Transboundary and Emerging Diseases
ORIGINAL ARTICLE
Coinfection of Sheep with Anaplasma, Theileria and Babesia Species in the Kurdistan Region, Iraq S. Renneker1,*, J. Abdo2,*, M.A. Bakheit1, B. Kullmann1, D. Beyer1, J. Ahmed1 and U. Seitzer1 1 2
Division of Veterinary Infection Biology and Immunology, Research Center Borstel, Borstel, Germany Duhok Research Center (DRC), Aj Duhok, Iraq
Keywords: coinfection; sheep; Iraq; Anaplasma; Babesia; Theileria Correspondence: J. Ahmed. Division of Veterinary Infection Biology and Immunology, Research Center Borstel, Borstel, Germany. Tel.: +4945371884280; Fax: +4945371886270; E-mail: [email protected] *Authors contributed equally.
Received for publication November 15, 2012 doi:10.1111/tbed.12148
Summary Infections of small ruminants with Anaplasma, Theileria and Babesia species are widely distributed in the old world and are of great economic impact. In Iraq, data on disease occurrence in sheep caused by above-mentioned infectious agents are scarce. This study provides information on various haemoparasitic agents infecting sheep in the Kurdistan Region, Iraq, using molecular diagnostic tools. Altogether, 195 samples originating from three governorates in the Kurdistan Region, namely Duhok, Erbil and Sulaimaniya, were analysed. The following pathogens were identified: Anaplasma ovis (62.6%), Theileria ovis (14.35%), T. lestoquardi (7.7%), T. uilenbergi (5.6%) and Babesia ovis (1.5%). T. uilenbergi is detected for the first time in Iraq. Coinfection of sheep with different pathogens could be observed in this study, and it was found that 45 of 195 (23%) of the samples contained more than one pathogen. Even triple-positive samples were identified in 3% of the investigated animals. In conclusion, we confirm the coinfection of sheep with various haemoparasitic pathogen species in the Kurdistan Region of Iraq. Further investigations are needed to reveal the epidemiology of the diseases, the respective tick vectors, and, in the case of coinfection, pathogens′ interaction and possible cross-protection.
Introduction Iraq has a huge population of small ruminants estimated at 9.3 million heads in 2010, representing 0.5% of the world’s population. These animals produce considerable amounts of milk, meat, wool and skin (FAOSTAT, 2012). Livestock diseases hamper the supply of local people with the above-mentioned products. Ticks and tick-borne haemoparasitic diseases such as theileriosis, babesiosis and anaplasmosis constitute a major challenge for livestock health and production in Iraq including the Kurdistan region (Khayyat and Gilder, 1947; Alsaad et al., 2009; Naqid and Zangana, 2011). The affected animals are usually subclinically diseased so that reduction in fertility and production are often the only hints for the above-mentioned diseases. Although economic losses caused by haemoparasitic diseases are known to be worldwide high (Hooshmand-Rad and Hawa, 1973; Perry and Randolph, 1999), recent data are scarce regarding
the Kurdistan Region (Zangana and Naqid, 2011). Personal communication with local veterinarians indicated problems with the above-mentioned diseases especially as huge movements of small ruminants from the South to the North were undertaken in the recent past, which might enhance the risk of disease outbreaks among these animals and their further spread in the Kurdistan region (Murad, 2011). For example, the risk of infection of animals with T. lestoquardi in the North is now greater because infections with this parasite were confined to the Southern part of the country (Latif et al., 1977). Earlier studies indicated that the clinical signs are more severe if an animal is coinfected with Anaplasma and piroplasms (Khayyat and Gilder, 1947). The aim of this study was to monitor small ruminants for tick-borne haemoparasitic diseases such as theileriosis, babesiosis and anaplasmosis and to determine the rate of coinfections in animals under study using molecular epidemiological tools in sheep in the Kurdistan Region.
© 2013 Blackwell Verlag GmbH • Transboundary and Emerging Diseases. 60 (Suppl. 2) (2013) 113–118
113
Coinfection of Sheep with Anaplasma, Theileria and Babesia Species
Material and Methods Collection of samples and DNA extraction A total of 195 samples were collected from sheep in Kurdistan Region of Iraq, from three governorates, namely Duhok, Erbil and Sulaimaniya. Of these, 78 samples were collected in the field, and 117 samples were obtained from animals brought to abattoirs within the governorates. Blood was collected into K-EDTA tubes, and DNA was extracted using the DNeasyâ Blood and Tissue kit (Qiagen, Hilden, Germany) following the manufacturers′ instructions. Purified DNA was then eluted from the mini spin column using double-distilled water at a temperature of 60°C. DNA concentration was assessed by photometry. Molecular detection methods PCR For the detection of T. lestoquardi and B. ovis, primer sequences and cycling protocols were adapted from Bakheit et al. (2006) and Aktas et al. (2005). For the detection of A. ovis, the protocol of de la Fuente et al. (2002) was used. PCR was performed in a final reaction volume of 33 ll that contained 3.5 ll 109 reaction buffer, 7 ll 59 enhancer solution, 0.7 ll of a 10 mM dNTPs mix (200 lM final concentration of each dNTP), 1.6 ll of each primer having a concentration of 10 lM (0.46 lM final concentration of each primer) and 0.175 ll of 5 U/ll Taq polymerase (0.025 U/ll final concentration) (PEQLAB Biotechnologie GmbH, Erlangen, Germany). DNA (2 ll) was then added. The PCR profile was conducted in an automated thermal cycler (Biometra, G€ ottingen, Germany) and consisted of an initial denaturing step of 3 min at 94°C followed by 35 cycles of denaturing, annealing and extension. Final extension was performed for 5 min at 72°C. PCR products were electrophoresed on a 1.5% agarose gel containing ethidium bromide for visualization under UV light. Reverse-line blotting (RLB) Reverse-line blotting was performed according to Gubbels et al. (1999) and Schnittger et al. (2004). Probes used for the detection of A. ovis and Ehrlichia ovis were 5′ATGTGAGGATTTTATCTTTGTA and 5′–GGCTTTTGCC TCTGTGT, respectively. For Theileria and Babesia species of small ruminants, the probes were similar to those in Schnittger et al. (2004). The primers RLB-F (5′-GAGGTAGTGACAAGAAATAACAATA-3′) and RLB-R (biotin5′-TCTTCGATCCCCTAACTTTC-3′) were used to amplify the hyper variable region 4 of the Babesia and Theileria 18 S RNA gene, while the primers A.o.-rDNA-680s (biotin-5′TCCGGTACTGACGCTGAGGTG) and A.o.-rDNA-1220as (5′–AACTGAGACGACTTTTACGGATTA) were used to amplify the bacterial 16 S hyper variable region. PCR 114
S. Renneker et al.
reaction was performed in 50-ll final volumes. Program for PCR was as follows: 3 min at 94°C initial denaturation, then 40 cycles of 1 min at 94°C, 90 s at 55°C and 90 s at 72°C, then a final extension step of 72°C for 5 min. Further hybridization steps and analysis of RLB results were performed according to Schnittger et al. (2004). Cloning and sequencing The PCR products of three samples (no. 16, 32 and 34) were cloned for subsequent sequence analysis to confirm co-presence of Anaplasma ovis and T. uilenbergi. Furthermore, PCR products of randomly selected samples positive for T. lestoquardi (no. 21, 36, 41 and 42) and Babesia ovis (no. 24) were cloned and sequenced. Briefly, the amplified PCR DNA band was excised and purified from the 1.5% agarose gel using QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany), cloned into the pDrive vector (Qiagen, Hilden, Germany) and transformed into E. coli cells. After growing overnight at 37°C, three selected clones of each sample were subjected to sequencing (Eurofins MWG Operon, Ebersberg, Germany) and analysed afterwards using Lasergene 5.0 (DNASTAR, Madison, WI, USA). Results Using RLB (Fig. 1), 122 of the 195 (62.6%) samples were found positive for Anaplasma ovis, 28 (14.35%) positive for T. ovis and 11 (5.6%) positive for T. uilenbergi (Table 1). This is the first description of T. uilenbergi in Iraq. This was confirmed by sequencing of three samples (Fig. 2). The obtained sequence of the T. uilenbergi 18S ribosomal RNA gene was deposited in GenBankâ under the accession KC778790. Theileria lestoquardi and Babesia ovis were not detected by RLB, but the distribution of transmitting ticks suggested the possibility of the presence of these two pathogens in Kurdistan Region (Hoogstraal and Kaiser, 1958; Robson et al., 1968; Hooshmand-Rad and Hawa, 1973; Friedhoff, 1997). Indeed, the possible occurrence of T. lestoquardi and Babesia ovis in this part of the country was suggested by many authors (Khayyat and Gilder, 1947; Hooshmand-Rad Table 1. By RLB and PCR detected pathogens of the 195 sheep DNA samples from Northern Iraq Detected pathogen
RLB
PCR
Anaplasma ovis
122/195 (62.6%)
130/195 (66.6%), Renneker et al. (2013)
Theileria ovis Theileria uilenbergi Theileria lestoquardi Babesia ovis
28/195 (14.35%) 11/195 (5.6%) Not detected Not detected
15/195 (7.7%) 3/195 (1.5%)
© 2013 Blackwell Verlag GmbH • Transboundary and Emerging Diseases. 60 (Suppl. 2) (2013) 113–118
S. Renneker et al.
Coinfection of Sheep with Anaplasma, Theileria and Babesia Species
Fig. 1. Reverse-line blotting of 40 samples against probes detecting various pathogens of small ruminants. Coinfection can be observed in several samples.
Fig. 2. Parts of sequencing results of cloned Theileria uilenbergi positive samples no. 16, 32 and 34. Clones no. 16.1, 32.1, 32.2 and 34.2 were 100% identical to the five published sequences available in the NCBI database (accession no. AY262116.1, JF719835.1, AY262120.1, AY262121.1, AY262122.1, AY262123.1).
and Hawa, 1973; Sulaiman et al., 2009). Using pathogenspecific PCRs, positive results for T. lestoquardi could be observed in 7.7% (15/195) of the samples. Regarding Babesia ovis, three of the 195 samples showed a positive result (1.5%) (Table 1). In a further step, sequence analysis of four randomly picked samples positive for T. lestoquardi (samples no. 21, 36, 41 and 42) and one sample positive for B. ovis (sample no. 24) was performed to confirm the PCR results. These sequences for the 18S ribosomal RNA genes of the respective pathogens can be found under the accession
numbers KC778785, KC778786 and KC778787 at GenBankâ. The per cent identity of all ten sequenced clones of T. lestoquardi in comparison with the published sequences in the GenBankâ database (accession no. AF081135.1 and JQ917458.1) was between 99 and 100% (data not shown). More importantly, coinfection of sheep with piroplasms and Anaplasma could be confirmed in this study. Five samples were triple positive for T. ovis, T. uilenbergi and Anaplasma ovis (2.56%), and one sample was triple positive for T. ovis, Anaplasma ovis and Babesia ovis (0.5%). Eleven
© 2013 Blackwell Verlag GmbH • Transboundary and Emerging Diseases. 60 (Suppl. 2) (2013) 113–118
115
Coinfection of Sheep with Anaplasma, Theileria and Babesia Species
samples were double positive for T. uilenbergi and Anaplasma ovis (5.6%), and 24 samples were double positive for T. ovis and Anaplasma ovis (12.3%). Three samples were positive for T. lestoquardi as well as Anaplasma ovis (1.5%), and one sample showed coinfection with Anaplasma ovis and Babesia ovis (0.5%) (Table 2). The sequences of the 16S rRNA of A. ovis are available at GenBankâ under the accession numbers KC778788 and KC778789, respectively. Discussion and Conclusion Theileria species, Anaplasma ovis and Babesia ovis could be detected in samples collected from the Kurdistan region of Iraq. Altogether, 135 of 195 (69.2%) animals were infected with at least one pathogen. Anaplasma ovis was the most prevalent in these samples (62.6%), which is indeed higher than previously published on this region (Muslih et al., 1981; Yousif et al., 1983; Naqid and Zangana, 2011). The reason for this difference might be the detection tools used, as these authors used Giemsa-stained blood smears to identify the parasites microscopically, while our study was performed using PCR-based techniques. It has been shown in several studies that molecular approaches are much more sensitive than microscopical examination (Schnittger et al., 2004). Our data fit well to the observations of Omer et al. (2007) who investigated ticks collected from sheep and goats in Kurdistan region and found that 90% of these ticks were Rhipicephalus bursa. This species is a known vector for A. ovis (Friedhoff, 1997). Given these data, the socio-economic relevance of A. ovis should be reconsidered taking into account other stress factors such as coinfection, poor health conditions, hot weather, vaccination, deworming or heavy tick infestation. (Khayyat and Gilder, 1947; Manickam, 1987). Currently, information on the distribution of Babesia ovis is scarce, albeit the presence vector ticks for B. ovis such as Rhipicephalus species (Sulaiman et al., 2009) and Hyalomma excavatum (Friedhoff, 1997). In a study carried out in Mosul in 2009 (Sulaiman et al., 2009), 15.42% of investigated goats were found positive for Babesia sp. Table 2. Coinfection rates observed in the 195 investigated samples from Northern Iraq
S. Renneker et al.
including B. ovis, B. motasi, B. foliata and B. taylori. However, the exact percentage for B. ovis among the examined samples has not been determined. On the other hand, Zangana and Naqid (2011) could not find B. ovis in the 500 samples they investigated by Giemsa staining, which suggests that the parasite is currently not frequent in the Kurdistan Region. This finding could be confirmed by our study as only 1.5% of the samples tested were positive. Considering the high pathogenicity of B. ovis in sheep (Sulaiman et al., 2009) and its frequent occurrence in Iraq (Friedhoff, 1997), there is a need for a more systematic study including north and south of the country. This study described the presence of T. uilenbergi in Iraq for the first time, suggesting a wider area of distribution of this pathogen than previously assumed. Until now, T. uilenbergi has been detected within China and is considered to be highly pathogenic (Schnittger et al., 2000, 2003; Yin et al., 2004). A variant of T. uilenbergi bearing 99.6% identity has been previously reported in Spain but was described as non-pathogenic (Nagore et al., 2004). The transmitting ticks Haemaphysalis qinghaiensis and H. longicornis have not been detected in Iraq. Future studies should focus on the distribution of the parasite and the identification of its field vector ticks. Theileria lestoquardi is known to be present in Iraq. Using IFAT, Latif et al. (1977) could demonstrate a lower rate of infection (7.3%) in the North than in the South (41.3%). In another study, 33.8% of goats were serologically positive to T. lestoquardi in Baghdad region (Al-Amerey and Hasso, 2002). In our study, we examined samples collected from sheep from the Kurdistan Region with an overall prevalence of 7.7%. This indicates that despite large movements of sheep from South to North in the recent past (Murad, 2011), no obvious changes occurred regarding the infection rate of sheep with T. lestoquardi. On the other hand, Zangana and Naqid (2011) found 20.8% goat sera to be positive for T. lestoquardi in Duhok governorate. This is surprising because T. lestoquardi is more pathogenic to sheep than goats. The phenomenon of multiple infections of animals represents an issue, which has been so far rarely investigated. The first description of coinfection of small ruminants in Iraq was carried out by Khayyat and Gilder as early as 1947, but to the best of our knowledge, no further studies have been carried out. In this study, coinfection of sheep with different pathogens could be found. Altogether, 45 of 195 (23%) sheep were infected with more than one pathogen, a fact which increases the health problems of the animals, and thus, the loss of products as described by Khayyat and Gilder (1947). Even triple positives could be recorded in 6 of 195 samples (3%), which indicates that superinfection by other hemoparasitic species occurs and absence of crossprotection between these species. Further studies should
Coinfection with
No. of positive samples (%)
Anaplasma ovis, Theileria ovis and Theileria uilenbergi Anaplasma ovis, Theileria ovis and Babesia ovis Anaplasma ovis and Theileria uilenbergi Anaplasma ovis and Theileria ovis Anaplasma ovis and Babesia ovis Anaplasma ovis and Theileria lestoquardi
5 (2.56) 1 (0.5) 11 (5.6) 24 (12.3) 1 (0.5) 3 (1.5)
116
© 2013 Blackwell Verlag GmbH • Transboundary and Emerging Diseases. 60 (Suppl. 2) (2013) 113–118
S. Renneker et al.
include more detailed picture about the effect of multiple infections. Additionally, questing ticks should be investigated as to whether they are infected with more than one pathogen and their ability to transmit more than one pathogen at the same time. In conclusion, Theileria, Anaplasma and Babesia species are present in sheep in the Kurdistan Region, and the demonstrated high infection rate suggests that ticks and tickborne diseases have considerable impact on the animals′ productivity (Hooshmand-Rad and Hawa, 1973; Perry and Randolph, 1999). Conflicts of interest The authors declare no conflicts of interest in relation to this work. References Aktas, M., K. Altay, and N. Dumanli, 2005: Development of a polymerase chain reaction method for diagnosis of Babesia ovis infection in sheep and goats. Vet. Parasitol. 133, 277– 281. Al-Amerey, M. A. Y., and S. A. Hasso, 2002: Epizootiological Survey of some blood and fecal parasitic protozoa of goats around Baghdad City. Basrah. J. Vet. Res. 1, 41–48. Alsaad, K. M., Q. T. Al-obaidi, and S. A. Esmaeel, 2009: Hematological and biochemical study on the effect of some common blood parasites in native goats in Mosul area. Iraq. J. Vet. Sci. 23, 101–106. Bakheit, M. A., E. Endl, J. S. Ahmed, and U. Seitzer, 2006: Purification of Macroschizonts of a Sudanese Isolate of Theileria lestoquardi (T. lestoquardi [Atbara]). Ann. N.Y. Acad. Sci. 1081, 453–462. FAOSTAT (2012). © FAO Statistics Division 2012. Available at http://faostat3.fao.org/home/index.html#VISUALIZE_BY_DOMAIN (accessed May 15, 2103). Friedhoff, K. T. 1997: Tick-borne diseases of sheep and goats caused by Babesia, Theileria or Anaplasma spp. Parassitologia 39(Suppl 1), 99–109. de la Fuente, J., R. A. Van Den Bussche, J. C. Garcia-Garcia, S. D. Rodrı́ guez, M. A. Garcı́ a, A. A. Guglielmone, A. J. Mangold, L. M. Friche Passos, M. F. Barbosa Ribeiro, E. F. Blouin, and K. M. Kocan, 2002: Phylogeography of New World isolates of Anaplasma marginale based on major surface protein sequences. Vet. Microbiol. 88, 275–285. Gubbels, J. M., A. P. de Vos, M. van der Weide, J. Viseras, L. M. Schouls, E. de Vries, and F. Jongejan, 1999: Simultaneous Detection of Bovine Theileria and Babesia Species by Reverse Line Blot Hybridization. J. Clin. Microbiol. 37, 782–1789. Hoogstraal, H., and M. N. Kaiser, 1958: The ticks (Ixodoidea) of Iraq: keys, Hosts and Distribution. J. Iraq Med. Prof. 6(2–3), 1–22.
Coinfection of Sheep with Anaplasma, Theileria and Babesia Species
Hooshmand-Rad, P., and N. J. Hawa, 1973: Malignant Theileriosis of sheep and goats. Trop. Anim. Hlth. Prod. 5, 97–102. Khayyat, S. M., and A. A. Gilder, 1947: Ovine piroplasmoses in Iraq. Trans. R. Soc. Trop. Med. Hyg. 41, 119–120, IN3, 121126. Latif, B. M. A., N. J. Hawa, and F. A. Bakir, 1977: Incidence of malignant Theileriosis (Theileria hirci) of sheep in Iraq. Iraqi J. Vet. Med. 1, 29–37. Manickam, R. 1987: Epidemiological and clinical observations of acute anaplasmosis in sheep. Indian J Vet Med 7, 159–160. Murad (Elam) T. (2011). Meat consumption in Iraq. Available at http://www.kurdistanfoodsecurity.com/2011/04/meat-consumption-in-iraq.html (accessed May 15, 2013). Muslih, N. J., H. C. Joshi, S. K. Dwivedi, N. J. Ahmad, and R. A. Dimitri, 1981: A preliminary study on the prevalence of anaplasmosis in sheep in Northern Iraq (Mosul). Indian J. vet. Med. 1, 106–112. Nagore, D., J. Garcı́ a-Sanmartı́ n, A. L. Garcı́ a-Perez, R. A. Juste, and A. Hurtado, 2004: Identification, genetic diversity and prevalence of Theileria and Babesia species in a sheep population from Northern Spain. Int. J. Parasitol. 34, 1059– 1067. Naqid, I. A., and I. K. Zangana, 2011: Hematological and serological (cELISA) studies of caprine anaplasmosis in Duhok governorate of Kurdistan region in Iraq. J. Duhok Univ. 13, 153–161 (Agri. And Vet. Sciences). Omer, L. T., M. Abdul-Aziz Kadir, U. Ulrike Seitzer, and J. S. Ahmed, 2007: A survey of ticks (Acari: Ixodidae) on cattle, sheep and goats in the Dohuk Governorate. Iraq. Parasitol. Res. 101(Suppl 2), 179–181. Perry, B. D., and T. F. Randolph, 1999: Improving the assessment of the economic impact of parasitic diseases and of their control in production animals. Vet. Parasitol. 84, 145–168. Renneker, S., J. Abdo, D. A. Salih, T. Karagenc, H. Bilgic, A. Torina, A. G. Oliva, J. Campos, B. Kullmann, J. Ahmed, and U. Seitzer, 2013: Can Anaplasma ovis in small ruminants be neglected any longer? Transbound. Emerg. Dis. 60 (Suppl. 2), 105–112. Robson, J., J. M. Robb, and N. J. Hawa, 1968: Ticks (Ixodidae) of domestic animals in Iraq. Part 4. A comparison of infestations in winter and early summer in the Liwa of Mosul. J. Med. Ent. 5, 261–264. Schnittger, L., H. Yin, L. Jianxun, W. Ludwig, P. Shayan, S. Rahbari, A. Voss-Holtmann, and J. S. Ahmed, 2000: Ribosomal small-subunit RNA gene-sequence analysis of Theileria lestoquardi and a Theileria species highly pathogenic for small ruminants in China. Parasitol. Res. 86, 352–358. Schnittger, L., H. Yin, M. J. Gubbels, D. Beyer, S. Niemann, F. Jongejan, and J. S. Ahmed, 2003: Phylogeny of sheep and goat Theileria and Babesia parasites. Parasitol. Res. 91, 398– 406. Schnittger, L., H. Yin, B. Qi, M. J. Gubbels, D. Beyer, S. Niemann, F. Jongejan, and J. S. Ahmed, 2004: Simultaneous detection and differentiation of Theileria and Babesia parasites
© 2013 Blackwell Verlag GmbH • Transboundary and Emerging Diseases. 60 (Suppl. 2) (2013) 113–118
117
Coinfection of Sheep with Anaplasma, Theileria and Babesia Species
infecting small ruminants by reverse line blotting. Parasitol. Res. 92, 189–196. Sulaiman, E. G., S. H. Arslan, Q. T. Al-Obaidi, and E. Daham, 2009: Clinical, haematological and biochemical studies of babesiosis in native goats in Mosul. Iraq. J. Vet. Sci. 24, 31–35. Yin, H., J. Luo, L. Schnittger, B. Lu, D. Beyer, M. Ma, G. Guan, Q. Bai, C. Lu, and J. Ahmed, 2004: Phylogenetic analysis of Theileria species transmitted by Haemaphysalis qinghaiensis. Parasitol. Res. 92, 36–42.
118
S. Renneker et al.
Yousif, Y. A., R. A. Dimitri, S. K. Dwivedi, and N. J. Ahmed, 1983: Anaemia due to anaplasmosis in Iraqi goats: I. Clinical and haematological features under field conditions. Indian Vet. J. 60, 576–578. Zangana, I. K., and I. A. Naqid, 2011: Prevalence of piroplasmosis (Theileriosis and Babesiosis) among goats in Duhok Governorate. Al-Anbar J. Vet. Sci. 4, 50–57.
© 2013 Blackwell Verlag GmbH • Transboundary and Emerging Diseases. 60 (Suppl. 2) (2013) 113–118
ORIGINAL ARTICLE
Coinfection of Sheep with Anaplasma, Theileria and Babesia Species in the Kurdistan Region, Iraq S. Renneker1,*, J. Abdo2,*, M.A. Bakheit1, B. Kullmann1, D. Beyer1, J. Ahmed1 and U. Seitzer1 1 2
Division of Veterinary Infection Biology and Immunology, Research Center Borstel, Borstel, Germany Duhok Research Center (DRC), Aj Duhok, Iraq
Keywords: coinfection; sheep; Iraq; Anaplasma; Babesia; Theileria Correspondence: J. Ahmed. Division of Veterinary Infection Biology and Immunology, Research Center Borstel, Borstel, Germany. Tel.: +4945371884280; Fax: +4945371886270; E-mail: [email protected] *Authors contributed equally.
Received for publication November 15, 2012 doi:10.1111/tbed.12148
Summary Infections of small ruminants with Anaplasma, Theileria and Babesia species are widely distributed in the old world and are of great economic impact. In Iraq, data on disease occurrence in sheep caused by above-mentioned infectious agents are scarce. This study provides information on various haemoparasitic agents infecting sheep in the Kurdistan Region, Iraq, using molecular diagnostic tools. Altogether, 195 samples originating from three governorates in the Kurdistan Region, namely Duhok, Erbil and Sulaimaniya, were analysed. The following pathogens were identified: Anaplasma ovis (62.6%), Theileria ovis (14.35%), T. lestoquardi (7.7%), T. uilenbergi (5.6%) and Babesia ovis (1.5%). T. uilenbergi is detected for the first time in Iraq. Coinfection of sheep with different pathogens could be observed in this study, and it was found that 45 of 195 (23%) of the samples contained more than one pathogen. Even triple-positive samples were identified in 3% of the investigated animals. In conclusion, we confirm the coinfection of sheep with various haemoparasitic pathogen species in the Kurdistan Region of Iraq. Further investigations are needed to reveal the epidemiology of the diseases, the respective tick vectors, and, in the case of coinfection, pathogens′ interaction and possible cross-protection.
Introduction Iraq has a huge population of small ruminants estimated at 9.3 million heads in 2010, representing 0.5% of the world’s population. These animals produce considerable amounts of milk, meat, wool and skin (FAOSTAT, 2012). Livestock diseases hamper the supply of local people with the above-mentioned products. Ticks and tick-borne haemoparasitic diseases such as theileriosis, babesiosis and anaplasmosis constitute a major challenge for livestock health and production in Iraq including the Kurdistan region (Khayyat and Gilder, 1947; Alsaad et al., 2009; Naqid and Zangana, 2011). The affected animals are usually subclinically diseased so that reduction in fertility and production are often the only hints for the above-mentioned diseases. Although economic losses caused by haemoparasitic diseases are known to be worldwide high (Hooshmand-Rad and Hawa, 1973; Perry and Randolph, 1999), recent data are scarce regarding
the Kurdistan Region (Zangana and Naqid, 2011). Personal communication with local veterinarians indicated problems with the above-mentioned diseases especially as huge movements of small ruminants from the South to the North were undertaken in the recent past, which might enhance the risk of disease outbreaks among these animals and their further spread in the Kurdistan region (Murad, 2011). For example, the risk of infection of animals with T. lestoquardi in the North is now greater because infections with this parasite were confined to the Southern part of the country (Latif et al., 1977). Earlier studies indicated that the clinical signs are more severe if an animal is coinfected with Anaplasma and piroplasms (Khayyat and Gilder, 1947). The aim of this study was to monitor small ruminants for tick-borne haemoparasitic diseases such as theileriosis, babesiosis and anaplasmosis and to determine the rate of coinfections in animals under study using molecular epidemiological tools in sheep in the Kurdistan Region.
© 2013 Blackwell Verlag GmbH • Transboundary and Emerging Diseases. 60 (Suppl. 2) (2013) 113–118
113
Coinfection of Sheep with Anaplasma, Theileria and Babesia Species
Material and Methods Collection of samples and DNA extraction A total of 195 samples were collected from sheep in Kurdistan Region of Iraq, from three governorates, namely Duhok, Erbil and Sulaimaniya. Of these, 78 samples were collected in the field, and 117 samples were obtained from animals brought to abattoirs within the governorates. Blood was collected into K-EDTA tubes, and DNA was extracted using the DNeasyâ Blood and Tissue kit (Qiagen, Hilden, Germany) following the manufacturers′ instructions. Purified DNA was then eluted from the mini spin column using double-distilled water at a temperature of 60°C. DNA concentration was assessed by photometry. Molecular detection methods PCR For the detection of T. lestoquardi and B. ovis, primer sequences and cycling protocols were adapted from Bakheit et al. (2006) and Aktas et al. (2005). For the detection of A. ovis, the protocol of de la Fuente et al. (2002) was used. PCR was performed in a final reaction volume of 33 ll that contained 3.5 ll 109 reaction buffer, 7 ll 59 enhancer solution, 0.7 ll of a 10 mM dNTPs mix (200 lM final concentration of each dNTP), 1.6 ll of each primer having a concentration of 10 lM (0.46 lM final concentration of each primer) and 0.175 ll of 5 U/ll Taq polymerase (0.025 U/ll final concentration) (PEQLAB Biotechnologie GmbH, Erlangen, Germany). DNA (2 ll) was then added. The PCR profile was conducted in an automated thermal cycler (Biometra, G€ ottingen, Germany) and consisted of an initial denaturing step of 3 min at 94°C followed by 35 cycles of denaturing, annealing and extension. Final extension was performed for 5 min at 72°C. PCR products were electrophoresed on a 1.5% agarose gel containing ethidium bromide for visualization under UV light. Reverse-line blotting (RLB) Reverse-line blotting was performed according to Gubbels et al. (1999) and Schnittger et al. (2004). Probes used for the detection of A. ovis and Ehrlichia ovis were 5′ATGTGAGGATTTTATCTTTGTA and 5′–GGCTTTTGCC TCTGTGT, respectively. For Theileria and Babesia species of small ruminants, the probes were similar to those in Schnittger et al. (2004). The primers RLB-F (5′-GAGGTAGTGACAAGAAATAACAATA-3′) and RLB-R (biotin5′-TCTTCGATCCCCTAACTTTC-3′) were used to amplify the hyper variable region 4 of the Babesia and Theileria 18 S RNA gene, while the primers A.o.-rDNA-680s (biotin-5′TCCGGTACTGACGCTGAGGTG) and A.o.-rDNA-1220as (5′–AACTGAGACGACTTTTACGGATTA) were used to amplify the bacterial 16 S hyper variable region. PCR 114
S. Renneker et al.
reaction was performed in 50-ll final volumes. Program for PCR was as follows: 3 min at 94°C initial denaturation, then 40 cycles of 1 min at 94°C, 90 s at 55°C and 90 s at 72°C, then a final extension step of 72°C for 5 min. Further hybridization steps and analysis of RLB results were performed according to Schnittger et al. (2004). Cloning and sequencing The PCR products of three samples (no. 16, 32 and 34) were cloned for subsequent sequence analysis to confirm co-presence of Anaplasma ovis and T. uilenbergi. Furthermore, PCR products of randomly selected samples positive for T. lestoquardi (no. 21, 36, 41 and 42) and Babesia ovis (no. 24) were cloned and sequenced. Briefly, the amplified PCR DNA band was excised and purified from the 1.5% agarose gel using QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany), cloned into the pDrive vector (Qiagen, Hilden, Germany) and transformed into E. coli cells. After growing overnight at 37°C, three selected clones of each sample were subjected to sequencing (Eurofins MWG Operon, Ebersberg, Germany) and analysed afterwards using Lasergene 5.0 (DNASTAR, Madison, WI, USA). Results Using RLB (Fig. 1), 122 of the 195 (62.6%) samples were found positive for Anaplasma ovis, 28 (14.35%) positive for T. ovis and 11 (5.6%) positive for T. uilenbergi (Table 1). This is the first description of T. uilenbergi in Iraq. This was confirmed by sequencing of three samples (Fig. 2). The obtained sequence of the T. uilenbergi 18S ribosomal RNA gene was deposited in GenBankâ under the accession KC778790. Theileria lestoquardi and Babesia ovis were not detected by RLB, but the distribution of transmitting ticks suggested the possibility of the presence of these two pathogens in Kurdistan Region (Hoogstraal and Kaiser, 1958; Robson et al., 1968; Hooshmand-Rad and Hawa, 1973; Friedhoff, 1997). Indeed, the possible occurrence of T. lestoquardi and Babesia ovis in this part of the country was suggested by many authors (Khayyat and Gilder, 1947; Hooshmand-Rad Table 1. By RLB and PCR detected pathogens of the 195 sheep DNA samples from Northern Iraq Detected pathogen
RLB
PCR
Anaplasma ovis
122/195 (62.6%)
130/195 (66.6%), Renneker et al. (2013)
Theileria ovis Theileria uilenbergi Theileria lestoquardi Babesia ovis
28/195 (14.35%) 11/195 (5.6%) Not detected Not detected
15/195 (7.7%) 3/195 (1.5%)
© 2013 Blackwell Verlag GmbH • Transboundary and Emerging Diseases. 60 (Suppl. 2) (2013) 113–118
S. Renneker et al.
Coinfection of Sheep with Anaplasma, Theileria and Babesia Species
Fig. 1. Reverse-line blotting of 40 samples against probes detecting various pathogens of small ruminants. Coinfection can be observed in several samples.
Fig. 2. Parts of sequencing results of cloned Theileria uilenbergi positive samples no. 16, 32 and 34. Clones no. 16.1, 32.1, 32.2 and 34.2 were 100% identical to the five published sequences available in the NCBI database (accession no. AY262116.1, JF719835.1, AY262120.1, AY262121.1, AY262122.1, AY262123.1).
and Hawa, 1973; Sulaiman et al., 2009). Using pathogenspecific PCRs, positive results for T. lestoquardi could be observed in 7.7% (15/195) of the samples. Regarding Babesia ovis, three of the 195 samples showed a positive result (1.5%) (Table 1). In a further step, sequence analysis of four randomly picked samples positive for T. lestoquardi (samples no. 21, 36, 41 and 42) and one sample positive for B. ovis (sample no. 24) was performed to confirm the PCR results. These sequences for the 18S ribosomal RNA genes of the respective pathogens can be found under the accession
numbers KC778785, KC778786 and KC778787 at GenBankâ. The per cent identity of all ten sequenced clones of T. lestoquardi in comparison with the published sequences in the GenBankâ database (accession no. AF081135.1 and JQ917458.1) was between 99 and 100% (data not shown). More importantly, coinfection of sheep with piroplasms and Anaplasma could be confirmed in this study. Five samples were triple positive for T. ovis, T. uilenbergi and Anaplasma ovis (2.56%), and one sample was triple positive for T. ovis, Anaplasma ovis and Babesia ovis (0.5%). Eleven
© 2013 Blackwell Verlag GmbH • Transboundary and Emerging Diseases. 60 (Suppl. 2) (2013) 113–118
115
Coinfection of Sheep with Anaplasma, Theileria and Babesia Species
samples were double positive for T. uilenbergi and Anaplasma ovis (5.6%), and 24 samples were double positive for T. ovis and Anaplasma ovis (12.3%). Three samples were positive for T. lestoquardi as well as Anaplasma ovis (1.5%), and one sample showed coinfection with Anaplasma ovis and Babesia ovis (0.5%) (Table 2). The sequences of the 16S rRNA of A. ovis are available at GenBankâ under the accession numbers KC778788 and KC778789, respectively. Discussion and Conclusion Theileria species, Anaplasma ovis and Babesia ovis could be detected in samples collected from the Kurdistan region of Iraq. Altogether, 135 of 195 (69.2%) animals were infected with at least one pathogen. Anaplasma ovis was the most prevalent in these samples (62.6%), which is indeed higher than previously published on this region (Muslih et al., 1981; Yousif et al., 1983; Naqid and Zangana, 2011). The reason for this difference might be the detection tools used, as these authors used Giemsa-stained blood smears to identify the parasites microscopically, while our study was performed using PCR-based techniques. It has been shown in several studies that molecular approaches are much more sensitive than microscopical examination (Schnittger et al., 2004). Our data fit well to the observations of Omer et al. (2007) who investigated ticks collected from sheep and goats in Kurdistan region and found that 90% of these ticks were Rhipicephalus bursa. This species is a known vector for A. ovis (Friedhoff, 1997). Given these data, the socio-economic relevance of A. ovis should be reconsidered taking into account other stress factors such as coinfection, poor health conditions, hot weather, vaccination, deworming or heavy tick infestation. (Khayyat and Gilder, 1947; Manickam, 1987). Currently, information on the distribution of Babesia ovis is scarce, albeit the presence vector ticks for B. ovis such as Rhipicephalus species (Sulaiman et al., 2009) and Hyalomma excavatum (Friedhoff, 1997). In a study carried out in Mosul in 2009 (Sulaiman et al., 2009), 15.42% of investigated goats were found positive for Babesia sp. Table 2. Coinfection rates observed in the 195 investigated samples from Northern Iraq
S. Renneker et al.
including B. ovis, B. motasi, B. foliata and B. taylori. However, the exact percentage for B. ovis among the examined samples has not been determined. On the other hand, Zangana and Naqid (2011) could not find B. ovis in the 500 samples they investigated by Giemsa staining, which suggests that the parasite is currently not frequent in the Kurdistan Region. This finding could be confirmed by our study as only 1.5% of the samples tested were positive. Considering the high pathogenicity of B. ovis in sheep (Sulaiman et al., 2009) and its frequent occurrence in Iraq (Friedhoff, 1997), there is a need for a more systematic study including north and south of the country. This study described the presence of T. uilenbergi in Iraq for the first time, suggesting a wider area of distribution of this pathogen than previously assumed. Until now, T. uilenbergi has been detected within China and is considered to be highly pathogenic (Schnittger et al., 2000, 2003; Yin et al., 2004). A variant of T. uilenbergi bearing 99.6% identity has been previously reported in Spain but was described as non-pathogenic (Nagore et al., 2004). The transmitting ticks Haemaphysalis qinghaiensis and H. longicornis have not been detected in Iraq. Future studies should focus on the distribution of the parasite and the identification of its field vector ticks. Theileria lestoquardi is known to be present in Iraq. Using IFAT, Latif et al. (1977) could demonstrate a lower rate of infection (7.3%) in the North than in the South (41.3%). In another study, 33.8% of goats were serologically positive to T. lestoquardi in Baghdad region (Al-Amerey and Hasso, 2002). In our study, we examined samples collected from sheep from the Kurdistan Region with an overall prevalence of 7.7%. This indicates that despite large movements of sheep from South to North in the recent past (Murad, 2011), no obvious changes occurred regarding the infection rate of sheep with T. lestoquardi. On the other hand, Zangana and Naqid (2011) found 20.8% goat sera to be positive for T. lestoquardi in Duhok governorate. This is surprising because T. lestoquardi is more pathogenic to sheep than goats. The phenomenon of multiple infections of animals represents an issue, which has been so far rarely investigated. The first description of coinfection of small ruminants in Iraq was carried out by Khayyat and Gilder as early as 1947, but to the best of our knowledge, no further studies have been carried out. In this study, coinfection of sheep with different pathogens could be found. Altogether, 45 of 195 (23%) sheep were infected with more than one pathogen, a fact which increases the health problems of the animals, and thus, the loss of products as described by Khayyat and Gilder (1947). Even triple positives could be recorded in 6 of 195 samples (3%), which indicates that superinfection by other hemoparasitic species occurs and absence of crossprotection between these species. Further studies should
Coinfection with
No. of positive samples (%)
Anaplasma ovis, Theileria ovis and Theileria uilenbergi Anaplasma ovis, Theileria ovis and Babesia ovis Anaplasma ovis and Theileria uilenbergi Anaplasma ovis and Theileria ovis Anaplasma ovis and Babesia ovis Anaplasma ovis and Theileria lestoquardi
5 (2.56) 1 (0.5) 11 (5.6) 24 (12.3) 1 (0.5) 3 (1.5)
116
© 2013 Blackwell Verlag GmbH • Transboundary and Emerging Diseases. 60 (Suppl. 2) (2013) 113–118
S. Renneker et al.
include more detailed picture about the effect of multiple infections. Additionally, questing ticks should be investigated as to whether they are infected with more than one pathogen and their ability to transmit more than one pathogen at the same time. In conclusion, Theileria, Anaplasma and Babesia species are present in sheep in the Kurdistan Region, and the demonstrated high infection rate suggests that ticks and tickborne diseases have considerable impact on the animals′ productivity (Hooshmand-Rad and Hawa, 1973; Perry and Randolph, 1999). Conflicts of interest The authors declare no conflicts of interest in relation to this work. References Aktas, M., K. Altay, and N. Dumanli, 2005: Development of a polymerase chain reaction method for diagnosis of Babesia ovis infection in sheep and goats. Vet. Parasitol. 133, 277– 281. Al-Amerey, M. A. Y., and S. A. Hasso, 2002: Epizootiological Survey of some blood and fecal parasitic protozoa of goats around Baghdad City. Basrah. J. Vet. Res. 1, 41–48. Alsaad, K. M., Q. T. Al-obaidi, and S. A. Esmaeel, 2009: Hematological and biochemical study on the effect of some common blood parasites in native goats in Mosul area. Iraq. J. Vet. Sci. 23, 101–106. Bakheit, M. A., E. Endl, J. S. Ahmed, and U. Seitzer, 2006: Purification of Macroschizonts of a Sudanese Isolate of Theileria lestoquardi (T. lestoquardi [Atbara]). Ann. N.Y. Acad. Sci. 1081, 453–462. FAOSTAT (2012). © FAO Statistics Division 2012. Available at http://faostat3.fao.org/home/index.html#VISUALIZE_BY_DOMAIN (accessed May 15, 2103). Friedhoff, K. T. 1997: Tick-borne diseases of sheep and goats caused by Babesia, Theileria or Anaplasma spp. Parassitologia 39(Suppl 1), 99–109. de la Fuente, J., R. A. Van Den Bussche, J. C. Garcia-Garcia, S. D. Rodrı́ guez, M. A. Garcı́ a, A. A. Guglielmone, A. J. Mangold, L. M. Friche Passos, M. F. Barbosa Ribeiro, E. F. Blouin, and K. M. Kocan, 2002: Phylogeography of New World isolates of Anaplasma marginale based on major surface protein sequences. Vet. Microbiol. 88, 275–285. Gubbels, J. M., A. P. de Vos, M. van der Weide, J. Viseras, L. M. Schouls, E. de Vries, and F. Jongejan, 1999: Simultaneous Detection of Bovine Theileria and Babesia Species by Reverse Line Blot Hybridization. J. Clin. Microbiol. 37, 782–1789. Hoogstraal, H., and M. N. Kaiser, 1958: The ticks (Ixodoidea) of Iraq: keys, Hosts and Distribution. J. Iraq Med. Prof. 6(2–3), 1–22.
Coinfection of Sheep with Anaplasma, Theileria and Babesia Species
Hooshmand-Rad, P., and N. J. Hawa, 1973: Malignant Theileriosis of sheep and goats. Trop. Anim. Hlth. Prod. 5, 97–102. Khayyat, S. M., and A. A. Gilder, 1947: Ovine piroplasmoses in Iraq. Trans. R. Soc. Trop. Med. Hyg. 41, 119–120, IN3, 121126. Latif, B. M. A., N. J. Hawa, and F. A. Bakir, 1977: Incidence of malignant Theileriosis (Theileria hirci) of sheep in Iraq. Iraqi J. Vet. Med. 1, 29–37. Manickam, R. 1987: Epidemiological and clinical observations of acute anaplasmosis in sheep. Indian J Vet Med 7, 159–160. Murad (Elam) T. (2011). Meat consumption in Iraq. Available at http://www.kurdistanfoodsecurity.com/2011/04/meat-consumption-in-iraq.html (accessed May 15, 2013). Muslih, N. J., H. C. Joshi, S. K. Dwivedi, N. J. Ahmad, and R. A. Dimitri, 1981: A preliminary study on the prevalence of anaplasmosis in sheep in Northern Iraq (Mosul). Indian J. vet. Med. 1, 106–112. Nagore, D., J. Garcı́ a-Sanmartı́ n, A. L. Garcı́ a-Perez, R. A. Juste, and A. Hurtado, 2004: Identification, genetic diversity and prevalence of Theileria and Babesia species in a sheep population from Northern Spain. Int. J. Parasitol. 34, 1059– 1067. Naqid, I. A., and I. K. Zangana, 2011: Hematological and serological (cELISA) studies of caprine anaplasmosis in Duhok governorate of Kurdistan region in Iraq. J. Duhok Univ. 13, 153–161 (Agri. And Vet. Sciences). Omer, L. T., M. Abdul-Aziz Kadir, U. Ulrike Seitzer, and J. S. Ahmed, 2007: A survey of ticks (Acari: Ixodidae) on cattle, sheep and goats in the Dohuk Governorate. Iraq. Parasitol. Res. 101(Suppl 2), 179–181. Perry, B. D., and T. F. Randolph, 1999: Improving the assessment of the economic impact of parasitic diseases and of their control in production animals. Vet. Parasitol. 84, 145–168. Renneker, S., J. Abdo, D. A. Salih, T. Karagenc, H. Bilgic, A. Torina, A. G. Oliva, J. Campos, B. Kullmann, J. Ahmed, and U. Seitzer, 2013: Can Anaplasma ovis in small ruminants be neglected any longer? Transbound. Emerg. Dis. 60 (Suppl. 2), 105–112. Robson, J., J. M. Robb, and N. J. Hawa, 1968: Ticks (Ixodidae) of domestic animals in Iraq. Part 4. A comparison of infestations in winter and early summer in the Liwa of Mosul. J. Med. Ent. 5, 261–264. Schnittger, L., H. Yin, L. Jianxun, W. Ludwig, P. Shayan, S. Rahbari, A. Voss-Holtmann, and J. S. Ahmed, 2000: Ribosomal small-subunit RNA gene-sequence analysis of Theileria lestoquardi and a Theileria species highly pathogenic for small ruminants in China. Parasitol. Res. 86, 352–358. Schnittger, L., H. Yin, M. J. Gubbels, D. Beyer, S. Niemann, F. Jongejan, and J. S. Ahmed, 2003: Phylogeny of sheep and goat Theileria and Babesia parasites. Parasitol. Res. 91, 398– 406. Schnittger, L., H. Yin, B. Qi, M. J. Gubbels, D. Beyer, S. Niemann, F. Jongejan, and J. S. Ahmed, 2004: Simultaneous detection and differentiation of Theileria and Babesia parasites
© 2013 Blackwell Verlag GmbH • Transboundary and Emerging Diseases. 60 (Suppl. 2) (2013) 113–118
117
Coinfection of Sheep with Anaplasma, Theileria and Babesia Species
infecting small ruminants by reverse line blotting. Parasitol. Res. 92, 189–196. Sulaiman, E. G., S. H. Arslan, Q. T. Al-Obaidi, and E. Daham, 2009: Clinical, haematological and biochemical studies of babesiosis in native goats in Mosul. Iraq. J. Vet. Sci. 24, 31–35. Yin, H., J. Luo, L. Schnittger, B. Lu, D. Beyer, M. Ma, G. Guan, Q. Bai, C. Lu, and J. Ahmed, 2004: Phylogenetic analysis of Theileria species transmitted by Haemaphysalis qinghaiensis. Parasitol. Res. 92, 36–42.
118
S. Renneker et al.
Yousif, Y. A., R. A. Dimitri, S. K. Dwivedi, and N. J. Ahmed, 1983: Anaemia due to anaplasmosis in Iraqi goats: I. Clinical and haematological features under field conditions. Indian Vet. J. 60, 576–578. Zangana, I. K., and I. A. Naqid, 2011: Prevalence of piroplasmosis (Theileriosis and Babesiosis) among goats in Duhok Governorate. Al-Anbar J. Vet. Sci. 4, 50–57.
© 2013 Blackwell Verlag GmbH • Transboundary and Emerging Diseases. 60 (Suppl. 2) (2013) 113–118
