96

FIBROBLAST GROWTH FACTOR

[10]

[10] Cloning, R e c o m b i n a n t E x p r e s s i o n , and Characterization of Basic Fibroblast Growth Factor

By

STEWART

A. THOMPSON, A N D R E W A. PROTTER, LOUISE B I T T I N G , JOHN C. FIDDES, and JUDITH A. ABRAHAM

Introduction

Basic fibroblast growth factor (bFGF) is a single-chain protein characterized both by a strong affinity for the sulfated glycosaminoglycan heparin and by potent mitogenic activity on a wide variety of mesoderm- and neuroectoderm-derived cell types. 1-5 Recent results indicate that bFGF is also mitogenic for some epithelial cell types, including keratinocytes. 6'7 Additional activities reported for bFGF include stimulating the migration of vascular endothelial cells and inducing the production of proteases such as collagenase and plasminogen activator in these cells. 8'9 Consistent with these in vitro observations, bFGF has been shown in vivo to promote new capillary growth (angiogenesis) 2 and wound healing 1°-~3 in a variety of animal models. Concurrent with the purification and characterization of bFGF in the late 1970s and early 1980s, the related mitogen acidic fibroblast growth I D. Gospodarowicz, N. Ferrara, L. Schweigerer, and G. Neufeld, Endocrinol. Rev. 8, 95 (1987). 2 j. Folkman and M. Klagsbrun, Science 235, 442 (1987). 3 R. R. Lobb, Eur. J. Clin. Invest. 18, 321 0988). 4 W. H. Burgess and T. Maciag, Annu. Reu. Biochem. 58, 575 (1989). 5 D. B. Rifkin and D. Moscatelli, J. Cell Biol. 109, 1 0989). 6 E. J. O'Keefe, M. L. Chiu, and R. E. Payne, Jr., J. Invest. Dermatol. 90, 767 (1988). 7 G. D. Shipley, W. W. Keeble, J. E. Hendrickson, R. J. Coffey, Jr., and M. R. Pittelkow, J. Cell. Physiol. 138, 511 (1989). 8 D. Moscatelli, M. Presta, and D. B. Rifkin, Proc. Natl. Acad. Sci. U.S.A. 83, 2091 (1986). 9 M. Presta, D. Moscatelli, J. Joseph-Silverstein, and D. B. Rifkin, Mol. Cell. Biol. 6, 4060 (1986). ~0j. M. Davidson, M. Klagsbrun, K. E. Hill, A. Buckley, R. Sullivan, P. S. Brewer, and S. C. Woodward, J. Cell Biol. 100, 1219 (1985). ii G. S. McGee, J. M. Davidson, A. Buckley, A. Sommer, S. C. Woodward, A. M. Aquino, R. Barbour, and A. A. Demetriou, J. Surg. Res. 45, 145 (1988). 12 p. A. Hebda, C. K. Klingbeil, J. A. Abraham, and J. C. Fiddes, J. Invest. Dermatol., in press (1990). 13 C. K. Klingbeil, L. B. Cesar, and J. C. Fiddes, in "Clinical and Experimental Approaches to Dermal and Epidermal Repair: Normal and Chronic Wounds" (A. Barbul, M. Caldwell, W. Eaglstein, T. Hunt, D. Marshall, E. Pines, and G. Skover, eds.) in press. Alan R. Liss, New York, 1990.

METHODS IN ENZYMOLOGY.VOL. 198

Copyright © 1991by AcademicPress. Inc. All rightsof reproductionin any form reserved.

[10]

RECOMBINANTBASICFGF

97

factor (aFGF) was also identified and purified. 1-4 Comparison of the complete amino acid sequences of a 146-residue form of bovine pituitary bFGF TM and a 140-residue form of bovine brain aFGF 15'16 demonstrated that the two factors share 55% absolute sequence identity. Although some differences in the effects of these two factors have been noted (e.g., on melanocytes ~7 and keratinocytes7), aFGF generally appears to have the same wide range of biological activities as does bFGF. 1-4 Like bFGF, aFGF displays strong affinity for heparin.l-5 Because of this affinity, aFGF and bFGF are sometimes referred to, respectively, as heparin-binding growth factors 1 and 2 (HBGF-1 and HBGF-2). 4'~8 Recently, it has been shown that these factors are members of a larger protein family (the FGF family or HBGF family) which includes at least five other members: the protein encoded by a putative murine oncogene, int219; the products of the human oncogenes FGF-5 2° and hst 2~ (also known as K-fgfZ~); the product of a gene (FGF-6) isolated by homology to hst/ K-fgf23; and keratinocyte growth factor (KGF). 24 In this chapter, we describe some of the methods we have used to isolate bovine and human bFGF gene sequences and to express recombinant human bFGF. The isolation of bFGF clones, by ourselves 25'26 and others, 27-29 employed many standard methods, which have been covered 14 F. Esch, A. Baird, N. Ling, N. Ueno, F. Hill, L. Denoroy, R. Klepper, D. Gospodarowicz, P. B6hlen, and R. Guillemin, Proc. Natl. Acad. Sci. U.S.A. 82, 6507 (1985). 15 G. Gimenez-Gallego, J. Rodkey, C. Bennett, M. Rios-Candelore, J. DiSalvo, and K. Thomas, Science 230, 1385 (1985). i6 F. Esch, N. Ueno, A. Baird, F. Hill, L. Denoroy, N. Ling, D. Gospodarowicz, and R. Guillemin, Biochem. Biophys. Res. Commun. 133, 554 (1985). Jv R. Halaban, S. Ghosh, and A. Baird, In Vitro Cell. Dev. Biol. 23, 47 (1987). 18 R. Lobb, J. Sasse, R. Sullivan, Y. Shing, P. D'Amore, J. Jacobs, and M. Klagsbrun, J. Biol. Chem. 261, 1924 (1986). 19 C. Dickson and G. Peters, Nature (London) 326, 833 (1987). 2o X. Zhan, B. Bates, X. Hu, and M. Goldfarb, Mol. Cell. Biol. 8, 3487 (1988). 21 T. Yoshida, K. Miyagawa, H. Odagiri, H. Sakamoto, P. F. R. Little, M. Terada, and T. Sugimura, Proc. Natl. Acad. Sci. U.S.A. 84, 7305 (1987). 22 p. Delli-Bovi, A. M. Curatola, K. M. Newman, Y. Sato, D. Moscatelli, R. M. Hewick, D. B. Rifkin, and C. Basilico, Mol. Cell. Biol. 8, 2933 (1988). 23 I. Marics, J. Adelaide, F. Raybaud, M.-G. Mattei, F. Coulier, J. Planche, O. de Lapeyriere, and D. Birnbaum, Oncogene 4, 335 (1989). 24 p. W. Finch, J. S. Rubin, T. Miki, D. Ron, and S. A. Aaronson, Science 245, 752 (1989). 25 j. A. Abraham, A. Mergia, J. L. Whang, A. Tumolo, J. Friedman, K. A. Hjerrild, D. Gospodarowicz, and J. C. Fiddes, Science 233, 545 (1986). 26 j. A. Abraham, J. L. Whang, A. Tumolo, A. Mergia, J. Friedman, D. Gospodarowicz, and J. C. Fiddes, EMBO J. 5, 2523 (1986). 27 T. Kurokawa, R. Sasada, M. Iwane, and K. Igarashi, FEBS Lett. 213, 189 (1987). 28 A. Sommer, M. T. Brewer, R. C. Thompson, D. Moscatelli, M. Presta, and D. B. Rifkin, Biochem. Biophys. Res. Commun. 144, 543 (1987).

98

FIBROBLAST GROWTH FACTOR

[10]

in detail in other volumes of this series (see, e.g., Volume 152). We have, therefore, concentrated on discussing in detail only the methods used to obtain the first bFGF clone (encoding bovine bFGF25), since the approach involved the use of a "homology-choice" probe. This novel method of probe design, wherein each codon choice in the probe is dictated as much as possible by the codon used in that position in a homologous gene, may prove useful to others for the isolation of genes encoding proteins sharing regions of high amino acid sequence similarity. Recombinant expression of bFGF has been reported in mammalian cells, 27'29-35 yeast, 36 and the bacterium Escherichia c o l l . 36-39 We describe here an E. coli expression vector, a purification protocol, and analytical techniques that have worked well in our hands for research-scale production and characterization of recombinant human bFGF and analogs thereof. Isolation of c D N A Clone Encoding B o v i n e Basic Fibroblast G r o w t h Factor

The amino-terminal amino acid sequences of bovine brain aFGF (140residue form) and pituitary bFGF (146-residue form) were determined by B6hlen et al. 4°'41 From the first 34 amino acids of the aFGF protein se29 H. Prats, M. Kaghad, A. C. Prats, M. Klagsbrun, J. M. Lelias, P. Liauzun, P. Chalon, J. P. Tauber, F. Amalric, J. A. Smith, and D. Caput, Proc. Natl. Acad. Sci. U.S.A. 86, 1836 (1989). 30 j. A. Abraham, J. L. Whang, A. Tumolo, A. Mergia, and J. C. Fiddes, Cold Spring Harbor Syrup. Quant. Biol. 51, 657 (1986). 31 S. Rogelj, R. A. Weinberg, P. Fanning, and M. Klagsbrun, Nature (London) 331, 173 (1988). 32 R. Sasada, T. Kurokawa, M. Iwane, and K. Igarashi, Mol. Cell. Biol. 8, 588 (1988). 33 S. B. Blam, R. Mitchell, E. Tischer, J. S, Rubin, M. Silva, S. Silver, J. C. Fiddes, J, A. Abraham, and S. A. Aaronson, Oncogene 3, 129 (1988). 34 G. Neufeld, R. Mitchell, P. Ponte, and D. Gospodarowicz, J. Cell Biol. 106, 1385 (1988). 35 R. Z. Florkiewicz and A. Sommer, Proc. Natl. Acad. Sci. U.S.A, 86, 3978 (1989). 36 p. j. Barr, L. S. Cousens, C. T. Lee-Ng, A. Medina-Selby, F. R. Masiarz, R. A. Hallewell, S. H. Chamberlain, J. D. Bradley, D. Lee, K. S. Steimer, L. Poulter, A. L. Burlingame, F. Esch, and A. Baird, J. Biol. Chem. 263, 16471 (1988). 37 M. Iwane, T. Kurokawa, R. Sasada, M. Seno, S. Nakagawa, and K. Igarashi, Biochem. Biopkys. Res. Commun. 146, 470 (1987). 38 C. H. Squires, J. Childs, S. P. Eisenberg, P. J. Polverini, and A. Sommer, J. Biol. Chem. 263, 16297 (1988). 39 G. M. Fox, S. G. Schiffer, M. F. Rohde, L. B. Tsai, A. R. Banks, and T. Arakawa, J. Biol. Chem. 263, 18452 (1988). 4o p. B6hlen, A. Baird, F. Esch, N. Ling, and D. Gospodarowicz, Proc. Natl. Acad. Sci. U.S.A. 81, 5364 (1984). 41 p. B6hlen, F. Esch, A. Baird, and D. Gospodarowicz, EMBO J. 4, 1951 (1985).

[10]

RECOMBINANTBASICFGF

99

quence, two "codon-choice ''42 oligonucleotide probes were designed: a unique-sequence oligonucleotide 48 bases in length and a 2-fold degenerate oligonucleotide 51 bases in length, z5 Using techniques described in detail elsewhere, 42'43 a bovine genomic library was screened in duplicate with these two probes, z5 DNA sequence analysis 44'45of one of the phage 0~BA2) hybridizing to both probes confirmed that this phage contained an aminoterminal coding exon of the bovine aFGF gene. 25 Using degenerate and codon-choice oligonucleotide probes designed from the amino-terminal amino acid sequence of bovine bFGF, several unsuccessful attempts were made to obtain clones for this factor through the screening of a number of different cDNA and genomic libraries. An alternative strategy was therefore developed, which took advantage of the amino acid sequence similarity between aFGF and bFGF. 14-16In comparing the amino-terminal sequences of the two proteins, a region of particularly strong similarity was observed (10 of 14 residues, see Fig. 1A). It was reasoned that if the genes for the two factors were ancestrally related, then the codon choices used in the aFGF gene might be conserved in the bFGF gene. As shown in Fig. 1A, a probe for the bovine bFGF gene sequence encoding the strongly similar region was accordingly designed25 based on two assumptions: (i) where an amino acid residue in bFGF is identical to the aFGF residue at the corresponding position, the codon for that residue in the bFGF gene is the same as the codon used in the aFGF gene (as determined from hBA2), and (ii) at positions where the amino acid residues differ between bFGF and aFGF, the codon for the bFGF amino acid is the one representing the minimum number of nucleotide changes from the aFGF codon. The resulting homology-choice probe was synthesized as the complement of the coding sequence (Fig. I A), to allow for possible use in screening for mRNA encoding bFGF. Probes constructed in this manner would be expected, under appropriate stringency conditions, to hybridize to the homologous DNA sequence used in the probe design (in this case, the aFGF gene sequence). Southern blot analyses 46 were therefore carried out to determine (i) whether the probe shown in Fig. 1A would indeed hybridize to the aFGF gene, and/or to any other sequences in the bovine genome, and (ii) whether 42 W. I. Wood, this series, Vol. 152, p. 443. 43 W. I. Wood, D. J. Capon, C. C. Simonsen, D. L. Eaton, J. Gitschier, B. Keyt, P. H. Seeburg, D. H. Smith, P. Hollingshead, K. L. Wion, E. Delwart, E. G. D. Tuddenham, G. A. Vehar, and R. M. Lawn, Nature (London) 312, 330 (1984). 44 F. Sanger, A. R. Coulson, B. G. Barrell, A. J. H. Smith, and B. A. Roe, J. Mol. Biol. 143, 161 (1980). 45 j. Messing, this series, Vol. 101, p. 20. 46 E. M. Southern, J. Mol. Biol. 98, 503 (1975).

100

FIBROBLAST GROWTH FACTOR

[I0]

A Basic:

lys

Acidic:

. . . lys

Acidic

asp pro lys

erg leu

tyr cys

ly$

leu

tyr cys ser asn gly

pro lys

leu

lys asn gly gly phe phe gly tyr

phe . . .

5'... AAG AAG CCC AAG CTC CTC TAC TGC AGC AAC GGG GGC TAC TTC... 3'

coding:

3 ' - T T C C.T6 GGG TTC GCG GAG ATG ACG T TC TTG CCC COG AAG A - 5'

Probe:

R

P

R

P

R P

55°C

65°C

B

2,.2 - -

5.0~ 4.3~ 3.5--

2.0-

1.9 ,.7 - -

0.9--

0.8 o.6 50"C

Fro. 1. Design of the probe for bovine bFGF clones, and determination of screening conditions. (A) The bFGF "homology-choice" probe. A portion of the amino-terminal sequence of bovine bFGF (residues 18 to 31 of the 146-residue form) is shown aligned with the corresponding homologous region of the amino-terminal sequence of bovine aFGF (residues 9 to 22 of the 140-residue form). Nonhomologous amino acids are in bold lettering. The nucleotide sequence known to encode this region of the aFGF protein is shown below the amino acid sequences, as is the sequence of the oligonucleotide probe. The probe was designed to match the complement of the aFGF coding sequence, except at nucleotide positions that had to be changed to reflect amino acid differences in the bFGF protein (underlined nucleotides; see text). (B) Southern blot analyses of bovine genomic DNA. The

[10]

RECOMBINANTBASICFGF

101

appropriate stringency conditions could be established in which the probe no longer detected the aFGF gene but still bound to other unique sequences (which would presumably represent bFGF gene fragments). For these Southern analyses (Fig. 1B), bovine genomic DNA was first digested with EcoRI or PstI. Multiple sets of the EcoRI and PstI digests were electrophoresed in parallel on a single 0.8% agarose gel and transferred to nitrocellulose. Strips containing individual sets of the digests were cut from the nitrocellulose and prehybridized at 42 ° with 20% formamide buffer [20% formamide, 50 mM sodium phosphate (pH 6.8), 6 x SSC (1 x SSC is 0.15 M NaC1, 15 mM sodium citrate), 5 x Denhardt's solution (0.1% Ficoll, 0.1% polyvinylpyrrolidone, 0.1% bovine serum albumin), and 100/xg/ml boiled herring sperm DNA] .42,43 The homology-choice probe shown in Fig. 1A was radiolabeled with S2p using T4 polynucleotide kinase and [y-32p]ATp,47 and all the strips were then hybridized overnight at 42 ° with 2 x 10 6 counts/min (cpm) of the 32p-labeled probe per ml in 20% formamide buffer containing 10% dextran sulfate. Variations in the stringency of the Southern blot screening were achieved by varying the temperature of the solution used to wash the blot strips. After the overnight hybridization, all strips were washed 3 times at room temperature in 1 x SSC, 0.1% sodium dodecyl sulfate (SDS) (15 min per wash). Individual strips were then washed in the same buffer for 10 min at 37°, 45 °, 50 °, 55 °, or 65 ° and exposed for 5 days at - 8 0 ° to autoradiographic film backed with an intensifying screen. The results for the highest three wash temperatures are shown in Fig. lB. Using either 50° or 55 ° as the wash temperature, a number of hybridizing fragments were detected, including a doublet of approximately 10 kilobases (kb) in the EcoRI-digested DNA. One of the bands of the doublet presumably corresponded to the 10.6-kb EcoRI fragment of the bovine aFGF gene predicted from the restriction map of the genomic clone hBA2 (it was expected that no PstI fragment from the aFGF gene would be detected under these conditions, since there is a PstI site in the aFGF gene that divides the probe region approximately in hal0. The strip washed at 65 ° showed only one of the two approximately 10-kb EcoRI fragments, as well 47 R. B. Wallace and C, G. Miyada, this series, Vol. 152, p. 432.

genomic DNA (10/zg per lane) was digested with EcoRI (R) or PstI (P), fractionated on a 0.8% agarose gel, and then transferred to nitrocellulose. Strips of the nitrocellulose were hybridized to the homology-choice probe as described in the text, then washed in 1 × SSC, 0.1% SDS at the temperature indicated. Autoradiographs of the washed filter strips are shown. Size markers (bacteriophage h DNA digested with EcoRI and HindlII) are in kilobases. (Reprinted from Abraham et al.25; copyright 1986 by the AAAS.)

102

FIBROBLAST GROWTH FACTOR

[10]

as a 3.5-kb PstI fragment. It was assumed that these fragments corresponded to portions of the bFGF gene. Using the conditions established from the Southern analyses (hybridization at 42 ° in 20% formamide buffer containing 10% dextran sulfate; final wash at 65 ° in I x SSC, 0.1% SDS), a bovine pituitary cDNA library 25 constructed in the bacteriophage vector hgtl0 was screened with the 32p_ labeled homology-choice probe. A single hybridizing phage was detected out of 106 recombinants screened; this phage (hBB2) was isolated, and fragments of the cDNA insert were subcloned into MI3 vectors 48'49 for sequencing by the dideoxynucleotide method. 44,45The results of the nucleotide sequencing (Fig. 2) demonstrated that the clone contains a potential translation initiation (ATG) codon at nucleotides 104-106, followed by a 154-codon open reading frame terminating with a TGA codon at nucleotides 569-571. Direct amino acid sequencing of bovine pituitary bFGF by Esch et al. 14 had initially indicated that the mature protein consists of 146 residues (corresponding to residues 10-155 in the predicted primary translation product shown in Fig. 2). Subsequent experiments, however, demonstrated that a longer, amino-terminally blocked form of bFGF could be obtained from the pituitaries if protease inhibitors were present during the isolation. 5° Amino acid composition data indicated that the blocked form consists of 154 residues (amino acids 2-155 in Fig. 2). Klagsbrun et al. 51'52 also reported the existence of a longer, amino-terminally blocked form of bFGF, when neutral extraction conditions were used on the human hepatoma cell line SK-HEP-1. By analogy with a F G F , 53'54 and from the results of recombinant bFGF studies in the yeast Saccharomyces cerevisiae, 36 it is likely that the blocking group is an amino-terminal acetylation. In contrast, an unblocked amino-terminally extended form of bFGF (initiating Ala-Ala-Gly-Ser-Ile-) was obtained when the protein was extracted in the presence of protease inhibitors from human prostate tissue. 55Taken 48 j. Messing and J. Vieira, Gene 19, 269 (1982). 49 C. Yanisch-Perron, J. Vieira, and J. Messing, Gene 33, 103 (1985). 50 N. Ueno, A. Baird, F. Esch, N. Ling, and R. Guillemin, Biochem. Biophys. Res. Commun. 138, 580 (1986). 5i M. Klagsbrun, J. Sasse, R. Sullivan, and J. A. Smith, Proc. Natl. Acad. Sci. U.S.A. 83, 2448 (1986). 52 M. Klagsbrun, S. Smith, R. Sullivan, Y. Shing, S. Davidson, J. A. Smith, and J. Sasse, Proc. Natl. Acad. Sci. U.S.A. 84, 1839 (1987). 53 W. H. Burgess, T. Mehlman, D. R. Marshak, B. A. Fraser, and T. Maciag, Proc. Natl. Acad. Sci. U.S.A. 83, 7216 (1986). 54 j. W. Crabb, L. G. Armes, S. A. Carr, C. M. Johnson, G. D. Roberts, R. S. Bordoli, and W. L. McKeehan, Biochemistry 25, 4988 (1986). 55 M. T. Story, F. Esch, S. Shimasaki, J. Sasse, S. C. Jacobs, and R. K. Lawson, Biochem. Biophys. Res. Commun. 142, 702 (1987).

[10]

RECOMBINANT BASIC FGF

CCGGGGCCGC GCCGCGGAGC

103

G C G T C G G A G G C C G G G G C C G G G G C G C G G C G G C T C C C C G C G C GGCT

Neol CCAGGG GCTCGGGGAC

CCCGCCAGGG CCTTGGTGGG G

~

C C GCC G G G A G C ATC ACC Met Ala A l a G l y Set Ile ThE 1

A C G CTG C C A GCC CTG CCG G A G GAC GGC GGC A G C GGC GCT TTC CCG CCG GGC CAC Thr Leu Pro A l a Leu Pro Glu A s p G l y G l y Set Gly Ala Phe Pro Pro Gly His I0 20

Hhol TTC A A G GAC CCC A A G CGG CTG TAC TGC A A G A A C GGG GGC TTC TTC CTG CGC' ATC Phe Lys A s p Pro Lys A r g Leu Tyr Cys Lys A s n Gly Gly Phe Phe Leu Arg lle 30 40 CAC CCC G A C GGC C G A G T G GAC GGG GTC CGC G A G A A G A G C GAC CCA CAC A T C A A A His Pro A s p G l y A r g Val A s p Gly Val Arg Glu Lys Set A s p Pro His Ile Lys 50 60 CTA C A A C T T C A A G C A G A A G A G A G A GGG G T T G T G TCT A T C A A A G G A G T G TGT GCA Leu Gln Leu G l n A l a Glu Glu A r g Gly Val Val Set Ile Lys Gly Val Cys Ala

70 A A C CGT TAC CTT G C T A T G A A A G A A GAT G G A A G A TTA C T A GCT TCT A A A TGT GTT Asn A r g Tyr Leu A l a Met Lys Glu A s p Gly A r g Leu Leu Ala Set Lys Cys Val 80 90 A C A G A C G A G TGT TTC T T T TTT G A A CGA TTG G A G TCT A A T A A C TAC A A T A C T TAC Thr A s p G l u Cys Phe Phe Phe G l u A r g Leu Glu Set A s n A s n Tyr A s n Thr Tyr 100 110 CGG TCA A G G A A A TAC TCC A G T TGG TAT GTG G C A CTG A A A C G A A C T G G G CAG TAT A r g Set A r g Lys Tyr Set Set Trp Tyr Val A l a Leu Lys A r g Thr Gly Gln Tyr 120 130 A A A CTT G G A CCC A A A A C A G G A CCT G G G CAG A A A GCT A T A CTT TTT CTT CCA ATG Lys Leu Gly Pro Lys Thr G l y Pro G l y Gln Lys Ala Ile Leu Phe Leu Pro Met 140 150 TCT G C T A A G A G C TGA T C T T A A T G G C A G C A T C T G A T Ser Ala Lys Set

CTCATTTTAC ATGAAGAGGT ATATTTC

FIG. 2. Partial nucleotide sequence of the cDNA insert in the bovine bFGF clone hBB2. Only 618 bases of the 2122-base pair (bp) insert are shown (the bases not shown represent 3'-untranslated sequence). Given below the nucleotide sequence is the amino acid sequence of the primary translation product predicted from the 155-codon open reading frame initiating with the ATG codon at nucleotides 104-106. Boxed sequences indicate changes made in the insert by in vitro mutagenesis during construction of the human bFGF expression vector (see text). The underlined region between the indicated N c o I and HhaI restriction sites was replaced by the synthetic sequence shown in Fig. 4A in a subsequent step in the construction of the vector. t o g e t h e r , t h e s e o b s e r v a t i o n s i n d i c a t e t h a t the 146-residue f o r m o f b F G F and other shorter forms are generated during the course of purification, w h i l e t h e 1 5 4 - r e s i d u e f o r m o f t h e p r o t e i n (with o r w i t h o u t a c e t y l a t i o n ) r e p r e s e n t s a t r u e m a t u r e b F G F s p e c i e s (see Fig. 3). Structure of Human Basic Fibroblast Growth Factor Coding Region Using unique-sequence probes derived from the hBB2 bovine cDNA insert, human bFGF clones were obtained from a number of cDNA and

104

[10]

FIBROBLAST GROWTH FACTOR - 5 5 - A 6 -41

I

2 I0

25

60

9q/96

155

I1( CTG CTG Cl"G

k

AT~ (oo,tyJ)

I Intmn

1

TeA

Intron

FIG. 3. Schematic diagram of the translated region in human bFGF mRNA. Codons within the translated sequence are numbered relative to the proposed initiating ATG codon at position 1. A TGA translation stop signal occurs immediately following codon 155. Current evidence suggests that translation of the open reading frame extending from codons 1-155 yields a primary translation product that is processed to mature bFGF through the removal of the initiating methionine (and, in at least some cases, acetylation of the new amino terminus). Forms o f b F G F with amino termini corresponding to positions l0 or 251'14probably result from proteolytic digestion during purification. Recent results 29,35 have shown that translation can also initiate at three CTG codons, lying at positions - 4 1 , - 4 6 , and - 5 5 in the continuing open reading frame upstream from the ATG start at codon I. In the human bFGF gene, the coding region is interrupted by two large introns, one lying within codon 60 and one lying between codons 94 and 95. 26

genomic libraries. 26 Subsequently, the isolation of human clones was also reported (i) using partial codon-choice oligonucleotide probes, based on the bovine b F G F amino acid sequence, to screen a human foreskin fibroblast cDNA library 27 and (ii) using fully degenerate, short oligonucleotide probes, based on amino acid sequence data from human placental bFGF, to screen an SK-HEP-1 cDNA library. 28 Initial sequence analyses 26 indicated that, as with bovine bFGF, the human bFGF coding region predicts a 155-residue primary translation product (Fig. 3). This product differs by only two amino acids from the proposed bovine primary translation product (at residues 121 and 137; Fig. 2). In the bovine and human bFGF cDNA sequences, the open reading frame extends for a considerable distance 5' to the proposed initiating ATG indicated in Figs. 2 and 3. One argument nonetheless supporting the proposal of a 155-residue primary translation product for human bFGF was that no other in-frame ATG codons exist in this 5' region before an in-frame translation termination codon is encountered. 26 However, subsequent results from a number of different groups demonstrated that forms of bFGF exist that are longer than 155 residues. 3-5 Recently, two g r o u p s 29'35 have presented evidence indicating that these longer forms arise through unusual translation initiations occurring at CTG (leucine) codons, lying 41, 46, and 55 codons 5' to the proposed ATG start. Since these experiments also indicated that translation initiation can occur at the proposed ATG start, there appear to be four possible primary translation products for human bFGF, extending 155, 196, 201, and 210 residues in

[10]

RECOMBINANTBASICFGF

105

length (Fig. 3). No differences in bioactivity have yet been demonstrated for the various forms. Surprisingly, despite the existence of cell-surface receptors for b F G F (suggesting extracellular interaction between the receptor and bFGF molecules), none of the primary translation products for this factor has a classic secretion signal sequence. Recombinant Expression of Human Basic Fibroblast Growth Factor Vector for Expression of Human Basic Fibroblast Growth Factor in Escherichia coli We have used plasmid vectors with the general structure shown in Fig. 4B to produce various lengths and analogs of recombinant human bFGF in soluble form in E. coli, often at levels of expression exceeding 5% of the total protein in crude cell lysates. The first form of human bFGF produced was the 155-residue primary translation product that initiates at the ATG codon indicated in Fig. 3. The cDNA sequence used to encode this primary translation product was derived through a series of modifications from the bovine bFGF cDNA insert carried in the recombinant phage hBB2 (Fig. 2). In the first modification step, in vitro mutagenesis 56 was used to alter the codons for amino acid residues 121 and 137 [from TCC (serine) to ACC (threonine), and CCC (proline) to TCC (serine), respectively], so that the cDNA would encode human bFGF (see Fig. 2). A second round of in vitro mutagenesis was then carried out to create a HindlII restriction site (AAGCTT) 34 bp downstream from the translation stop codon. As a result of these steps, the coding region for the 155-residue form of human bFGF could be isolated as a 503-bp NcoI-HindlII fragment (Fig. 2). Since the amino-terminal portion of this coding region had a high G/C content (70.4% G + C in the first 125 bp), the coding region was digested with HhaI, and the amino-terminal portion was replaced with the synthetic sequence shown in Fig. 4A (encoding the same amino acids, but lowering the G/C content to 54.4%). In the synthetic sequence, the initiating ATG of the coding region is contained within an NdeI site, and the final bFGF coding sequence was therefore isolated as a 503-bp NdeI-HindlII fragment. To create the vector pTsF-9dH3 (Fig. 4B), the 5' end of the 503-bp NdeI-HindlII bFGF fragment was first ligated to a synthetic 86-bp fragment (stippled box in Fig. 4B), which consists of bases - 56 to + 22 of the trp promoter/operator region 57 flanked by EcoRI and NdeI linkers on the 56 M. J. Zoller and M. Smith, this series, Vol. 100, p. 468. 57 G. N. Bennett, M. E. Schweingruber, K. D. Brown, C. Squires, and C. Yanofsky, J. Mol. Biol. 121, 113 (1978).

106

FIBROBLAST GROWTH FACTOR

[10]

A Nde I CATAT~GCTGCTGGTTCTATCACTACCCTGCCAGCTCTGCCAGAAGACC_~TGGTTCTGGTGCC MetAlaAlaGlySerlleThrThrLeuProAlaLeuProGluAspGlyGlySerGlyAla. . . . . . . . Ml~l TTCCCACCAGGTCACTTCAAAGACCCAAAACGTCTGTACTGCAAAAACGGTGGTTTCTTCCT~--~ "I PheProProGlyHisPheLysAspProLysArgLeuTyrCysLysAsnGlyGlyPhePheLeu

B Pvu/

~

~ ~ :

\~ \

/ Hindm'

IdI3"~FGF~

BarnHI

TsF" 3.2kb trpp/ot~NdeZ Ioc

_.

EcoRZ

y

~ / ~ BomHI \

Pvu~

[Hind~l']

FiG. 4. Expression vector for recombinant bFGF production in E. colL (A) Synthetic nucleotide sequence used to replace the G/Codch amino-terminal end of the bFGF coding region in the clone hBB2 (underlined sequence in Fig. 2). The amino acids encoded by this sequence are the sameas those encoded by the replaced segment. (B) The expression plasmid pTsF-9dH3, in which expression of the 155-residue precursor form of human bFGF (long solid box) is controlled by the E. coli trp operon promoter/operator sequence (stippled box). The rrnB 5 S ribosomal RNA gene and transcription terminators Tr and T2 (hatched box), as well as the 5' end of the/3-1actamase gene (AmpR), are derived from the plasmid pKK233-2. The remainder of the plasmid is derived from pUC9. The expanded segment indicates the polylinker region of pUC9; in pTsF-9dH3, the HindllI restriction site in the polylinker has been eliminated.

5' and 3' ends, respectively. The 3' end of the bFGF fragment was ligated to a HindlII-PvuI fragment ofpKK233-258 containing the two transcription termination signals from the 3' end of the rrnB locus (hatched box in Fig. 4B). The resulting composite sequence was then ligated between the EcoRI and PvuI sites of a derivative of pUC959 (in which the HindlII site in the polylinker had been destroyed by filling in the cohesive ends of the cleaved site and religating the blunt ends). Analogs of the 155-residue form of human bFGF have been expressed 5s E. Amann and J. Brosius, Gene 40, 183 (1985). 59j. Vieira and J. Messing, Gene 19, 259 (1982).

[10]

RECOMBINANT BASIC F G F

107

by replacing the b F G F cDNA segment in pTsF-9dH3 with DNA segments encoding the altered protein sequences of interest. The results presented below to illustrate research-scale production, purification, and analytical techniques for recombinant bFGF were derived from experiments on one such analog, in which the second amino acid of the 155-residue form of the factor had been deleted. The modified version of pTsF-9dH3 encoding this analog is referred to as pTsF-9dH3-154. Various bacterial host strains have been used to express the human bFGF encoded by pTsF-9dH3 and its derivatives. In the experiments described below, the host strain used was E. coli B (American Type Culture Collection, strain 23848, Rockville, MD). Growth and Lysis o f Escherichia coli Cells Expressing Human Basic Fibroblast Growth Factor To initiate research-scale production of the 154-residue primary translation product described above, a single colony of E. coli B containing pTsF-9dH3-154 is used to inoculate 50 ml of LB medium 6° supplemented with 50/zg/ml ampicillin. The culture is grown overnight at 30° to stationary phase, and 10 ml/liter is then used to inoculate four l-liter batches of supplemented minimal medium (M9 medium 6° containing 0.4% glucose, 2 /zg/ml thiamin, 0.5% casamino acids, 0.1 mM CaCI2, 0.8 mM M g S O 4 , and 50/~g/ml ampicillin). The l-liter cultures are incubated with shaking in triple-baffled 2.8-liter Fernbach flasks at 30° until the optical density of the cultures (monitored at 550 nm) reaches 0.5-0.7. At this point, 50 mg of 3/3-indoleacrylic acid (Sigma, St. Louis, MO) in 10 ml of ethanol is added to each culture to induce the trp promoter 61 on the expression plasmid. The cultures are then incubated with shaking for an additional 16 to 24 hr at 30°. The cells are collected by centrifugation for 15 min at 5000 rpm (7000 g) in a Sorvall RC-3B centrifuge equipped with an H-6000A rotor (Du Pont, Wilmington, DE). The cell pellet from each l-liter culture is resuspended in a minimum volume of deionized water ( - 2 0 ml). The cell suspensions from the four l-liter cultures are then combined and centrifuged for 15 min at 9000 rpm (10,000 g) in a Sorvall SS-34 rotor. If desired, the resulting cell pellet may be quick-frozen in liquid nitrogen and stored at - 8 0 ° for purification at a later time. A crude cell lysate is prepared from the fresh or frozen cell pellet by first resuspending the pellet in 100 ml of 20 mM sodium phosphate (pH 6o j. Sambrook, E. F. Fritsch, and T. Maniatis, "Molecular Cloning: A Laboratory Manual." Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989. 61 W. F. Doolittle and C. Yanofsky, J. Bacteriol. 95, 1283 (1968).

108

FIBROBLAST GROWTH FACTOR

[10]

7.0) containing 5 mM EDTA and 1 mM phenylmethylsulfonyl fluoride (Boehringer Mannheim, Indianapolis, IN). Lysozyme (Sigma) is then added to a final concentration of 0.5 mg/ml, and the suspension is incubated on ice for 30 min. In some cases, the mixture has been observed to become so viscous that it appears semisolid; in these cases, more resuspension buffer is added. After lysozyme treatment, the cell suspension is sonicated on ice using an Ultrasonics (Farmingdale, NY) Model W-225R cell disruptor (set to a power level of 4; 50% pulsed cycle; 0.5inch diameter probe). The sonication is carried out in ten 1-min intervals with a l-min cooling period between each interval. Bovine pancreatic RNase A (Sigma) and bovine pancreatic DNase I (Boehringer-Mannheim) are each added to a final concentration of 1 /xg/ml, and the solution is incubated for 30 min on ice. Cell debris is then removed by centrifugation in an SS-34 rotor at 15,000 rpm (29,000 g) for 30 min at 4 °. The pellet is discarded, and the supernatant (crude lysate) is retained at 4 ° for chromatography.

Purification of Recombinant Basic Fibroblast Growth Factor Once the crude lysate has been prepared, the purification of bFGF can be accomplished by a two-step procedure. The first step, ion-exchange chromatography carried out on SP-Sephadex C-25 resin (Pharmacia, Piscataway, NJ), results in a dramatic reduction in contaminating proteins. The protein is eluted from the column in a stepwise fashion, as gradient elution has not been observed to improve the degree of purification. HeparinSepharose (Pharmacia) is used for the second step in the purification. This chromatographic resin has been previously established as an efficient tool in the isolation of bFGF from natural s o u r c e s , 1-4'62'63 and its use in this procedure results in a final purification of the protein to greater than 97%, as judged by SDS-polyacrylamide gel electrophoresis (SDS-PAGE). To prepare the SP-Sephadex C-25 column, the resin is first rehydrated according to the manufacturer's recommendations. In addition, we routinely precycle the resin with acid and base washes before use to ensure that the resin is in the fully ionized form, 64 After precycling, the resin is equilibrated in column buffer [20 mM sodium phosphate (pH 7.0), 5 mM EDTA, 0.1 M NaCI]. The crude lysate supernatant obtained from 4 liters of the expression cell culture (i.e., from - 2 8 g of cell paste) is fractionated using 14 ml of SP-Sephadex in a 2.5 cm diameter column. This chromatography step and all subsequent purification steps are carried out at 4 °. The crude cell lysate 62 M. Klagsbrun, R. Sullivan, S. Smith, R. Rybka, and Y. Shing, this series, Vol. 147, p. 95. 63 D. Gospodarowicz, this series, Vol. 147, p. 106. 64 T. G. Cooper, "The Tools of Biochemistry," p. 144. Wiley, New York, 1977.

[10]

RECOMBINANTBASICFGF

109

is loaded onto the column with a peristaltic pump at a flow rate of 2 ml/min, and the eluate is monitored at 280 nm with an in-line UV detector. After the crude lysate has been completely loaded, the column is washed with the initial column buffer until the absorbance of the eluate returns to baseline level. The eluant is changed to 20 mM sodium phosphate (pH 7.0) containing 5 mM EDTA and 0.6 M NaCI, and the peak of eluting material as judged by absorbance is collected. For the next step of the purification, 10 to 15 ml of heparin-Sepharose, prepared according to the manufacturer's recommendations, is packed into a 2.5 cm diameter column. The column is equilibrated with 20 mM sodium phosphate (pH 7.0) containing 5 mM EDTA and 0.6 M NaC1. The material that eluted from SP-Sephadex at 0.6 M NaCI is loaded onto the column at 2 ml/min with a peristaltic pump. Protein elution from the column is monitored at 280 nm as described above. After loading, the column is washed with 20 mM sodium phosphate (pH 7.0) containing 5 mM EDTA and 0.6 M NaCI until the absorbance of the eluate returns to baseline. The recombinant bFGF bound to the column is then eluted with 20 mM sodium phosphate (pH 7.0) containing 5 rnM EDTA and 2.0 M NaCI. We have found that the above procedure is effective for the purification of bFGF and most mutant forms of the protein we have tested, including a variety of amino-terminal truncations and extensions as well as many point mutations. It should be noted, however, that single codon changes in the bFGF coding sequence can result in dramatic differences in the level of expression of the recombinant protein. The protocol described here is able to accomodate the purification of at least 150 mg of recombinant bFGF from 4 liters of starting culture. Analysis o f Recombinant Basic Fibroblast Growth Factor

Three methods of analysis are used for determining the purity of the recombinant protein: reversed-phase HPLC, heparin-TSK HPLC, and SDS-PAGE. Although reversed-phase HPLC and SDS-PAGE are commonly used laboratory procedures, they are discussed in this chapter because the sulfhydryl chemistry of recombinant human bFGF as produced in E. coli is such that the protein can appear artifactually impure by these two techniques (and by heparin-TSK HPLC), owing to apparent disulfide-mediated heterogeneity. 39'65'66 In addition to these physical analyses for purity, recombinant bFGF 65s. A. Thompson,J. W. Rose, J. Hatch, T. M. Palisi, D. I. Blumenthal,K. Y. Sato, J. C. Fiddes, and A. A. Potter, unpublishedobservations (1989). 66M. Seno, R. Sasada, M. Iwane, K. Sudo, T. Kurokawa,K. Ito, and K. Igarasbi,Biochem. Biophys. Res. Commun. 151, 701 (1988).

1I0

FIBROBLASTGROWTHFACTOR

[10]

preparations are also routinely tested for bioactivity in a proliferation assay utilizing capillary endothelial c e l l s . 67 Reversed-Phase HPLC. Reversed-phase HPLC analysis of the protein is generally performed using a Vydac C4 column purchased from The Separations Group (Hesperia, CA), but recombinant bFGF behaves in a similar fashion on a C~8 HPLC column. The Vydac C4 HPLC column (25 cm × 4.6 mm) is equilibrated with 30% acetonitrile in 0.1% trifluoroacetic acid, using a flow rate of 1 ml/min. The eluate is monitored at 220 nm. Recombinant bFGF (20-100/zg) is applied to the column and is then eluted with a 30-min gradient of 30 to 45% acetonitrile in 0.1% trifluoroacetic acid. Under these conditions, the protein will elute at approximately 29 min. Small peaks of absorbance detected at earlier times in the gradient elution appear to be due at least in part to disulfide-mediated microheterogeneity rather than to the presence of contaminants, since treatment of the sample with 20 mM dithiothreitol for 15 min at room temperature eliminates the majority of these species. Heparin-TSK HPLC. The purity of the protein can also be judged using heparin-TSK HPLC, as has been noted by others. 66A liquid chromatography system [such as the fast protein liquid chromatography (FPLC) system from Pharmacia] capable of accommodating high sodium chloride concentrations is advisable for this type of chromatography, in order to avoid damage to the pumping system. For analysis of the recombinant human bFGF, a heparin-TSK column (7.5 cm x 7.5 mm, Novex, Encinitas, CA) is equilibrated at a flow rate of 1 ml/min in 20 mM Tris-HCl (pH 7.5) containing 0.72 M NaC1. The eluate is monitored at either 220 or 280 nm. A sample (generally 20/zg) of recombinant bFGF is loaded onto the column and then eluted with a multilinear NaC1 gradient in 20 mM Tris-HC1, pH 7.5 (0.72 to 1.2 M NaC1 over I min, then 1.2 to 3 M NaC1 over 23 min). The monomeric recombinant protein elutes at approximately 13 min in this system (Fig. 5A). Before reuse, the column is washed for 5 min with the 3 M NaC1 buffer and is then reequilibrated with the 0.72 M NaC1 buffer. With storage at 4 ° in buffers such as 20 mM Tris-HC1 (pH 7.5) containing 1.5 M NaC1, the structure of the recombinant bFGF has been observed to change such that progressively less of the protein elutes from the heparin-TSK HPLC column as the 13-min peak, and peaks of more retained species appear in the analysis (Fig. 5B). The heterogeneity appears to originate through disulfide bond formation, since the more retained species can be reduced or eliminated by treatment with dithiothrei67 D. Gospodarowicz, S. Massoglia, J. Cheng, and D. K. Fujii, J. Cell. Physiol. 127, 121 (1986).

[10]

RECOMBINANT BASIC FGF

111

A

B

o•

51

~0 ~

~5~

Time

20 r

25~

30 T

{rain)

FIG. 5. Heparin-TSK HPLC analysis of a sample of purified recombinant bFGF that has undergone a significant degree of multimerization. Chromatography was carried out on a 7.5 cm × 7.5 mm column either after (A) or before (B) reduction with dithiothreitol. The sample analyzed here was placed for several days at 4° in 20 mM Tris-HCl (pH 7.5), 1.5 M NaC1 to allow the multimerization to occur; the product obtained directly from the purification procedure described in this chapter generally chromatographs almost entirely as the 13-min (monomer) peak.

112

FIBROBLASTGROWTHFACTOR

[10]

tol (compare Fig. 5B with 5A) or by mutation of the recombinant bFGF to eliminate the cysteines at residues 78 and 96 (see Fig. 2). 39,65,66 Nonreducing S D S - P A G E analyses conducted after iodoacetamide treatment of the samples (see below), along with the results of gel-filtration chromatography studies, 65have indicated that the later-eluting species in the heparinTSK HPLC analysis represent multimers o f b F G F molecules (dimers elute at - 1 8 min, and trimers at 21 min; subsequent peaks are heterogeneous mixtures of forms of trimer size or greater). Taken together, these observations indicate that the heterogeneity detected by heparin-TSK HPLC is due to intermolecular disulfide bond formation. SDS-Polyacrylamide Gel Electrophoresis. SDS-PAGE is carried out with a 15% acrylamide gel containing 0.5% bisacrylamide according to the procedure of Laemmli. 68 The gel dimensions are normally 5 x 8.2 cm (length by width), with a thickness of 0.75 mm. The amount of protein loaded onto the gel will vary according to the staining technique, but 10 /zg of protein for a Coomassie-stained gel and 1/zg for a silver-stained gel is sufficient to determine purity. Two points should be kept in mind when analyzing recombinant bFGF by this technique. First, protocols for the use of SDS-PAGE generally call for heating the protein in SDS-PAGE sample loading buffer for 3 to 5 min at 95 °. We have found that recombinant bFGF will partially degrade to lower molecular weight fragments under these conditions, so that after staining of the gel the protein sample appears to contain contaminating species (Fig. 6, lane 3). Partial degradation after heating in SDS-containing buffers has also been reported in other proteins. 69 This problem can be circumvented by eliminating the heating step prior to loading of the sample on the gel (Fig. 6, lane 2). The second precaution to be taken when using SDS-PAGE concerns interpretation of the results of gel analyses when reductants have not been included in the S D S - P A G E sample loading buffer. As mentioned above, intermolecular disulfide bonds appear to form between recombinant bFGF molecules under some conditions, 39'65'66 generating higher molecular weight, multimeric forms of the protein. With other proteins, comparisons of nonreducing and reducing SDS-PAGE have commonly been used to identify such forms. With recombinant bFGF, however, we have found that in the absence of reducing agents the heterogeneous forms can still appear predominantly as monomeric bFGF on SDS-PAGE analysis, presumably owing to thiol-disulfide rearrangements occurring once the protein has been unfolded by the SDS in the sample loading buffer. These 6s U. K. Laemmli, Nature (London) 227, 680 (1970). 69 j. Rittenhouse and F. Marcus, Anal. Biochem. 138, 442 (1984).

[10]

RECOMBINANTBASICFGF

I

2

5

113

4

FIG. 6. Heat-induced degradation of bFGF. Samples were fractionated by reducing SDS-PAGE and then visualized by silver staining of the gel. Lanes 1 and 4, molecular weight markers [phosphorylase B (97.4 kD), bovine serum albumin (66.2 kD), ovalbumin (42.7 kD), carbonic anhydrase (31.0 kD), soybean trypsin inhibitor (21.5 kD), and lysozyme (14.4 kD)]; lane 2, 6/~g of recombinant bFGF, loaded in SDS-PAGE sample loading buffer without heat treatment; lane 3, 6/zg of recombinant bFGF, heated to 95° for 10 min in SDS-PAGE sample loading buffer prior to application to the gel.

rearrangements can be blocked by the inclusion of 500 mM iodoacetamide in the sample loading buffer, which will carboxymethylate the free cysteines that otherwise might participate in thiol-disulfide exchange reactions. Lower concentrations of iodoacetamide may be used successfully in this type of analysis, but less than 200 mM is not recommended. If it is desirable to precipitate a recombinant bFGF sample with trichloroacetic acid (TCA) prior to addition of nonreducing SDS-PAGE loading buffer (e.g., to concentrate the protein or to reduce the salt concentration in the sample), then carboxymethylation of the protein in the presence of a denaturant should be performed prior to the precipitation step. Such carboxymethylations are carried out by mixing the protein sample with an equal volume of 1 M iodoacetamide in 8 M urea and incubating for 5 min at room temperature. TCA can then be added to a final concentration of 10% to precipitate the bFGF. After 3 min on ice, the protein is pelleted by centrifugation in a microcentrifuge for 3 min. The pellet is washed with 0.2 ml of acetone and is then resuspended in nonreducing SDS-PAGE sample buffer. An example of this technique is shown in Fig. 7. The sample analyzed in this experiment was isolated from a preparation of recombinant bFGF

114

FIBROBLASTGROWTHFACTOR I

97.4 66.2 42Z

2

5

4

[10] 5 ~ii!J!!i~!ii:i !!~!ii!iii:::~ii:i

:51.0 21.5 M..4~

FIG. 7. SDS-PAGE analysis of the form of bFGF eluting at 21 min from the heparin-TSK HPLC column, with or without treatment with iodoacetamide prior to electrophoresis. Lane 1, molecular weight markers, applied to the gel in nonreducing sample loading buffer; lane 2, bFGF sample precipitated with TCA and resuspended in nonreducing SDS-PAGE sample loading buffer before electrophoresis; lane 3, bFGF sample treated with iodoacetamide as described in the text, prior to TCA precipitation and resuspension in nonreducing SDS-PAGE sample loading buffer; lane 4, bFGF sample treated as in lane 3, except that 10% 2-mercaptoethanol was added to the sample loading buffer; lane 5, bFGF sample treated as in lane 2, except that the precipitated sample was resuspended in the sample loading buffer containing 10% 2-mercaptoethanol.

that had undergone a significant degree of multimerization, as judged by heparin-TSK chromatography. The protein eluting from the heparin-TSK column at approximately 21 min (third peak; see Fig. 5B) was collected and shown by heparin-TSK HPLC analysis to reelute at the same position in the gradient. When a sample of this 21-min peak form of bFGF was precipitated with TCA and resuspended in nonreducing loading buffer prior to S D S - P A G E analysis, the protein migrated predominantly at the apparent molecular weights expected for the monomer and dimer forms of bFGF (Fig. 7, lane 2). In contrast, when the sample was first treated with iodoacetamide and urea as described above before precipitation with TCA, the protein migrated predominantly at the molecular weight expected for a trimeric form of bFGF (Fig. 7, lane 3). To demonstrate that the higher molecular weight forms observed in lanes 2 and 3 are due to the presence of disulfide bonds in the loaded protein sample, the bFGF isolated as the 21-min peak from heparin-TSK chromatography was again precipitated with TCA, with or without prior iodoacetamide treatment as in lanes 3 and 2, but was resuspended in sample loading buffer containing 10% 2-

[10]

RECOMBINANT BASIC F G F

115

mercaptoethanol before electrophoresis on the SDS gel (lanes 4 and 5, respectively). Under these conditions, the bFGF in both cases migrated almost entirely as the monomeric form. Bioassay. The activity of the recombinant bFGF is measured in a cell proliferation assay. The target cells used in the assay, bovine adrenal cortex capillary endothelial (ACE) cells, were obtained from D. Gospodaro w i c z . 67 For passaging, 2.5 × 105 cells (-2.5% of the cells from a confluent T-75 flask) are seeded in a T-75 flask in 15 ml of growth medium [Dulbecco's modified Eagle's medium (DMEM-21 ; Mediatech, Washington, D.C.) supplemented with 10% calf serum (Hyclone, Logan, UT), 2 mM L-glutamine (GIBCO, Grand Island, NY), 50 IU/ml penicillin (GIBCO), and 50 /zg/ml streptomycin (GIBCO)]. The flask is then incubated at 37° in a humidified atmosphere containing 10% CO2. Basic FGF (1 ng/ml) is added on the day of seeding (day 0) and 2 days later. By day 4, the cells have reached confluence. No further additions o f b F G F are made until the cells are split again (on day 7). For the assay, the day 7 cells are removed from the T-75 flask by first exposing the monolayer for 2-3 min to 1 ml of trypsin/EDTA in Hanks' buffered salt solution (calcium- and magnesium-free; GIBCO) and then adding 9 ml of growth medium to rinse the cells from the flask surface. An aliquot of the resulting cell suspension is diluted with growth medium to a concentration of 5 × 10s cells/well and used to seed 6-well tissue culture plates (2 ml/well). The cells are then incubated for at least 1 hr prior to addition of b F G F samples. Before addition to the cells, samples to be assayed are serially diluted at 4° in phosphate-buffered saline (PBS) containing 0.2% gelatin (Sigma). Aliquots (10/zl/well) of each dilution are then added to duplicate wells on the day of cell seeding (day 0) and are added again 2 days later. Control wells receive additions of the diluent alone (PBS containing 0.2% gelatin) to determine background growth of the cells in the absence of added bFGF. On day 4, the cells are exposed to 0.5 ml of trypsin/EDTA at 37 ° for 2-3 min, transferred to a vial containing 10 ml of isotonic saline solution, and counted in a Coulter particle counter. The cell counts from duplicate wells are averaged, and the averaged count from the background wells is substracted. For each sample, the average cell count for each dilution is divided by the highest average cell count obtained in that dilution series, so that the data are expressed as the percentage of the maximal proliferation induced by the sample. The data are then graphed as the percent maximal proliferation versus the log of the concentration of bFGF added to the wells on day 0. Relative activity between any two samples is judged by comparing the EDs0 values (i.e., the concentration of each sample needed in the assay wells to elicite 50% of maximal proliferation).

116

FIBROBLAST GROWTH FACTOR

lO

iO0

bFGF

iO00

[10]

iO000

{pglml)

FIG. 8. Endothelial cell proliferation assay of recombinant bFGF. Aliquots of serial dilutions of the bFGF analog described in the text were added to assay wells on the first day of the assay (day 0) and two days later; the amount of proliferation in each well was then determined on day 4 by counting the cells in a Coulter counter. Each point represents the average of the results from duplicate wells. Results are graphed as the percent of the maximal proliferation induced by the sample vs. the concentration of the recombinant bFGF added to the assay wells on day 0.

An example of the results obtained from assaying the recombinant bFGF analog described above (154-residue primary translation product) is given in Fig. 8. In this experiment, the EDs0 of the analog was calculated to be 242 pg/ml. Acknowledgments Much of the work described in this chapter was supported by Small Business Innovation Research Grants GM36762 and HL39348 from the National Institute of General Medical Sciences and the National Heart, Lung, and Blood Institute, respectively.