrade exogenous H2O2 (a) and endogenous peroxides generated by aerobic metabolism (b). The experiments were performed at least twice, and the average values are shown with calculated standard deviation. Asterisks indicate a statistically significant difference (*P
