APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Apr. 1991, p. 1168-1172 0099-2240/91/041168-05$02.00/0 Copyright © 1991, American Society for Microbiology
Vol. 57, No. 4
Cloning of the Structural Gene for Clostridium botulinum Type C1 Toxin and Whole Nucleotide Sequence of Its Light Chain Component K. KIMURA, N. FUJII, K. TSUZUKI, T. MURAKAMI, T. INDOH, N. YOKOSAWA, AND K. OGUMA* Department of Microbiology, Sapporo Medical College, Sapporo 060, Japan Received 17 May 1990/Accepted 24 January 1991
The toxigenicity of Clostridium botulinum type C1 is mediated by specific bacteriophages. DNA was extracted from one of these phages. Two DNA fragments, 3 and 7.8 kb, which produced the protein reacting with antitoxin serum were cloned by using bacteriophage Agtll and Escherichia coli. Both DNA fragments were then subcloned into pUC118 plasmids and transferred into E. coli cells. The nucleotide sequences of the cloned DNA fragments were analyzed by the dideoxy chain termination method, and their gene products were analyzed by Western immunoblot. The 7.8-kb fragment coded for the entire light chain component and the N terminus of the heavy chain component of the toxin, whereas the 3-kb fragment coded for the remaining heavy chain component. The entire nucleotide sequence for the light chain component was determined, and the derived amino acid sequence was compared with that of tetanus toxin. It was found that the light chain component of Cl toxin possessed several amino acid regions, in addition to the N terminus, that were homologous to tetanus toxin.
The neurotoxins produced by Clostridium botulinum are, like tetanus toxin, among the most potent toxins in the natural world. The botulinum neurotoxins cause fatal intoxication in both animals and humans. They act at the tips of the motor nerve endings at the neuromuscular junction and inhibit the release of acetylcholine, leading to paralysis of the muscles. However, the detailed mode of action is still unknown. The botulinum toxins are classified into seven groups (A to G) on the basis of their antigenicity. They are produced as single polypeptide chains and are cleaved by endogenous proteases or trypsin to yield two subunits: a heavy chain (Hc; molecular weight 100,000) and a light chain (Lc; molecular weight 50,000) (1). Individually, they are nontoxic, and little information is available about the function of each. We have confirmed that the production of C1 and D toxins is governed by temperate bacteriophages (9). By using synthetic oligonucleotide probes constructed from knowledge of the N-terminal amino acid sequence of the Lc component, we also showed that these temperate bacteriophages carry the structural genes for botulinum toxins (3). In this paper, the cloning of the structural gene for the toxin from one type C temperate phage, c-st, and the nucleotide sequence of the whole Lc component of the toxin are described.
hydrochloride [pH 7.4]), as reported previously (9). After the lysate was treated with DNase I and RNase A (each at 100 jig/ml) (Sigma Chemical Co., St. Louis, Mo.) at 37°C for 30 min, the phage was precipitated with 8% polyethylene glycol 6000-1 M NaCl at 4°C overnight. The precipitate was resuspended with PEG-resuspension buffer (10 mM Tris-HCl [pH 7.4], 10 mM MgCl2, 100 mM NaCl), and then the phage particles were extracted with an equal volume of chloroform. The aqueous phase thus obtained was treated with 0.02% proteinase K (Sigma Chemical Co.)-0.2% sodium dodecyl sulfate (SDS) at 37°C for 1 h. From this preparation, DNA was extracted with phenol and precipitated with ice-cold ethanol. Monoclonal and polyclonal antibodies against type C1 toxin. In this study, one monoclonal antibody (EL161-38, mouse) reacting with the Lc component of the toxin and three polyclonal antibodies (rabbit) reacting with whole toxin or with the Lc or Hc component were employed. All antibodies were prepared previously, and immunoglobulin G (IgG) fractions were obtained by column chromatography (10, 19). Before use, polyclonal antibodies were adsorbed three times with whole Escherichia coli cells to remove nonspecific antibodies. Cloning and subcloning. The phage DNA was digested with EcoRI (Takara Shuzo Co., Kyoto, Japan), ligated to the EcoRI site of Xgtll DNA (Promega Corp., Madison, Wis.), and then packaged in vitro by using Packagene (Promega Corp.). The gene library was plated on E. coli Y1090 (Promega Corp.) to give approximately 3,000 plaques per 87-mm-diameter plate. After 3 h of incubation at 42°C, nitrocellulose filter disks (Amersham International plc, Amersham, United Kingdom) saturated with 10 mM IPTG (isopropyl-,-D-thiogalactopyranoside) were overlaid on agar plates and left in contact for an additional 3 h at 37°C. Positive recombinant phage clones were selected with an antibody against whole C1 toxin by using the ProtoBlot Immunoscreening System (Promega Corp.). The isolated clones were amplified in 1 liter of 2x TY medium (1.6% [wt/vol] tryptone, 1% yeast extract, 0.5% NaCl [pH 7.6]).
=
MATERIALS AND METHODS Preparation of phage DNA. Phage c-st was induced from a
toxigenic C. botulinum type C strain, C-Stockholm, by mitomycin C treatment. The nontoxigenic variant (C)-A02, obtained from C-Stockholm by treatment with acridine orange, was used as an indicator strain. Acquired c-st phage was increased in titer by being passaged through an indicator strain, (C)-A02, in LYG medium (1% [wt/vol] lactalbumin hydrolysate, 2% yeast extract, 2% glucose, 0.15% cysteine *
Corresponding author. 1168
VOL. 57, 1991
Purification of phage particles and extraction of the recombinant phage DNAs were performed in the same ways as for c-st phage. The extracted DNAs were digested with EcoRI, and the resultant inserts were separated by preparative agarose gel electrophoresis. The DNA fragments obtained were then subcloned into the EcoRI site of the polylinker of plasmid pUC118 (Takara Shuzo Co.) (20). DNA sequencing. In an attempt to determine the DNA sequences of the long insertion fragments in the pUC118 plasmids, progressive unidirectional deletions of the inserted DNA fragments were created by using a Deletion Kit (Takara Shuzo Co.). DNA sequence analysis was performed by the dideoxy chain termination method with a-35S-dATP (NEN Products, Boston, Mass.) and a T7 sequencing kit (Pharmacia LKB Biotechnology, Uppsala, Sweden). Polymerase chain reaction. Instead of constructing the DNA libraries of c-st phage by using various restriction endonucleases in addition to EcoRI, the polymerase chain reaction (12) was employed to obtain overlapping clones. Two kinds of 20-mer oligonucleotides which were used as primers to amplify their flanking region on c-st phage DNA were synthesized according to the sequence data reported here. The amplification took place in 100-,ul reaction mixture containing 50 ng of c-st phage DNA in 25 mM TAPS
(N-tris[hydroxymethyl]methyl-3-aminopropanesulfonic acid)-HCl (pH 8.0), 50 mM KCI, 2 mM MgCl2, 1 mM 2-mercaptoethanol, primers at 1 ,uM, deoxynucleoside triphosphates (dATP, dGTP, dCTP, and dTTP) at 200 ,uM each, and 2.5 U of Taq DNA polymerase (Takara Shuzo Co.). The sample was overlaid with 2 drops of mineral oil to prevent condensation and subjected to 28 cycles of amplification as follows. The sample was heated to 94°C for 1 min, cooled to 40°C for 2.5 min, and heated to 72°C for 3 min. The ends of the amplified DNA fragments were converted to blunt-ended structures with T4 DNA polymerase by using a DNA blunting kit (Takara Shuzo Co.). The repaired fragments were cloned into the SmaI site of the pUC118 plasmid polylinker. The recombinant plasmids were sequenced as described above. Western immunoblot analysis. E. coli MV1184 cells (Takara Shuzo Co.) were transformed by the recombinant plasmids. The transformed cells were incubated in 50 ml of 2x TY medium at 37°C for 12 h. After centrifugation, the cells were resuspended in 5 ml of TEP buffer (100 mM Tris-HCl [pH 7.4], 10 mM EDTA, 1 mM phenylmethylsulfonyl fluoride), sonicated for about 5 min at 0°C to give clear fluids, and centrifuged (16,000 x g, 10 min). Aliquots (10 [L) of the resultant supernatants were electrophoresed on SDS12% polyacrylamide gels according to Laemmli's method (5), and the protein bands were electrotransferred onto nitrocellulose membranes (Bio-Rad Laboratories, Richmond, Calif.). The membranes were incubated with 10% skim milk in phosphate-buffered saline, pH 7.2, for 1 h at room temperature with gentle stirring. After the membranes were rinsed with T-TBS buffer (20 mM Tris-HCl [pH 7.5], 0.05% Tween 20, 0.5 M NaCl), they were incubated with diluted antitoxin IgGs for 1 h at room temperature. Thereafter, alkaline phosphatase anti-rabbit or anti-mouse IgG conjugates (Promega Corp.), diluted 1:7,500 with T-TBS, were reacted with the membranes for 30 min at room temperature. The membranes were washed, and then alkaline phosphatase activity was detected with nitroblue tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate for 2 to 10 min.
C. BOTULINUM TYPE C1 TOXIN GENE
anIIC 97K66K- --
1169
anffHc 410K
;i
43K-
31K-
FIG. 1. Analysis of the gene products of recombinant clones by Western blot. The inserted DNA fragments in Xgtll phages were recloned into plasmid pUC118 to give pCL8 and pCH3. E. coli MV1184 cells were transformed with these recombinant plasmids, cultured in 2x TY medium, and sonicated. The resultant lysates and purified C1 toxin were employed for Western blot analysis with antitoxin IgG. Anti-C1, Polyclonal anti-whole C1 toxin IgGs; antiLc, monoclonal anti-Cl Lc component IgG; anti-Hc, polyclonal anti-Cl Hc component IgGs.
Nucleotide sequence accession number. The nucleotide sequence has been submitted to the DDBJ/GenBank/EMBL data banks, with the accession number D90210.
RESULTS AND DISCUSSION Cloning of the structural gene for toxin. Purified c-st phage DNA was treated with EcoRI, ligated to Xgtll, and plated on E. coli Y1090. Thirty clones giving positive results with anti-C1 toxin IgG were selected by immunoscreening. The representative clones XCL-8 and XCH-3 were chosen for further investigation. The lengths of the inserted DNA fragments were 7.8 kb (XCL-8) and 3 kb (XCH-3). The insertion fragments of XCL-8 and XCH-3 were recloned into pUC118 plasmids to yield plasmids pCL8 and pCH3, respectively. The E. coli cells transformed with plasmid pCL8 produced a protein with a molecular weight of about 65,000 (L protein) which reacted with polyclonal anti-whole toxin and anti-Lc IgGs and with monoclonal anti-Lc IgG. The pCH3 transformant produced a protein with a molecular weight of about 74,000 (H protein) which reacted with polyclonal anti-whole toxin and anti-Hc IgGs (Fig. 1). These results indicated that pCL8 contained the structural gene for the Lc component and that pCH3 contained the structural gene for the Hc component. The orientation of the inserted DNA fragment in pCL8 did not affect the expression of L protein. In contrast, the inserted fragment in pCH3 lost its ability to produce H protein when its orientation was changed in plasmid pUC118 (data not shown). These results indicated that the gene for L protein encoded in pCL8 was transcribed independently of the lac promoter of the plasmid, whereas that for H protein was transcribed with the lacZ gene. Nucleotide sequence of the Lc component of Cl toxin. The whole L-protein gene cloned in the plasmid pCL8 was sequenced by using its deletion mutants. The nucleotide sequence and deduced amino acid sequence are presented in Fig. 2. The nucleotide sequence contained a single open reading frame coding for 545 amino acids, corresponding to a polypeptide with a molecular weight of 62,600. The derived N-terminal amino acid sequence was identical to that of the N-terminal peptides of the Lc component of C1 toxin, except
-282
-
AGTGGATGAGTGTATAATTATATATTAGACGGTACAGAAAATAT
-230
TTAGATATATCTCCTGAAATAATAGAATACAATTAGTAAGTTCCAAAGATAATGCAAAAAAGATTACAGTTAATACTGATTTATTTAGACCTGATTGTATAACATTTTCATATAATGA
-119
TAAATATTTTTCTCTATCACTTAGAGATGGAGATTATAATTGGATGATATGTAATGACAATAACAAGGTGCTAAAGCTGCACATTTGTGGATATTAGAAAGTTAGGAGATGTTAGTATT
1 ATG CCA ATA ACA ATT AAC AAC TTT AAT TAT TCA GAT CCT GTT GAT AAT AAA AAT ATT TTA TAT TTA GAT ACT CAT TTA AAT ACA CTA GCT Met Pro Ile Thr Ile Ass Ass Phe Asn Tyr Ser Asp Pro Val Asp Ass Lys As I le Leu Tyr Leu Asp Thr His Leu Ass Thr Leu Ala 30 20 10 1 91 AAT GAG CCT GAA AAA GCC TTT CGC ATT ACA GGA AAT ATA TGG GTA ATA CCT GAT AGA TTT TCA AGA AAT TCT AAT CCA AAT TTA AAT AAA Asn Glu Pro Glu Lys Ala Phe Arg lie Thr Gly Asn lie Trp Val Ile Pro Asp Ars Phe Ser Arg Aso Ser Ass Pro Ass Leu Ass Lys s0 50 40
181 CCT CCT CGA GTT ACA AGC CCT AAA AGT GGT TAT TAT GAT CCT AAT TAT TTG AGT ACT GAT TCT GAC AAA GAT ACA TTT TTA AAA GAA ATT Pro Pro Arg Val Thr Ser Pro Lys Ser Gly Tyr Tyr Asp Pro Asn Tyr Leu Ser Thr Asp Ser Asp Lys Asp Thr Phe Leu Lys Glu Ile 90 80 70 271 ATA AAG TTA TTT AAA AGA ATT AAT TCT AGA GAA ATA GGA GAA GAA TTA ATA TAT AGA CTT TCG ACA GAT ATA CCC TTT CCT GGG AAT AAC lie Lys Leo Phe Lys Arg lie Ass Ser Arg Glu lie Gly Glu Glu Leu lie Tyr Arg Leu Ser Thr Asp lie Pro Phe Pro Gly Ass Ass 120 110 100 361 AAT ACT CCA ATT AAT ACT TTT GAT TTT GAT GTA GAT TTT AAC AGT GTT GAT GTT AAA ACT AGA CAA GGT AAC AAC TGG OTT AAA ACT GGT Ass Thr Pro lie Asn Thr Phe Asp Phe Asp Val Asp Phe Asn Ser Val Asp Vol Lys Thr Arg Gin Gly Ass Ass Trp Val Lys Thr Gly 150 140 130
411 AGC ATA AAT CCT AGT GTT ATA ATA ACT GGA CCT AGA GAA AAC ATT ATA GAT CCA GAA ACT TCT ACG TTT AAA TTA ACT AAC AAT ACT TTT Ser Ile Asn Pro Ser Val Ile lie Thr Gly Pro Arg Glu Asn lie lie Asp Pro Glu Thr Ser Thr Phe Lys Leo Thr Asn Asn Thr Phe IS0 170
160
541 GCG GCA CAA GAA GGA TTT GGT GCT TTA TCA ATA ATT TCA ATA TCA CCT AGA TTT ATO CTA ACA TAT AGT AAT GCA ACT AAT GAT GTA GGA Ala Al& Gin Glu Gly Phe Gly Ala Leu Ser lie lie Ser lie Ser Pro Arg Phe Met Leu Thr Tyr Ser Ass Ala Thr Ass Asp Val Gly 210 200 190 631 GAG GGT AGA TTT TCT AAG TCT GAA TTT TGC ATG GAT CCA ATA CTA ATT TTA ATG CAT GAA CTT AAT CAT OCA ATG CAT AAT TTA TAT GGA Glu Gl0 Arg Phe Ser Lys Ser Gl0 Phe Cys Net Asp Pro lie Leo lie Leu Met His Glu Lee Asn His Ala Met His Ass Lee Tyr Gl0 240 230 220
721 ATA GCT ATA CCA AAT GAT CAA ACA ATT TCA TCT GTA ACT AGT AAT ATT TTT TAT TCT CAA TAT AAT GTG AAA TTA GAO TAT GCA Ile Ala Ile Pro Asn Aop Gin Thr lie Ser Ser Val Thr Ser Asn lie Phe Tyr Ser Gln Tyr Asn Val Lys Leo Glu Tyr Ala
260
250
GAA ATA Glu lle
270
811 TAT GCA TTT GGA GGT CCA ACT ATA GAC CTT ATT CCT AAA AGT GCA AGG AAA TAT TTT GAG GAA AAG GCA TTG GAT TAT TAT AGA TCT ATA Tyr Ala Phe Gly GlC Pro Thr lie Asp Leu lie Pro Lys Ser Ala Arg Lys Tyr Phe Glu Glu Lys Ala Leo Asp Tyr Tyr Arg Ser lle 300 290 280
AGA AAG TAT 901 GCT AAA AGA CTT AAT AGT ATA ACT ACT GCA AAT CCT TCA AGC TTT AAT AAA TAT ATA GGG GAA TAT AAA CAG AAA CTT ATT Ala Lys Arg Leu Asn Ser Ile Thr Thr Ala Asn Pro Ser Ser Phe Asn Lys Tyr Ile Gly Glu Tyr Lys Gln Lys Leu I le Arg Lys Tyr 330 320 310 991 AGA TTC GTA GTA GAA TCT TCA GGT GAA GTT ACA GTA AAT CGT AAT AAG TTT GTT GAG TTA TAT AAT GAA CTT ACA CAA ATA TTT ACA GAA Arg Phe Vol Val Glu Ser Ser Gly Glu Val Thr Vol Ass Arg Asn Lys Phe Vol Gbm Leu Tyr Asn Gle Leu Thr Cln Ile Phe Thr Gl0 360 3so 340
1081 TTT AAC TAC OCT AAA ATA TAT AAT GTA CAA AAT AGG AAA ATA TAT CTT TCA AAT GTA TAT ACT CCG GTT ACG GCG AAT ATA TTA GAC GAT Phe Asn Tyr Ala Lys Ile Tyr Asn Val Gln Asn Arg Lys Ile Tyr Leu Ser Ass Vol Tyr Thr Pro Vol Thr Ala Ass lie Leu Asp Asp 380
370
390
1171 AAT GTT TAT GAT ATA CAA AAT GGA TTT AAT ATA CCT AAA AGT AAT TTA AAT GTA CTA mTT ATG GGT CAA AAT TTA TCT CGA AAT CCA GCA Asa Vol Tyr Asp lie Gln Asn Gly Phe Asn Ile Pro Lys Ser Ass Leu Asn Vol Lev Phe Net Gly Gl. Ass Leo Ser Arg Aso Pro Ala 420 410 400 ACA 1261 TTA AGA AAA GTC AAT CCT GAA AAT ATG CTT TAT TTA TTT ACA AAA mTT TGT CAT AAA GCA ATA CAT GGT AGA TCA TTA TAT AAT AAA Thr Leu Arg Lys Vol Ass Pro Glu Asn Ket Leu Tyr Lee The Thr Lys Phe Cys His Lys Ala Ile Asp Gly Ars Ser Lee Tyr Asa Lye 450 440 430
TTT TTA AGA AAA 1351 TTA GAT TGT AGA GAG CTT TTA GTT AAA AAT ACT GAC TTA CCC TTT ATA GGT GAT ATT AGT GAT GTT AAA ACT GAT ATA Leu Asp Cys Arg G01 Leu Leo Val Lys Asn Thr Asp Leu Pro Phe lie Gly Asp lie Ser Asp Val Lys Thr Asp lie Phe Leu Arg Lys 460 470 460
1441 GAT ATT AAT GAA GAA ACT GAA GTT ATA TAC TAT CCC GAC AAT GTT TCA GTA GAT CAA GTT ATT CTC ACT AAG AAT ACC TCA GAA CAT GGA Asp Ile Ass Glu Glu Thr Glu Vol Ile Tyr Tyr Pro Asp Asn Vol Ser Vol Asp Gln Val Ile Leu Ser Lys Asn Thr Ser Glu His Gl0 510 S00 490 P11531 CAA CTA GAT TTA TTA TAC CCT AGT ATT GAC AGT GAG AGT GAA ATA TTA CCA GGG GAG AAT CAA GTC TTT TAT GAT AAT AGA ACT CAA AAT Gle Leu Asp Leo Leu Tyr Pro Ser lie Asp Ser Glu Ser GOl lie Leo Pro Gly Gl0 Asn Gle Val Phe Tyr Asp Ass Arg Thr Gln Asn
030
520
1 P2 T TTT GAT TCA CTA TTA CAA C OTT AAT AAA CTA CAA GAA TTT TTT ACT TTT ACG AGA TCA ATT AGT GAT 1621 GTT GAT TAT TTG AAT TCT TAT TAT TAC CTA GAA TCT Vol Asp Tyr Leu Asn Ser Tyr Tyr Tyr Leu Glu Ser Gln Lys Len Ser Asp Asn Vol Glu Asp Phe Thr Phe Thr Arg Ser Ile
540
r
EcoR
S50
560
GAO GAG Glu Glu
570
1711 GCT TTG GAT AAT AGT GCA AAA GTA TAT ACT TAC TTT CCT ACA CTA GCT AAT AAA GTA AAT GCG GOT GTT CAA GGT GGT TTA TTT TTA ATG Ala Leu Asp Ass Ser Ala Lys Vol Tyr Thr Tyr Phe Pro Thr Leo Ala Asn Lys Vol Ass Ala Gly Val Gl0 Gly Gly Leo Phe Leu Met
580
590
600
1801 TGG GCA AAT GAT GTA GTT GAA GA Trp Ala Asn Asp Vol Val Glu
FIG. 2. Partial nucleotide sequence of the C1 toxin gene in pCL8 (whole) and pCH3 (partial) and deduced amino acid sequences. V, Putative trypsin cleavage site. Primers employed for the polymerase chain reaction are indicated (P1 and P2). 1170
C. BOTULINUM TYPE C1 TOXIN GENE
VOL. 57, 1991
y+1 348 Tr1333 GAT GGT AGA TCA TTA TAT AAT AAA ACA TTA GAT TGT AGA GAG CTT TTA GTT AAA AAT ACT GAC TTA CCC TTT ATA GGT GAT Phe E Gly Asp Asn Thr As Leu Tyr Asn Lys Thr Le Asp Cys Arg Glu Leu Leu Asp Gly Arg Mri
F3
[VaEl
er
u
Thr
Asp
Leu
Gly
Ala
Leu
Ala -
-
-
-
Glu Asn Asp Phe Gly Ser Ser Lys Ser Gly
Ile Leu Cys Ile Ile Cys Ile Thr - Ile Thr - Ile Ile Cys Ile Leu
Cys
Ile Lys Asn Lys Val Asn Asn Ile Asp Val Asp Asn Glu Gln Val Lys Asn Asn Lys ValJLys As Asn Glu Ile Asn As Gly
Leu
Lys
As As
Thr
Ala
Phe
Leu Lys Phe Leu Phe [heJ
_ Ala
Thr Leu Pr Tyr Val Ala Phe LeuPr Tyr Val Asp Glu Leu Phe -
1171
Type C-ST Tetanus Type A Type B Type D-SA Type D-1873 Type E
FIG. 3. Putative N terminus of the Hc component of C1 toxin. The nucleotide sequence of L protein and the deduced amino acid sequence are aligned with the N-terminal amino acid sequences of the heavy chain of tetanus toxin and other types of botulinum toxins. The amino acid residues common to C1 and other toxins are boxed. V, Putative trypsin cleavage site; -, amino acids not identified. Numbers refer to nucleotide positions relative to the start codon. Data for tetanus toxin and botulinum toxin types A, B, D, and E are from references 2, 14, 15, 8, and 13, respectively.
for the first methionine residue (19). Considering the molecular weights of L protein and the Lc component of C1 toxin, it was concluded that L protein included the entire Lc component. The N-terminal amino acid sequence of the C1 toxin Hc component has not yet been analyzed, but those of other types of botulinum toxins have been reported (8, 13-15). The amino acid sequences of the Hc components of different toxin types showed some homology (2). The C-terminal amino acid residue of the Lc component should be Lys or Arg, because Lc and Hc components are formed by the cleavage of whole toxin with trypsin (1). Considering these factors, it was speculated that the C1 toxin may be cleaved between Lys-449 and Thr-450 or between Arg-444 and Ser-445, as shown in Fig. 3. The molecular weight of the putative Lc component of the toxin was calculated to be 51,600 or 51,100, which is close to the value determined for the Lc component by SDS-polyacrylamide gel electrophoresis (17). Therefore, it was concluded that the insertion fragment of the recombinant plasmid pCL8 coded for the whole Lc component and the N terminus of the Hc component of C1 toxin. On the basis of the Western blot analysis, pCH3 contained the gene for the Hc component. In an attempt to determine the nucleotide sequence between the DNA fragments cloned in pCL8 and pCH3, the base sequence of the 5' terminus of the insertion fragment of pCH3 was first determined. The 20-mer oligonucleotide primers which were complementary to parts of the 3' and 5' termini of pCL8 and pCH3 insertion fragments were then prepared (Fig. 2), and the sequences were amplified by the polymerase chain reaction. The nucleotide sequence obtained was identical to those of the 3' and 5' termini of the insertion fragments of pCL8 and pCH3,
4%
r-9
indicating that these two cloned fragments were directly juxtaposed (Fig. 4). The molecular weight of C1 toxin is reported to be 141,000 (17). The gene products from pCL8 and pCH3 were about 65,000 and 74,000, respectively. Therefore, it was speculated that the structural gene for whole C1 toxin might lie in these two cloned fragments. The entire nucleotide sequence of pCH3 is now being determined. Furthermore, it was found that pCL8 produced a protein reacting with antibody against a hemagglutinin associated with C1 toxin in culture fluid or under acid conditions. The structural gene for the hemagglutinin is located approximately 4.3 kb upstream of the toxin gene, and the hemagglutinin and toxin genes were transcribed in opposite directions (Fig. 4). Detailed data concerning the hemagglutinin gene and its product have already been published (18a). Regulatory sequences in the 5' noncoding region. The 5' noncoding region was analyzed for the presence of regulatory sequences. A nucleotide sequence highly complementary to the 3' end of Bacillus subtilis 16S rRNA (6) (AGG AGATG) was found at position -16 and included a ShineDalgarno sequence (16) (AGGAGA). At positions -33 and -66, sequences similar to the -10 (TATTAG) and the -35 (ATGACA) (r55 regions, respectively, were found. In addition, at -35 and -101, sequences similar to the -10 (GATATT) and the -35 (ACTTAGA) gp33-34 regions, respectively, were present. Moreover, a -35 region (TGGAGA) similar to gp28 promoters was found at position -92, but no corresponding -10 region was detected (4). The expression of L protein in E. coli transformants was independent of the lac promoter. This may indicate that some of the consensus promoter sequences mentioned above are
CL8 7.8kb .858b.
4.3kb
-T.%.Tw%oj
CH3
3.0kb H.*
1635b --) V%OW%O-
I
.. .. ..
p- Lc -
HA
1
-- Hc
C1 toxin
FIG. 4. Schematic representation of hemagglutinin (HA) and C1 toxin structural genes. The phage DNAs were digested with EcoRI. The fragments (7.8 and 3.0 kb) were cloned into pUC118 plasmids to give pCL8 and pCH3. The structural genes for HA and C1 toxin are indicated by boxes. The orientations of the open reading frames are indicated by arrows in the boxes. The toxin's putative cleavage site, at which the Lc and Hc components are generated, is also indicated. CL8 and CH3 indicate the insertion fragments of pCL8 and pCH3, respectively.
1172
APPL. ENVIRON. MICROBIOL.
KIMURA ET AL.
analysis of Escherichia coli promoter DNA sequences. Nucleic Acids Res. 11:2237-2255. rx., 500 5. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature (London) 400 227:680-685. u 6. McLaughlin, J. R., C. L. Murray, and J. C. Rabinowitz. 1981. 300 Unique features in the ribosome binding site sequence of the z , /S . * s t * #~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ gram positive Staphylococcus aureus P-lactamase gene. J. Biol. 200 a~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Chem. 256:11283-11291. 100 7. Melasniemi, H., and M. Paloheimo. 1989. Cloning and expression of the Clostridium thermohydrosulfuricum a-amylase-pullulanase gene in Escherichia coli. J. Gen. Microbiol. 135:17551 500 1762. Tetanus toxin 8. Moriishi, K., B. Syuto, S. Kubo, and K. Oguma. 1989. Molecular diversity of neurotoxins from Clostridium botulinum type D FIG. 5. Local comparison of amino acid sequences of Cl toxin strains. Infect. Immun. 57:2886-2891. and tetanus toxin. The regions with high similarity are dotted. 9. Oguma, K., H. Iida, M. Shiozaki, and K. Inoue. 1976. AntigeNumbers refer to the amino acid positions relative to the first nicity of converting phages obtained from Clostridium botulimethionine codon. An arrow indicates the highly conserved hydrophobic region. num types C and D. Infect. Immun. 13:855-860. 10. Oguma, K., B. Syuto, H. lida, and S. Kubo. 1980. Antigenic similarity of toxins produced by Clostridium botulinum type C and D strains. Infect. Immun. 30:656-660. effective in transcription. This agreed with the data for other 11. Pearson, W. R., and D. J. Lipman. 1988. Improved tools for Clostridium strains reported previously (7, 18). biological sequence comparison. Proc. Natl. Acad. Sci. USA Amino acid residue homology between botulinum C1 toxin 85:2444-2448. and tetanus toxin. Homnology exists in the N-terminal amino 12. Saiki, R. K., D. H. Gelfand, S. Stoffe, S. J. Scharf, R. Iguchi, acid sequences of botulinum and tetanus toxins (2, 19). The G. T. Horn, K. B. Mullis, and H. A. Erlich. 1988. Primerentire DNA sequence of tetanus toxin has already been directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239:487-491. reported (2). Homology of the derived amino acid sequence 13. Sathyamoothy, V., and B. R. DasGupta. 1985. Partial amino acid of L protein to the sequence of tetanus toxin was analyzed sequences of the heavy chains of botulinum neurotoxin type E. by the dot matrix method (11). There existed several regions Biochem. Biophys. Res. Commun. 127:768-772. of homologous amino acid sequences in addition to the N 14. Schmidt, J. J., V. Sathyamoothy, and B. R. DasGupta. 1984. termini of the toxins (Fig. 5). One of the homologous Partial amino acid sequence of the heavy and light chains of regions, Asp-222 to Gly-240 of botulinum toxin, was combotulinum neurotoxin type A. Biochem. Biophys. Res. Com600 -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
wo~~~~~~~~~~~ I
I
I
I
I
0
000
posed mainly of uncharged amino acid residues. Therefore, it was speculated that this region might play a role in spanning the mammalian cell membrane, as reported by Eisel et al. for tetanus toxin (2).
ACKNOWLEDGMENTS This study was supported in part by grant 02857069 from the Ministry of Education of Japan and by grants from the Mishima Foundation and the Suhara Foundation. REFERENCES 1. DasGupta, B. R. 1981. Structure and structure function relation of botulinum neurotoxins, p. 1-19. In G. E. Lewis, Jr. (ed.), Biomedical aspects of botulism. Academic Press, Inc., New York. 2. Eisel, U., W. Jarausch, K. Goretzki, A. Henschen, J. Engels, U. Weller, M. Hudel, E. Habermann, and H. Niemann. 1986. Tetanus toxin: primary structure, expression in E. coli, and homology with botulinum toxin. EMBO J. 5:2495-2502. 3. Fujii, N., K. Oguma, N. Yokosawa, K. Kimura, and K. Tsuzuki. 1988. Characterization of bacteriophage nucleic acids obtained from Clostridium botulinum types C and D. Appl. Environ. Microbiol. 54:69-73. 4. Howley, D. K., and W. R. McClure. 1983. Compilation and
mun. 119:900-904. 15. Schmidt, J. J., V. Sathyamoothy, and B. R. DasGupta. 1985. Partial amino acid sequences of botulinum neurotoxins type B and E. Arch. Biochem. Biophys. 238:544-548. 16. Shine, J., and L. Dalgarno. 1974. The 3'-terminal sequence of Escherichia coli 16S ribosome RNA: complementarity to nonsense triplets and ribosome binding sites. Proc. Natl. Acad. Sci. USA 71:1342-1346. 17. Syuto, B., and S. Kubo. 1977. Isolation and molecular size of Clostridium botulinum type C toxin. Appl. Environ. Microbiol. 33:400-405. 18. Tso, J. Y., and C. Siebel. 1989. Cloning and expression of the phospholipase C gene from Clostridium perfringens and Clostridium bifermentans. Infect. Immun. 57:468-476. 18a.Tsuzuki, K., K. Kimura, N. Fujii, N. Yokosawa, T. Indoh, T. Murakami, and K. Oguma. 1990. Cloning and complete nucleotide sequence of the gene for the main component of hemagglutinin produced by Clostridium botulinum type C. Infect. Immun. 58:3173-3177. 19. Tsuzuki, K., N. Yokosawa, B. Syuto, I. Ohishi, N. Fujii, K. Kimura, and K. Oguma. 1988. Establishment of a monoclonal
antibody recognizing an antigenic site common to Clostridium botulinum type B, C,, D, and E toxins and tetanus toxin. Infect. Immun. 56:898-902. 20. Vieira, J., and J. Messing. 1987. Production of single-stranded plasmid DNA. Methods Enzymol. 153:3-11.
Vol. 57, No. 4
Cloning of the Structural Gene for Clostridium botulinum Type C1 Toxin and Whole Nucleotide Sequence of Its Light Chain Component K. KIMURA, N. FUJII, K. TSUZUKI, T. MURAKAMI, T. INDOH, N. YOKOSAWA, AND K. OGUMA* Department of Microbiology, Sapporo Medical College, Sapporo 060, Japan Received 17 May 1990/Accepted 24 January 1991
The toxigenicity of Clostridium botulinum type C1 is mediated by specific bacteriophages. DNA was extracted from one of these phages. Two DNA fragments, 3 and 7.8 kb, which produced the protein reacting with antitoxin serum were cloned by using bacteriophage Agtll and Escherichia coli. Both DNA fragments were then subcloned into pUC118 plasmids and transferred into E. coli cells. The nucleotide sequences of the cloned DNA fragments were analyzed by the dideoxy chain termination method, and their gene products were analyzed by Western immunoblot. The 7.8-kb fragment coded for the entire light chain component and the N terminus of the heavy chain component of the toxin, whereas the 3-kb fragment coded for the remaining heavy chain component. The entire nucleotide sequence for the light chain component was determined, and the derived amino acid sequence was compared with that of tetanus toxin. It was found that the light chain component of Cl toxin possessed several amino acid regions, in addition to the N terminus, that were homologous to tetanus toxin.
The neurotoxins produced by Clostridium botulinum are, like tetanus toxin, among the most potent toxins in the natural world. The botulinum neurotoxins cause fatal intoxication in both animals and humans. They act at the tips of the motor nerve endings at the neuromuscular junction and inhibit the release of acetylcholine, leading to paralysis of the muscles. However, the detailed mode of action is still unknown. The botulinum toxins are classified into seven groups (A to G) on the basis of their antigenicity. They are produced as single polypeptide chains and are cleaved by endogenous proteases or trypsin to yield two subunits: a heavy chain (Hc; molecular weight 100,000) and a light chain (Lc; molecular weight 50,000) (1). Individually, they are nontoxic, and little information is available about the function of each. We have confirmed that the production of C1 and D toxins is governed by temperate bacteriophages (9). By using synthetic oligonucleotide probes constructed from knowledge of the N-terminal amino acid sequence of the Lc component, we also showed that these temperate bacteriophages carry the structural genes for botulinum toxins (3). In this paper, the cloning of the structural gene for the toxin from one type C temperate phage, c-st, and the nucleotide sequence of the whole Lc component of the toxin are described.
hydrochloride [pH 7.4]), as reported previously (9). After the lysate was treated with DNase I and RNase A (each at 100 jig/ml) (Sigma Chemical Co., St. Louis, Mo.) at 37°C for 30 min, the phage was precipitated with 8% polyethylene glycol 6000-1 M NaCl at 4°C overnight. The precipitate was resuspended with PEG-resuspension buffer (10 mM Tris-HCl [pH 7.4], 10 mM MgCl2, 100 mM NaCl), and then the phage particles were extracted with an equal volume of chloroform. The aqueous phase thus obtained was treated with 0.02% proteinase K (Sigma Chemical Co.)-0.2% sodium dodecyl sulfate (SDS) at 37°C for 1 h. From this preparation, DNA was extracted with phenol and precipitated with ice-cold ethanol. Monoclonal and polyclonal antibodies against type C1 toxin. In this study, one monoclonal antibody (EL161-38, mouse) reacting with the Lc component of the toxin and three polyclonal antibodies (rabbit) reacting with whole toxin or with the Lc or Hc component were employed. All antibodies were prepared previously, and immunoglobulin G (IgG) fractions were obtained by column chromatography (10, 19). Before use, polyclonal antibodies were adsorbed three times with whole Escherichia coli cells to remove nonspecific antibodies. Cloning and subcloning. The phage DNA was digested with EcoRI (Takara Shuzo Co., Kyoto, Japan), ligated to the EcoRI site of Xgtll DNA (Promega Corp., Madison, Wis.), and then packaged in vitro by using Packagene (Promega Corp.). The gene library was plated on E. coli Y1090 (Promega Corp.) to give approximately 3,000 plaques per 87-mm-diameter plate. After 3 h of incubation at 42°C, nitrocellulose filter disks (Amersham International plc, Amersham, United Kingdom) saturated with 10 mM IPTG (isopropyl-,-D-thiogalactopyranoside) were overlaid on agar plates and left in contact for an additional 3 h at 37°C. Positive recombinant phage clones were selected with an antibody against whole C1 toxin by using the ProtoBlot Immunoscreening System (Promega Corp.). The isolated clones were amplified in 1 liter of 2x TY medium (1.6% [wt/vol] tryptone, 1% yeast extract, 0.5% NaCl [pH 7.6]).
=
MATERIALS AND METHODS Preparation of phage DNA. Phage c-st was induced from a
toxigenic C. botulinum type C strain, C-Stockholm, by mitomycin C treatment. The nontoxigenic variant (C)-A02, obtained from C-Stockholm by treatment with acridine orange, was used as an indicator strain. Acquired c-st phage was increased in titer by being passaged through an indicator strain, (C)-A02, in LYG medium (1% [wt/vol] lactalbumin hydrolysate, 2% yeast extract, 2% glucose, 0.15% cysteine *
Corresponding author. 1168
VOL. 57, 1991
Purification of phage particles and extraction of the recombinant phage DNAs were performed in the same ways as for c-st phage. The extracted DNAs were digested with EcoRI, and the resultant inserts were separated by preparative agarose gel electrophoresis. The DNA fragments obtained were then subcloned into the EcoRI site of the polylinker of plasmid pUC118 (Takara Shuzo Co.) (20). DNA sequencing. In an attempt to determine the DNA sequences of the long insertion fragments in the pUC118 plasmids, progressive unidirectional deletions of the inserted DNA fragments were created by using a Deletion Kit (Takara Shuzo Co.). DNA sequence analysis was performed by the dideoxy chain termination method with a-35S-dATP (NEN Products, Boston, Mass.) and a T7 sequencing kit (Pharmacia LKB Biotechnology, Uppsala, Sweden). Polymerase chain reaction. Instead of constructing the DNA libraries of c-st phage by using various restriction endonucleases in addition to EcoRI, the polymerase chain reaction (12) was employed to obtain overlapping clones. Two kinds of 20-mer oligonucleotides which were used as primers to amplify their flanking region on c-st phage DNA were synthesized according to the sequence data reported here. The amplification took place in 100-,ul reaction mixture containing 50 ng of c-st phage DNA in 25 mM TAPS
(N-tris[hydroxymethyl]methyl-3-aminopropanesulfonic acid)-HCl (pH 8.0), 50 mM KCI, 2 mM MgCl2, 1 mM 2-mercaptoethanol, primers at 1 ,uM, deoxynucleoside triphosphates (dATP, dGTP, dCTP, and dTTP) at 200 ,uM each, and 2.5 U of Taq DNA polymerase (Takara Shuzo Co.). The sample was overlaid with 2 drops of mineral oil to prevent condensation and subjected to 28 cycles of amplification as follows. The sample was heated to 94°C for 1 min, cooled to 40°C for 2.5 min, and heated to 72°C for 3 min. The ends of the amplified DNA fragments were converted to blunt-ended structures with T4 DNA polymerase by using a DNA blunting kit (Takara Shuzo Co.). The repaired fragments were cloned into the SmaI site of the pUC118 plasmid polylinker. The recombinant plasmids were sequenced as described above. Western immunoblot analysis. E. coli MV1184 cells (Takara Shuzo Co.) were transformed by the recombinant plasmids. The transformed cells were incubated in 50 ml of 2x TY medium at 37°C for 12 h. After centrifugation, the cells were resuspended in 5 ml of TEP buffer (100 mM Tris-HCl [pH 7.4], 10 mM EDTA, 1 mM phenylmethylsulfonyl fluoride), sonicated for about 5 min at 0°C to give clear fluids, and centrifuged (16,000 x g, 10 min). Aliquots (10 [L) of the resultant supernatants were electrophoresed on SDS12% polyacrylamide gels according to Laemmli's method (5), and the protein bands were electrotransferred onto nitrocellulose membranes (Bio-Rad Laboratories, Richmond, Calif.). The membranes were incubated with 10% skim milk in phosphate-buffered saline, pH 7.2, for 1 h at room temperature with gentle stirring. After the membranes were rinsed with T-TBS buffer (20 mM Tris-HCl [pH 7.5], 0.05% Tween 20, 0.5 M NaCl), they were incubated with diluted antitoxin IgGs for 1 h at room temperature. Thereafter, alkaline phosphatase anti-rabbit or anti-mouse IgG conjugates (Promega Corp.), diluted 1:7,500 with T-TBS, were reacted with the membranes for 30 min at room temperature. The membranes were washed, and then alkaline phosphatase activity was detected with nitroblue tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate for 2 to 10 min.
C. BOTULINUM TYPE C1 TOXIN GENE
anIIC 97K66K- --
1169
anffHc 410K
;i
43K-
31K-
FIG. 1. Analysis of the gene products of recombinant clones by Western blot. The inserted DNA fragments in Xgtll phages were recloned into plasmid pUC118 to give pCL8 and pCH3. E. coli MV1184 cells were transformed with these recombinant plasmids, cultured in 2x TY medium, and sonicated. The resultant lysates and purified C1 toxin were employed for Western blot analysis with antitoxin IgG. Anti-C1, Polyclonal anti-whole C1 toxin IgGs; antiLc, monoclonal anti-Cl Lc component IgG; anti-Hc, polyclonal anti-Cl Hc component IgGs.
Nucleotide sequence accession number. The nucleotide sequence has been submitted to the DDBJ/GenBank/EMBL data banks, with the accession number D90210.
RESULTS AND DISCUSSION Cloning of the structural gene for toxin. Purified c-st phage DNA was treated with EcoRI, ligated to Xgtll, and plated on E. coli Y1090. Thirty clones giving positive results with anti-C1 toxin IgG were selected by immunoscreening. The representative clones XCL-8 and XCH-3 were chosen for further investigation. The lengths of the inserted DNA fragments were 7.8 kb (XCL-8) and 3 kb (XCH-3). The insertion fragments of XCL-8 and XCH-3 were recloned into pUC118 plasmids to yield plasmids pCL8 and pCH3, respectively. The E. coli cells transformed with plasmid pCL8 produced a protein with a molecular weight of about 65,000 (L protein) which reacted with polyclonal anti-whole toxin and anti-Lc IgGs and with monoclonal anti-Lc IgG. The pCH3 transformant produced a protein with a molecular weight of about 74,000 (H protein) which reacted with polyclonal anti-whole toxin and anti-Hc IgGs (Fig. 1). These results indicated that pCL8 contained the structural gene for the Lc component and that pCH3 contained the structural gene for the Hc component. The orientation of the inserted DNA fragment in pCL8 did not affect the expression of L protein. In contrast, the inserted fragment in pCH3 lost its ability to produce H protein when its orientation was changed in plasmid pUC118 (data not shown). These results indicated that the gene for L protein encoded in pCL8 was transcribed independently of the lac promoter of the plasmid, whereas that for H protein was transcribed with the lacZ gene. Nucleotide sequence of the Lc component of Cl toxin. The whole L-protein gene cloned in the plasmid pCL8 was sequenced by using its deletion mutants. The nucleotide sequence and deduced amino acid sequence are presented in Fig. 2. The nucleotide sequence contained a single open reading frame coding for 545 amino acids, corresponding to a polypeptide with a molecular weight of 62,600. The derived N-terminal amino acid sequence was identical to that of the N-terminal peptides of the Lc component of C1 toxin, except
-282
-
AGTGGATGAGTGTATAATTATATATTAGACGGTACAGAAAATAT
-230
TTAGATATATCTCCTGAAATAATAGAATACAATTAGTAAGTTCCAAAGATAATGCAAAAAAGATTACAGTTAATACTGATTTATTTAGACCTGATTGTATAACATTTTCATATAATGA
-119
TAAATATTTTTCTCTATCACTTAGAGATGGAGATTATAATTGGATGATATGTAATGACAATAACAAGGTGCTAAAGCTGCACATTTGTGGATATTAGAAAGTTAGGAGATGTTAGTATT
1 ATG CCA ATA ACA ATT AAC AAC TTT AAT TAT TCA GAT CCT GTT GAT AAT AAA AAT ATT TTA TAT TTA GAT ACT CAT TTA AAT ACA CTA GCT Met Pro Ile Thr Ile Ass Ass Phe Asn Tyr Ser Asp Pro Val Asp Ass Lys As I le Leu Tyr Leu Asp Thr His Leu Ass Thr Leu Ala 30 20 10 1 91 AAT GAG CCT GAA AAA GCC TTT CGC ATT ACA GGA AAT ATA TGG GTA ATA CCT GAT AGA TTT TCA AGA AAT TCT AAT CCA AAT TTA AAT AAA Asn Glu Pro Glu Lys Ala Phe Arg lie Thr Gly Asn lie Trp Val Ile Pro Asp Ars Phe Ser Arg Aso Ser Ass Pro Ass Leu Ass Lys s0 50 40
181 CCT CCT CGA GTT ACA AGC CCT AAA AGT GGT TAT TAT GAT CCT AAT TAT TTG AGT ACT GAT TCT GAC AAA GAT ACA TTT TTA AAA GAA ATT Pro Pro Arg Val Thr Ser Pro Lys Ser Gly Tyr Tyr Asp Pro Asn Tyr Leu Ser Thr Asp Ser Asp Lys Asp Thr Phe Leu Lys Glu Ile 90 80 70 271 ATA AAG TTA TTT AAA AGA ATT AAT TCT AGA GAA ATA GGA GAA GAA TTA ATA TAT AGA CTT TCG ACA GAT ATA CCC TTT CCT GGG AAT AAC lie Lys Leo Phe Lys Arg lie Ass Ser Arg Glu lie Gly Glu Glu Leu lie Tyr Arg Leu Ser Thr Asp lie Pro Phe Pro Gly Ass Ass 120 110 100 361 AAT ACT CCA ATT AAT ACT TTT GAT TTT GAT GTA GAT TTT AAC AGT GTT GAT GTT AAA ACT AGA CAA GGT AAC AAC TGG OTT AAA ACT GGT Ass Thr Pro lie Asn Thr Phe Asp Phe Asp Val Asp Phe Asn Ser Val Asp Vol Lys Thr Arg Gin Gly Ass Ass Trp Val Lys Thr Gly 150 140 130
411 AGC ATA AAT CCT AGT GTT ATA ATA ACT GGA CCT AGA GAA AAC ATT ATA GAT CCA GAA ACT TCT ACG TTT AAA TTA ACT AAC AAT ACT TTT Ser Ile Asn Pro Ser Val Ile lie Thr Gly Pro Arg Glu Asn lie lie Asp Pro Glu Thr Ser Thr Phe Lys Leo Thr Asn Asn Thr Phe IS0 170
160
541 GCG GCA CAA GAA GGA TTT GGT GCT TTA TCA ATA ATT TCA ATA TCA CCT AGA TTT ATO CTA ACA TAT AGT AAT GCA ACT AAT GAT GTA GGA Ala Al& Gin Glu Gly Phe Gly Ala Leu Ser lie lie Ser lie Ser Pro Arg Phe Met Leu Thr Tyr Ser Ass Ala Thr Ass Asp Val Gly 210 200 190 631 GAG GGT AGA TTT TCT AAG TCT GAA TTT TGC ATG GAT CCA ATA CTA ATT TTA ATG CAT GAA CTT AAT CAT OCA ATG CAT AAT TTA TAT GGA Glu Gl0 Arg Phe Ser Lys Ser Gl0 Phe Cys Net Asp Pro lie Leo lie Leu Met His Glu Lee Asn His Ala Met His Ass Lee Tyr Gl0 240 230 220
721 ATA GCT ATA CCA AAT GAT CAA ACA ATT TCA TCT GTA ACT AGT AAT ATT TTT TAT TCT CAA TAT AAT GTG AAA TTA GAO TAT GCA Ile Ala Ile Pro Asn Aop Gin Thr lie Ser Ser Val Thr Ser Asn lie Phe Tyr Ser Gln Tyr Asn Val Lys Leo Glu Tyr Ala
260
250
GAA ATA Glu lle
270
811 TAT GCA TTT GGA GGT CCA ACT ATA GAC CTT ATT CCT AAA AGT GCA AGG AAA TAT TTT GAG GAA AAG GCA TTG GAT TAT TAT AGA TCT ATA Tyr Ala Phe Gly GlC Pro Thr lie Asp Leu lie Pro Lys Ser Ala Arg Lys Tyr Phe Glu Glu Lys Ala Leo Asp Tyr Tyr Arg Ser lle 300 290 280
AGA AAG TAT 901 GCT AAA AGA CTT AAT AGT ATA ACT ACT GCA AAT CCT TCA AGC TTT AAT AAA TAT ATA GGG GAA TAT AAA CAG AAA CTT ATT Ala Lys Arg Leu Asn Ser Ile Thr Thr Ala Asn Pro Ser Ser Phe Asn Lys Tyr Ile Gly Glu Tyr Lys Gln Lys Leu I le Arg Lys Tyr 330 320 310 991 AGA TTC GTA GTA GAA TCT TCA GGT GAA GTT ACA GTA AAT CGT AAT AAG TTT GTT GAG TTA TAT AAT GAA CTT ACA CAA ATA TTT ACA GAA Arg Phe Vol Val Glu Ser Ser Gly Glu Val Thr Vol Ass Arg Asn Lys Phe Vol Gbm Leu Tyr Asn Gle Leu Thr Cln Ile Phe Thr Gl0 360 3so 340
1081 TTT AAC TAC OCT AAA ATA TAT AAT GTA CAA AAT AGG AAA ATA TAT CTT TCA AAT GTA TAT ACT CCG GTT ACG GCG AAT ATA TTA GAC GAT Phe Asn Tyr Ala Lys Ile Tyr Asn Val Gln Asn Arg Lys Ile Tyr Leu Ser Ass Vol Tyr Thr Pro Vol Thr Ala Ass lie Leu Asp Asp 380
370
390
1171 AAT GTT TAT GAT ATA CAA AAT GGA TTT AAT ATA CCT AAA AGT AAT TTA AAT GTA CTA mTT ATG GGT CAA AAT TTA TCT CGA AAT CCA GCA Asa Vol Tyr Asp lie Gln Asn Gly Phe Asn Ile Pro Lys Ser Ass Leu Asn Vol Lev Phe Net Gly Gl. Ass Leo Ser Arg Aso Pro Ala 420 410 400 ACA 1261 TTA AGA AAA GTC AAT CCT GAA AAT ATG CTT TAT TTA TTT ACA AAA mTT TGT CAT AAA GCA ATA CAT GGT AGA TCA TTA TAT AAT AAA Thr Leu Arg Lys Vol Ass Pro Glu Asn Ket Leu Tyr Lee The Thr Lys Phe Cys His Lys Ala Ile Asp Gly Ars Ser Lee Tyr Asa Lye 450 440 430
TTT TTA AGA AAA 1351 TTA GAT TGT AGA GAG CTT TTA GTT AAA AAT ACT GAC TTA CCC TTT ATA GGT GAT ATT AGT GAT GTT AAA ACT GAT ATA Leu Asp Cys Arg G01 Leu Leo Val Lys Asn Thr Asp Leu Pro Phe lie Gly Asp lie Ser Asp Val Lys Thr Asp lie Phe Leu Arg Lys 460 470 460
1441 GAT ATT AAT GAA GAA ACT GAA GTT ATA TAC TAT CCC GAC AAT GTT TCA GTA GAT CAA GTT ATT CTC ACT AAG AAT ACC TCA GAA CAT GGA Asp Ile Ass Glu Glu Thr Glu Vol Ile Tyr Tyr Pro Asp Asn Vol Ser Vol Asp Gln Val Ile Leu Ser Lys Asn Thr Ser Glu His Gl0 510 S00 490 P11531 CAA CTA GAT TTA TTA TAC CCT AGT ATT GAC AGT GAG AGT GAA ATA TTA CCA GGG GAG AAT CAA GTC TTT TAT GAT AAT AGA ACT CAA AAT Gle Leu Asp Leo Leu Tyr Pro Ser lie Asp Ser Glu Ser GOl lie Leo Pro Gly Gl0 Asn Gle Val Phe Tyr Asp Ass Arg Thr Gln Asn
030
520
1 P2 T TTT GAT TCA CTA TTA CAA C OTT AAT AAA CTA CAA GAA TTT TTT ACT TTT ACG AGA TCA ATT AGT GAT 1621 GTT GAT TAT TTG AAT TCT TAT TAT TAC CTA GAA TCT Vol Asp Tyr Leu Asn Ser Tyr Tyr Tyr Leu Glu Ser Gln Lys Len Ser Asp Asn Vol Glu Asp Phe Thr Phe Thr Arg Ser Ile
540
r
EcoR
S50
560
GAO GAG Glu Glu
570
1711 GCT TTG GAT AAT AGT GCA AAA GTA TAT ACT TAC TTT CCT ACA CTA GCT AAT AAA GTA AAT GCG GOT GTT CAA GGT GGT TTA TTT TTA ATG Ala Leu Asp Ass Ser Ala Lys Vol Tyr Thr Tyr Phe Pro Thr Leo Ala Asn Lys Vol Ass Ala Gly Val Gl0 Gly Gly Leo Phe Leu Met
580
590
600
1801 TGG GCA AAT GAT GTA GTT GAA GA Trp Ala Asn Asp Vol Val Glu
FIG. 2. Partial nucleotide sequence of the C1 toxin gene in pCL8 (whole) and pCH3 (partial) and deduced amino acid sequences. V, Putative trypsin cleavage site. Primers employed for the polymerase chain reaction are indicated (P1 and P2). 1170
C. BOTULINUM TYPE C1 TOXIN GENE
VOL. 57, 1991
y+1 348 Tr1333 GAT GGT AGA TCA TTA TAT AAT AAA ACA TTA GAT TGT AGA GAG CTT TTA GTT AAA AAT ACT GAC TTA CCC TTT ATA GGT GAT Phe E Gly Asp Asn Thr As Leu Tyr Asn Lys Thr Le Asp Cys Arg Glu Leu Leu Asp Gly Arg Mri
F3
[VaEl
er
u
Thr
Asp
Leu
Gly
Ala
Leu
Ala -
-
-
-
Glu Asn Asp Phe Gly Ser Ser Lys Ser Gly
Ile Leu Cys Ile Ile Cys Ile Thr - Ile Thr - Ile Ile Cys Ile Leu
Cys
Ile Lys Asn Lys Val Asn Asn Ile Asp Val Asp Asn Glu Gln Val Lys Asn Asn Lys ValJLys As Asn Glu Ile Asn As Gly
Leu
Lys
As As
Thr
Ala
Phe
Leu Lys Phe Leu Phe [heJ
_ Ala
Thr Leu Pr Tyr Val Ala Phe LeuPr Tyr Val Asp Glu Leu Phe -
1171
Type C-ST Tetanus Type A Type B Type D-SA Type D-1873 Type E
FIG. 3. Putative N terminus of the Hc component of C1 toxin. The nucleotide sequence of L protein and the deduced amino acid sequence are aligned with the N-terminal amino acid sequences of the heavy chain of tetanus toxin and other types of botulinum toxins. The amino acid residues common to C1 and other toxins are boxed. V, Putative trypsin cleavage site; -, amino acids not identified. Numbers refer to nucleotide positions relative to the start codon. Data for tetanus toxin and botulinum toxin types A, B, D, and E are from references 2, 14, 15, 8, and 13, respectively.
for the first methionine residue (19). Considering the molecular weights of L protein and the Lc component of C1 toxin, it was concluded that L protein included the entire Lc component. The N-terminal amino acid sequence of the C1 toxin Hc component has not yet been analyzed, but those of other types of botulinum toxins have been reported (8, 13-15). The amino acid sequences of the Hc components of different toxin types showed some homology (2). The C-terminal amino acid residue of the Lc component should be Lys or Arg, because Lc and Hc components are formed by the cleavage of whole toxin with trypsin (1). Considering these factors, it was speculated that the C1 toxin may be cleaved between Lys-449 and Thr-450 or between Arg-444 and Ser-445, as shown in Fig. 3. The molecular weight of the putative Lc component of the toxin was calculated to be 51,600 or 51,100, which is close to the value determined for the Lc component by SDS-polyacrylamide gel electrophoresis (17). Therefore, it was concluded that the insertion fragment of the recombinant plasmid pCL8 coded for the whole Lc component and the N terminus of the Hc component of C1 toxin. On the basis of the Western blot analysis, pCH3 contained the gene for the Hc component. In an attempt to determine the nucleotide sequence between the DNA fragments cloned in pCL8 and pCH3, the base sequence of the 5' terminus of the insertion fragment of pCH3 was first determined. The 20-mer oligonucleotide primers which were complementary to parts of the 3' and 5' termini of pCL8 and pCH3 insertion fragments were then prepared (Fig. 2), and the sequences were amplified by the polymerase chain reaction. The nucleotide sequence obtained was identical to those of the 3' and 5' termini of the insertion fragments of pCL8 and pCH3,
4%
r-9
indicating that these two cloned fragments were directly juxtaposed (Fig. 4). The molecular weight of C1 toxin is reported to be 141,000 (17). The gene products from pCL8 and pCH3 were about 65,000 and 74,000, respectively. Therefore, it was speculated that the structural gene for whole C1 toxin might lie in these two cloned fragments. The entire nucleotide sequence of pCH3 is now being determined. Furthermore, it was found that pCL8 produced a protein reacting with antibody against a hemagglutinin associated with C1 toxin in culture fluid or under acid conditions. The structural gene for the hemagglutinin is located approximately 4.3 kb upstream of the toxin gene, and the hemagglutinin and toxin genes were transcribed in opposite directions (Fig. 4). Detailed data concerning the hemagglutinin gene and its product have already been published (18a). Regulatory sequences in the 5' noncoding region. The 5' noncoding region was analyzed for the presence of regulatory sequences. A nucleotide sequence highly complementary to the 3' end of Bacillus subtilis 16S rRNA (6) (AGG AGATG) was found at position -16 and included a ShineDalgarno sequence (16) (AGGAGA). At positions -33 and -66, sequences similar to the -10 (TATTAG) and the -35 (ATGACA) (r55 regions, respectively, were found. In addition, at -35 and -101, sequences similar to the -10 (GATATT) and the -35 (ACTTAGA) gp33-34 regions, respectively, were present. Moreover, a -35 region (TGGAGA) similar to gp28 promoters was found at position -92, but no corresponding -10 region was detected (4). The expression of L protein in E. coli transformants was independent of the lac promoter. This may indicate that some of the consensus promoter sequences mentioned above are
CL8 7.8kb .858b.
4.3kb
-T.%.Tw%oj
CH3
3.0kb H.*
1635b --) V%OW%O-
I
.. .. ..
p- Lc -
HA
1
-- Hc
C1 toxin
FIG. 4. Schematic representation of hemagglutinin (HA) and C1 toxin structural genes. The phage DNAs were digested with EcoRI. The fragments (7.8 and 3.0 kb) were cloned into pUC118 plasmids to give pCL8 and pCH3. The structural genes for HA and C1 toxin are indicated by boxes. The orientations of the open reading frames are indicated by arrows in the boxes. The toxin's putative cleavage site, at which the Lc and Hc components are generated, is also indicated. CL8 and CH3 indicate the insertion fragments of pCL8 and pCH3, respectively.
1172
APPL. ENVIRON. MICROBIOL.
KIMURA ET AL.
analysis of Escherichia coli promoter DNA sequences. Nucleic Acids Res. 11:2237-2255. rx., 500 5. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature (London) 400 227:680-685. u 6. McLaughlin, J. R., C. L. Murray, and J. C. Rabinowitz. 1981. 300 Unique features in the ribosome binding site sequence of the z , /S . * s t * #~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ gram positive Staphylococcus aureus P-lactamase gene. J. Biol. 200 a~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Chem. 256:11283-11291. 100 7. Melasniemi, H., and M. Paloheimo. 1989. Cloning and expression of the Clostridium thermohydrosulfuricum a-amylase-pullulanase gene in Escherichia coli. J. Gen. Microbiol. 135:17551 500 1762. Tetanus toxin 8. Moriishi, K., B. Syuto, S. Kubo, and K. Oguma. 1989. Molecular diversity of neurotoxins from Clostridium botulinum type D FIG. 5. Local comparison of amino acid sequences of Cl toxin strains. Infect. Immun. 57:2886-2891. and tetanus toxin. The regions with high similarity are dotted. 9. Oguma, K., H. Iida, M. Shiozaki, and K. Inoue. 1976. AntigeNumbers refer to the amino acid positions relative to the first nicity of converting phages obtained from Clostridium botulimethionine codon. An arrow indicates the highly conserved hydrophobic region. num types C and D. Infect. Immun. 13:855-860. 10. Oguma, K., B. Syuto, H. lida, and S. Kubo. 1980. Antigenic similarity of toxins produced by Clostridium botulinum type C and D strains. Infect. Immun. 30:656-660. effective in transcription. This agreed with the data for other 11. Pearson, W. R., and D. J. Lipman. 1988. Improved tools for Clostridium strains reported previously (7, 18). biological sequence comparison. Proc. Natl. Acad. Sci. USA Amino acid residue homology between botulinum C1 toxin 85:2444-2448. and tetanus toxin. Homnology exists in the N-terminal amino 12. Saiki, R. K., D. H. Gelfand, S. Stoffe, S. J. Scharf, R. Iguchi, acid sequences of botulinum and tetanus toxins (2, 19). The G. T. Horn, K. B. Mullis, and H. A. Erlich. 1988. Primerentire DNA sequence of tetanus toxin has already been directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239:487-491. reported (2). Homology of the derived amino acid sequence 13. Sathyamoothy, V., and B. R. DasGupta. 1985. Partial amino acid of L protein to the sequence of tetanus toxin was analyzed sequences of the heavy chains of botulinum neurotoxin type E. by the dot matrix method (11). There existed several regions Biochem. Biophys. Res. Commun. 127:768-772. of homologous amino acid sequences in addition to the N 14. Schmidt, J. J., V. Sathyamoothy, and B. R. DasGupta. 1984. termini of the toxins (Fig. 5). One of the homologous Partial amino acid sequence of the heavy and light chains of regions, Asp-222 to Gly-240 of botulinum toxin, was combotulinum neurotoxin type A. Biochem. Biophys. Res. Com600 -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
wo~~~~~~~~~~~ I
I
I
I
I
0
000
posed mainly of uncharged amino acid residues. Therefore, it was speculated that this region might play a role in spanning the mammalian cell membrane, as reported by Eisel et al. for tetanus toxin (2).
ACKNOWLEDGMENTS This study was supported in part by grant 02857069 from the Ministry of Education of Japan and by grants from the Mishima Foundation and the Suhara Foundation. REFERENCES 1. DasGupta, B. R. 1981. Structure and structure function relation of botulinum neurotoxins, p. 1-19. In G. E. Lewis, Jr. (ed.), Biomedical aspects of botulism. Academic Press, Inc., New York. 2. Eisel, U., W. Jarausch, K. Goretzki, A. Henschen, J. Engels, U. Weller, M. Hudel, E. Habermann, and H. Niemann. 1986. Tetanus toxin: primary structure, expression in E. coli, and homology with botulinum toxin. EMBO J. 5:2495-2502. 3. Fujii, N., K. Oguma, N. Yokosawa, K. Kimura, and K. Tsuzuki. 1988. Characterization of bacteriophage nucleic acids obtained from Clostridium botulinum types C and D. Appl. Environ. Microbiol. 54:69-73. 4. Howley, D. K., and W. R. McClure. 1983. Compilation and
mun. 119:900-904. 15. Schmidt, J. J., V. Sathyamoothy, and B. R. DasGupta. 1985. Partial amino acid sequences of botulinum neurotoxins type B and E. Arch. Biochem. Biophys. 238:544-548. 16. Shine, J., and L. Dalgarno. 1974. The 3'-terminal sequence of Escherichia coli 16S ribosome RNA: complementarity to nonsense triplets and ribosome binding sites. Proc. Natl. Acad. Sci. USA 71:1342-1346. 17. Syuto, B., and S. Kubo. 1977. Isolation and molecular size of Clostridium botulinum type C toxin. Appl. Environ. Microbiol. 33:400-405. 18. Tso, J. Y., and C. Siebel. 1989. Cloning and expression of the phospholipase C gene from Clostridium perfringens and Clostridium bifermentans. Infect. Immun. 57:468-476. 18a.Tsuzuki, K., K. Kimura, N. Fujii, N. Yokosawa, T. Indoh, T. Murakami, and K. Oguma. 1990. Cloning and complete nucleotide sequence of the gene for the main component of hemagglutinin produced by Clostridium botulinum type C. Infect. Immun. 58:3173-3177. 19. Tsuzuki, K., N. Yokosawa, B. Syuto, I. Ohishi, N. Fujii, K. Kimura, and K. Oguma. 1988. Establishment of a monoclonal
antibody recognizing an antigenic site common to Clostridium botulinum type B, C,, D, and E toxins and tetanus toxin. Infect. Immun. 56:898-902. 20. Vieira, J., and J. Messing. 1987. Production of single-stranded plasmid DNA. Methods Enzymol. 153:3-11.
