Curr Microbiol DOI 10.1007/s00284-015-0779-9

ClpP Affects Biofilm Formation of Streptococcus mutans Differently in the Presence of Cariogenic Carbohydrates Through Regulating gtfBC and ftf Jia-qin Zhang • Xiang-hua Hou • Xiu-yu Song • Xiao-bo Ma • Yuan-xun Zhao • Shi-yang Zhang

Received: 31 March 2014 / Accepted: 19 December 2014 Ó Springer Science+Business Media New York 2015

Abstract The abilities to form biofilms on teeth surface and to metabolize a wide range of carbohydrates are key virulence attributes of Streptococcus mutans. ClpP has been proved to play an important role in biofilm development in streptococci. Here we demonstrated that ClpP was involved in biofilm formation of S. mutans. ClpP inactivation resulted in enhanced biofilm formation or initial cell adherence in broth supplemented with sucrose, while reduced in broth supplemented with glucose or fructose. Our results also indicated that the enhanced capacities of biofilm formation and initial cell adherence were achieved through regulating the expression of a number of extracellular sucrose-metabolizing enzymes, such as glucosyltransferases (GTFB and GTFC) at early-exponential growth phase and fructosyltransferase at late-exponential growth phase in the presence of sucrose.

Jia-qin Zhang and Xiang-hua Hou have contributed equally. J. Zhang (&)
X. Song
X. Ma
Y. Zhao Department of Clinical Laboratory, The First Affiliated Hospital of Xiamen University, No. 55 Zhenhai Road, Xiamen 361003, China e-mail: [email protected] J. Zhang
S. Zhang Nosocomial Infection Control Center of Xiamen, Xiamen 361003, China X. Hou Department of Nephrology, The First Affiliated Hospital of Xiamen University, Xiamen 361003, China S. Zhang Department of Nosocomial Infection Control, The First Affiliated Hospital of Xiamen University, Xiamen 361003, China

Introduction Streptococcus mutans is the primary pathogen of human dental caries and also the causative agent of subacute bacterial endocarditis, a life-threatening inflammation of heart valves [6, 13]. S. mutans dwells in oral cavity and keeps a biofilm lifestyle in dental plaque. The abilities to form biofilms on teeth surface and to metabolize a wide range of carbohydrates are key virulence attributes of S. mutans [10, 12]. Biofilm formation of S. mutans is a multistep process and initiated by cell-to-surface adherence, followed by bacterial accumulation with the development of cell-to-cell interactions. To colonize on tooth surface, S. mutans synthesizes various surface-associated proteins, above all glucosyltransferases (GTFs) and fructosyltransferase (FTF). Three GFTs, GTFB, GTFC, and GTFD, are encoded by S. mutans to synthesize extracellular glucan polymers from sucrose [10]. Adhesive glucans mediate the attachment of bacteria to tooth surface as well as to other bacteria [9]. Among GTFs, GtfB makes primarily waterinsoluble a-(1–3)-linked glucan polymers, GtfD is responsible for synthesis of water-soluble a-(1-6)-linked glucan polymers, whereas, GtfC appears to synthesize both types of glucan products, with the water-insoluble glucans predominating [4]. S. mutans also produces a FTF, which synthesizes fructan polymers from sucrose [19]. Fructans are considered to function primarily as extracellular storage compounds, and can also act as binding sites for bacteria accumulation [18]. All of above surface-associated proteins along with glucan-binding proteins (GBPs) mediate the aggregation of oral bacteria and promote plaque formation [16]. A number of investigations have indicated that different induction of those surface-associated proteins in planktonic state is a pivotal step in initiation of adhesion and biofilm formation of S. mutans [17].

123

J. Zhang et al.: Presence of Cariogenic Carbohydrates

Biofilm of S. mutans is formed under a diverse, multispecies, and dynamic environment that often undergoes rapid changes [12]. Under a variety of stress conditions, damaged proteins accumulate dramatically [2]. Besides of losing their physiological functions, these damaged proteins can bring lethal consequences to cells. The capacity to tolerate rapid and frequent environmental fluctuations, to remove the irreversibly damaged proteins and to stabilize proteins that perform essential functions, is central for viability and survival of bacterial pathogens in hosts [2, 15]. To survive environmental changes, cells synthesize proteins, including both chaperones and proteases, above all to prevent accumulation of abnormal proteins [3, 5, 14]. Recent studies have focused on a large family of caseinolytic proteins, named Clp-proteolytic complex, which is composed of ClpP peptidase and ATPases [1]. Previous studies have demonstrated that ClpP plays an indispensable role in cellular protein quality control, cell structure maintenance and biofilm development in streptococci [1, 7]. However, the role of ClpP in biofilm formation of S. mutans in the presence of carbohydrates is controversial [8]. The purpose of present study is to gain insight into the role of intracellular ClpP in biofilm formation of S. mutans and to examine the effects of ClpP on expression of surface-associated proteins in the presence of several cariogenic carbohydrates. Here we demonstrated that ClpP inactivation resulted in an enhanced ability to form biofilm

in the presence of sucrose, while reduced in the presence of glucose or fructose. Different expression patterns of those surface-associated genes induced by different carbohydrate sources in planktonic state of S. mutans and ClpP-deficient strain has been observed.

Materials and Methods Bacterial Strains and Growth Conditions Escherichia coli strain DH5a and its derivatives were grown in Luria-Bertani (LB) medium. S. mutans UA159 and its derivatives were routinely grown in Todd-Hewitt medium (BBL, Becton Dickinson) supplemented with 0.2 % yeast extract (THY) at 37 °C under microaerophilic condition. Ampicillin (Amp; 100 lg/ml for E. coli), erythromycin (Em; 300 lg/ml for E. coli or 10 lg/ml for S. mutans), kanamycin (Km; 50 lg/ml for E. coli or 300 lg/ml for S. mutans) were added as needed (Table 1). Construction of Mutant Strain The clpP gene was deleted by an adopting Cre-loxP method as previously described by Jiaqin Zhang [23]. Briefly, a PCR product with flanking sequence upstream and downstream of clpP was amplified from UA159

Table 1 List of oligonucleotides used in this study Primer

Sequence (5’ to 3’)a

Application

SMU1671-F

AGTCAATGAAATTGCTATGC

clpP deletion

SMU1674-R

GACAAATTTAAGAGCACCAA

clpP deletion

Eco-SMU1671-OutF

GGCGAATTCAATTGGCAAATCCTGTCCG

clpP cloning

Bam-SMU1672-OutR

GGCGGATCCCAAGAGTATCTTCAATTGC

clpP cloning

lox71-Km-F

CGTACCGTTCGTATAGCATACATTATACGAAG TTATGAGGATGAAGAGGATGAGGAGGCAG

KMR cloning

lox66-Km-R

CGTACCGTTCGTATAATGTATGCTATACGAA GTTATGCTTTTTAGACATCTAAATCTAGG

KMR cloning

gtfB-F

AGATATCGTCACAACAAG

RT PCR

gtfB-R

CATAAGTCTTGTTAATGCC

RT PCR

gtfC-F

CTTCAGCTGTAGTGACTTTG

RT PCR

gtfC-R

CGTCAAAATTAGCTGTATTAGC

RT PCR

ftf-F

TTTCCGCCCGCATAGAC

RT PCR

ftf-R

AATCAAGTCGCACGAC

RT PCR

gyrA-F

TAACAAGTGAAATGAAGAC

RT PCR

gyrA-R

CCATAGAACCAAAATTTCCA

RT PCR

gtfB-outF

GTTATAAACTGCGCAAAGTT

gtfB/C deletion

gtfB-outR

ATTGATTGAGCACCAGTG

gtfB deletion

gtfB-F1

AGTTGGTTTCTCTTATGACG

gtfC deletion

gtfC-outR

TCCTAAGCTAATGAAAGCAT

gtfB/C deletion

a

Restriction sites used to facilitate ligation are italics and underlined

123

J. Zhang et al.: Presence of Cariogenic Carbohydrates

chromosome using primers SMU1671-F and SMU1674-R, and cloned into pGEM-T Easy vector (Promega, CA, US) to generate pCKA101. A Km resistance cassette, with flanking loxP sites, amplified from pUC4XKm2 using primers lox71-Km-F and lox66-Km-R, was cloned into HindIII-digested, T4 DNA polymerase-blunted pCKA101, resulting in pCKA102. Linearized pCKA102 was then transformed into S. mutans UA159. The transformants were selected on THY agar containing Km. One such double crossover mutant, named DclpP::Km, was transformed with pCrePA to excise loxP-KmR cassette from the chromosome at 30 °C. Then pCrePA were removed from the cells by incubating overnight at 37 °C, resulting in a clpP deletion mutant strain (DclpP). The deletion was verified by PCR analysis and sequencing. Construction of Complemented Strain To ensure that the phenotype of DclpP mutant was due solely to absence of clpP, a complemented strain was constructed. Entire clpP gene coding region plus a 1.4-kb upstream sequence was amplified from UA159 genomic DNA using primers Eco-SMU1671-OutF and BamSMU1672-OutR. The resulting fragment was introduced into EcoRI–BamHI-digested pOri23, an E. coli–S. mutans shuttle plasmid, to create pClpP-1. Then the plasmid pClpP-1 was transformed into DclpP mutant strain to create DclpP complemented strain (S-pClpP). Biofilm Formation The ability to form biofilms of S. mutans and its derivatives was assessed by growing them on a polypropylene surface in THY broth supplemented with one of the tested cariogenic carbohydrates (sucrose, glucose or fructose) at the final concentration of 3 %. After incubation at 37 °C for 72 h, cells were washed twice, air dried, and stained with 0.1 % crystal violet for 15 min. The bound dye was extracted from the stained cells by 1 ml Destain solution (ethanol/acetone = 8:2). The biofilm formation was then quantified by measuring the optical density of the solution at 575 nm. Initial Adherence Assay Overnight S. mutans and its derivatives were 1:100 diluted with fresh THY broth, and incubated until OD600 reached 0.5. Aliquots (4.5 ml) were then transferred to polystyrene tubes containing either 0.5 ml THY or 0.5 ml THY supplemented with sucrose, glucose or fructose at final concentration of 3 %. After incubation for 1 h, nonadherent cells were transferred to a sterile tube and adherent cells were scraped from the abiotic surface with a polypropylene

spatula, resuspended in 5 ml fresh THY broth, and vortexed to homogeneity. Both adherent and nonadherent cells were spread on Trypticase yeast Columbia blood (TYCB) agar and TYCB agar containing 10 lg/ml erythromycin as control for possible contamination. Adherence ability was designed as the percentage of adherent cells. Animals Study The ability of DclpP mutant to colonize on animals’ teeth was evaluated in vivo as previously described [20]. Briefly, SDF level Sprague-Dawley rats were infected with S. mutans UA159 or its derivatives by cotton swab, and fed with a highly cariogenic diet and sucrose water (3 %). On experimental day 5, successful infections were screened by bacterial identification using Vitek2 semi-automated system (bioMe´rieux Inc., Durham, NC) and PCR analysis on 16 s RNA gene followed by sequencing. On experimental day 30, lower jaws of the rats were removed for microbiological assessment. This study was reviewed and approved by Ethics Committee of Xiamen University. RNA Methods and Real-Time PCR Total RNA was extracted from S. mutans and its derivatives as previously described by Jiaqin Zhang [23]. Equal amounts of total RNA (1 lg) were used to synthesize cDNA templates using SuperScript first-strand synthesis system (Invitrogen Corp., Carlsbad, CA) according to the recommended procedure. Real-time PCR was carried out on a LightCyclerÒ 480 PCR detection system (Roche, Rotkreuz, CH) with SYBR Green I supermix (TaKaRa, Dalian, CN). Thermal cycling condition was set for 40 cycles of 95 °C for 10 s and 60 °C for 45 s, with an initial cycle at 95 °C for 30 s. During each cycle, accumulation of PCR products was detected by monitoring fluorescence increase of double-stranded-DNA-binding SYBR Green I. Melting curves were run immediately after the last PCR cycle through plotting fluorescence intensities against temperatures. The relative quantities of mRNA of each gene were determined by comparative critical threshold cycle (DDCT) method and normalized by a house-keeping gene gyrA. All data were collected and analyzed with the software provided with LightCyclerÒ 480.

Results and Discussion Unlike most infectious diseases, in which classic virulence factors, such as toxins, play clear roles in the damage elicited by organisms, the pathology of dental caries is associated almost exclusively with bacterial metabolism [12]. The capacity to form biofilms is one of the most

123

J. Zhang et al.: Presence of Cariogenic Carbohydrates

important virulence properties of S. mutans. Previous investigations have confirmed that ClpP proteolysis process plays an important role in biofilm formation of streptococci [11]. Here we demonstrated some new findings on ClpP functions in initial cell adherence and stable biofilm formation of S. mutans. Stable Biofilm Formation of S. mutans was Affected by clpP Inactivation in Presence of Cariogenic Carbohydrates To assess functions of ClpP on biofilm formation of S. mutans, the clpP gene was deleted without introducing any antibiotic resistance genes. We and other investigators had demonstrated that ClpP-deficient mutant exhibited a phenotype of increased adhesive films and clump formation in THY broth under microaerophilic condition [8, 11, 23]. Unusually long chains formed by DclpP mutant were also observed [8, 11, 23]. Therefore, we evaluated the capacity of S. mutans and its derivatives to form biofilms on polyethylene surfaces. Our results demonstrated that inactivation of clpP led to a consistent reduction in stable biofilm formation in THY and THY supplemented with high concentration of glucose or fructose (Fig. 1). This kind of reduction could be restored by the complementary plasmid (Fig. 1). While in THY supplemented with sucrose, biofilm formation of DclpP mutant enhanced about twofold compared with its parental strain (Fig. 1). To exclude the possibility that the differences in biofilm formation was due to variations in growth capacity and

Fig. 1 Effects of ClpP on biofilm formation of S. mutans and its derivatives in presence of cariogenic carbohydrates. Cells of wildtype (UA159), clpP-deficient mutant (DclpP) and its complementary strain (S-pClpP) were grown in THY broth or THY supplemented with sucrose, glucose or fructose on polypropylene surface. After incubation for 72 h, biofilms formed by UA159, DclpP, and S-pClpP were stained with crystal violet. Bound dye was extracted from the stained cells by Destain solution. Biofilm formation was then quantified by measuring OD575 of the solution. The results shown are the means with standard deviations from at least three independent experiments

123

autolysis of the strains, the growth characters of DclpP mutant, its parental and complemented strain were estimated. Our results showed that ClpP-deficient mutant exhibited a slow-growth phenotype with a longer lag phase in THY broth under microaerophilic condition, but was able to reach a similar Klett Units at the stationary phase as the wild-type strain (Fig. 2). This kind of slow-growth phenotype could be fully restored by the complementary plasmid pClpP-1 (Fig. 2). At the end of biofilm formation experiments, DclpP mutant strain grew equally well and reached similar final OD600 as it parental strain in THY and THY supplemented with sucrose, glucose, or fructose. These results indicated that the reduced stable biofilm formation of DclpP mutant was solely contributed by inactivation of ClpP. gtfBCD and ftf Transcripts were Differentially Regulated by Cariogenic Carbohydrates in Wild-Type and DclpP Mutant Strain It had been proved that expressions of many enzymes, such as GTF and FTF, were affected by the presence of carbohydrates in broth [17, 18, 21]. Since biofilm formation of DclpP mutant was different from the wild-type strain, we monitored the expression of several genes known for their roles in biofilms formation. Our results further confirmed the findings that expression of GTFs and FTF in S. mutans depended largely on the type of carbohydrates and growth phase in planktonic state [17]. In present investigation, expressions of gtfB/C and ftf were upregulated differently by dietary carbohydrate sources in broth, and this kind of

Fig. 2 Growth characterization of DclpP mutant strain. Overnight cultures of wild-type (UA159), clpP-deficient mutant (DclpP) and its complementary strain (S-pClpP) were 1:100 diluted in THY broth, and grown under microaerophilic condition. At indicated intervals, Klett Units were taken to monitor the growth of the tested strains. A representative result from at least three independent experiments is shown

J. Zhang et al.: Presence of Cariogenic Carbohydrates

variation also depended on growth phases (Figs. 3, 4). In wild-type strain UA159, expressions of gtfB/C and ftf were more pronounced in early-exponential phase than that of late-exponential phase (Figs. 3, 4). Transcriptions of gtfB/C in DclpP mutant were also significantly enhanced by the tested cariogenic carbohydrates in early-exponential phase, only more pronounced than that of its parental and complemented strain. Different from the wild-type strain, transcription of ftf was significantly enhanced by cariogenic carbohydrates in late-exponential phase in DclpP mutant, instead of in early-exponential phase. However, transcription of gtfD in DclpP mutant, it’s parental and complemented strain was affected slightly in both early- and lateexponential phases by the tested cariogenic carbohydrates (Figs. 3c, 4c). All these results indicated that ClpP inactivation could upregulate the expression of gtfB/C and ftf, but not gtfD, and this kind of effects was also dependent on

Fig. 3 Effects of ClpP on gtfB/C/D and ftf expression of S. mutans and its derivatives in presence of cariogenic carbohydrates in earlyexponential phase. Total RNA was extracted from early-exponential cells of UA159, DclpP, and S-pClpP cultured in THY or THY supplemented with sucrose, glucose or fructose, and used for cDNA

the types of carbohydrate sources in broth and growth phases. Initial Cell Adherence of S. mutans was Affected by Carbohydrate Source and clpP Gene To assess contribution of clpP to cell adherence of S. mutans, measurements were performed just over the course of an hour, well before a mature biofilm (need at least 18 h) has being formed [20], so that only the initial adherence of S. mutans and its derivatives was monitored. An enhanced adherence to abiotic surface was observed in DclpP mutant when sucrose was used as sole carbohydrate source, and this enhancement was at least twofold of the wild-type strain (Fig. 5). No obvious difference was observed in the initial adherence between DclpP mutant and the wild-type strain in presence of fructose or glucose (Fig. 5).

templates synthesis. Transcriptions of gtfB/C/D and ftf of S. mutans and its derivatives in the presence of carbohydrates were analyzed by real-time PCR. The results shown are the means with standard deviations from at least three independent experiments

123

J. Zhang et al.: Presence of Cariogenic Carbohydrates

Fig. 4 Effects of ClpP on gtfB/C/D and ftf expression expression of S. mutans and its derivatives in the presence of cariogenic carbohydrates in late-exponential phase. Transcriptions of gtfB/C/D and ftf of UA159, DclpP, and S-pClpP in the presence of various carbohydrates

were analyzed by real-time PCR as previously described. The results shown are the means with standard deviations from three independent experiments

Previous investigations have proposed that water-insoluble glucans produced by gtfB/C-encoded enzymes are critical for sucrose-dependent colonization on smooth surfaces of S. mutans [17, 18, 22]. Our results also confirmed that transcription of gtfB/C was upregulated by carbohydrates in DclpP mutant, its parental and complemented strain (Figs. 3, 4). Therefore, we speculated that the enhanced adherence of DclpP mutant in presence of sucrose was due to upregulation of gtfB/C transcription. To confirm this hypothesis, gtfB, gtfC, or gtfBC was deleted by Cre-loxP method. Interestingly, inactivation of gtfB, gtfC, or gtfBC in DclpP mutant resulted in great reduction in adherence in the presence of sucrose, similar to that in the absence of sucrose, which serves as a substrate for GFTs (Fig. 5). These findings

indicated that the involvement of ClpP in S. mutans adhesion was mediated by gtfB/C gene products.

123

The Inactivation of clpP Increased the Infectivity of S. mutans, but not Significantly Since DclpP mutant exhibited a phenotype of enhanced ability to form stable biofilms in presence of sucrose and increased capacity to adhere abiotic surface, we speculated that inactivation of clpP might render a more virulent strain. To test this hypothesis, we evaluated the ability of DclpP mutant to colonize on rats teeth. Following a 30-days infection period, colonies of S. mutans UA159, DclpP mutant and its complemented strain were recovered

J. Zhang et al.: Presence of Cariogenic Carbohydrates

be used as a potential target against bacteria, though the molecular mechanisms remain mostly undetermined. Acknowledgments The authors would like to thank S. Hou for technical assistance and Q. Xu and H. Rao for critically reading the manuscript. This work was supported through funding from the National Natural Science Foundation of China (No. 81000762), the Natural Science Foundation (No. 2010D018) of Fujian Province, China. Conflict of interest declare.

The authors have no conflicts of interest to

References Fig. 5 Effects of ClpP on initial adherence of S. mutans and its derivatives in presence of cariogenic carbohydrates. Diluted cultures (4.5 ml) of UA159, DclpP, and S-pClpP were transferred to polystyrene tubes containing either 0.5 ml THY or 0.5 ml THY supplemented with sucrose, glucose, or fructose at final concentration of 3 %. After incubation for 1 h, adherent and nonadherent cells were spread on TYCB agar and incubated for 48 h. Cells were counted and percentage of adherent cells was calculated

Fig. 6 Inactivation of clpP increased the infectivity of S. mutans, but not significantly. SDF level Sprague-Dawley rats were infected with UA159, DclpP and S-pClpP by cotton swab, and fed with a highly cariogenic diet and sucrose water. On experimental day 30, lower jaws of the rats were removed for microbiological assessment. The symbols shown represent the recovered bacterial colonies from the teeth of each individual rat infected with UA159, DclpP and S-pClpP, while the line represents the average recovered colonies of each strain

from the jaws of infected rats. Interestingly, no significant differences (P [ 0.05) were observed among the infectivities of S. mutans strains, though average CFUs from recipient animals infected by DclpP mutant was a little more than that of wild-type strain (Fig. 6). In conclusion, our findings revealed broad impacts of Clp protease and surface-associated proteins on biofilm formation of S. mutans in presence of cariogenic carbohydrates, and highlighted the fact that Clp protease could

1. Chattoraj P, Banerjee A, Biswas S, Biswas I (2010) ClpP of Streptococcus mutans differentially regulates expression of genomic islands, mutacin production, and antibiotic tolerance. J Bacteriol 192(5):1312–1323 2. Dougan DA, Mogk A, Bukau B (2002) Protein folding and degradation in bacteria: to degrade or not to degrade? That is the question. Cell Mol Life Sci 59(10):1607–1616 3. Goldberg AL (2003) Protein degradation and protection against misfolded or damaged proteins. Nature 426(6968):895–899 4. Hamada S, Slade HD (1980) Biology, immunology, and cariogenicity of Streptococcus mutans. Microbiol Rev 44(2):331–384 5. Hartl FU, Hayer-Hartl M (2009) Converging concepts of protein folding in vitro and in vivo. Nat Struct Mol Biol 16(6):574–581 6. Horaud T, Delbos F (1984) Viridans streptococci in infective endocarditis: species distribution and susceptibility to antibiotics. Eur Heart J 5(Suppl C):39–44 7. Ibrahim YM, Kerr AR, Silva NA, Mitchell TJ (2005) Contribution of the ATP-Dependent Protease ClpCP to the Autolysis and Virulence of Streptococcus pneumoniae. Infect Immun 73(2):730–740 8. Kajfasz JK, Martinez AR, Rivera-Ramos I, Abranches J, Koo H, Quivey RG Jr, Lemos JA (2009) Role of Clp proteins in expression of virulence properties of Streptococcus mutans. J Bacteriol 191(7):2060–2068 9. Koo H, Hayacibara MF, Schobel BD, Cury JA, Rosalen PL, Park YK, Vacca-Smith AM, Bowen WH (2003) Inhibition of Streptococcus mutans biofilm accumulation and polysaccharide production by apigenin and tt-farnesol. J Antimicrob Chemother 52(5):782–789 10. Kuramitsu HK, Wang BY (2006) Virulence properties of cariogenic bacteria. BMC Oral Health 6(Suppl 1):S11 11. Lemos JA, Burne RA (2002) Regulation and physiological significance of ClpC and ClpP in Streptococcus mutans. J Bacteriol 184(22):6357–6366 12. Lemos JA, Burne RA (2008) A model of efficiency: stress tolerance by Streptococcus mutans. Microbiology 154(Pt 11):3247–3255 13. Loesche WJ (1986) Role of Streptococcus mutans in human dental decay. Microbiol Rev 50(4):353–380 14. Parsell DA, Lindquist S (1993) The function of heat-shock proteins in stress tolerance: degradation and reactivation of damaged proteins. Annu Rev Genet 27:437–496 15. Sauer RT, Bolon DN, Burton BM, Burton RE, Flynn JM, Grant RA, Hersch GL, Joshi SA, Kenniston JA, Levchenko I, Neher SB, Oakes ESC, Siddiqui SM, Wah DA, Baker TA (2004) Sculpting the proteome with AAA ? proteases and disassembly machines. Cell 119(1):9–18

123

J. Zhang et al.: Presence of Cariogenic Carbohydrates 16. Senadheera MD, Guggenheim B, Spatafora GA, Huang YC, Choi J, Hung DC, Treglown JS, Goodman SD, Ellen RP, Cvitkovitch DG (2005) A VicRK signal transduction system in Streptococcus mutans affects gtfBCD, gbpB, and ftf expression, biofilm formation, and genetic competence development. J Bacteriol 187(12):4064–4076 17. Shemesh M, Tam A, Feldman M, Steinberg D (2006) Differential expression profiles of Streptococcus mutans ftf, gtf and vicR genes in the presence of dietary carbohydrates at early and late exponential growth phases. Carbohydr Res 341(12):2090–2097 18. Shemesh M, Tam A, Steinberg D (2007) Expression of biofilmassociated genes of Streptococcus mutans in response to glucose and sucrose. J Med Microbiol 56(Pt 11):1528–1535 19. Tam A, Shemesh M, Wormser U, Sintov A, Steinberg D (2006) Effect of different iodine formulations on the expression and activity of Streptococcus mutans glucosyltransferase and

123

20.

21.

22.

23.

fructosyltransferase in biofilm and planktonic environments. J Antimicrob Chemother 57(5):865–871 Tamesada M, Kawabata S, Fujiwara T, Hamada S (2004) Synergistic effects of streptococcal glucosyltransferases on adhesive biofilm formation. J Dent Res 83(11):874–879 Waite RD, Papakonstantinopoulou A, Littler E, Curtis MA (2005) Transcriptome analysis of Pseudomonas aeruginosa growth: comparison of gene expression in planktonic cultures and developing and mature biofilms. J Bacteriol 187(18):6571–6576 Yousefi B, Ghaderi S, Rezapoor-Lactooyi A, Amiri N, Verdi J, Shoae-Hassani A (2012) Hydroxy decenoic acid down regulates gtfB and gtfC expression and prevents Streptococcus mutans adherence to the cell surfaces. Ann Clin Microbiol Antimicrob 11:21 Zhang J, Banerjee A, Biswas I (2009) Transcription of clpP is enhanced by a unique tandem repeat sequence in Streptococcus mutans. J Bacteriol 191(3):1056–1065