Cloning of the Rat Insulin-Like Growth Factor-Binding Protein-2 Gene and Identification of a Functional Promoter Lacking a TATA Box

Alexandra L. Brown and Matthew M. Rechler Growth and Development Section Molecular Cellular and Nutritional Endocrinology Branch National Institute of Diabetes and Digestive and Kidney Diseases National Institutes of Health Bethesda, Maryland 20892

We have isolated clones encoding the rat insulinlike growth factor-binding protein-2 (IGFBP-2) gene and determined its organization and nucleotide sequence. The rat IGFBP-2 gene spans at least 8 kilobases and consists of four exons, each of which contains protein-coding sequences. The amino acid sequences of exons 1,3, and 4 are 32-50% identical to the corresponding exons of human IGFBP-1 and IGFBP-3, and 87-91% identical to those of human IGFBP-2. The 18 cysteines in the mature binding

the IGFBP-2 gene remains to be determined. (Molecular Endocrinology 4: 2039-2051, 1990)

INTRODUCTION Insulin-like growth factor-l (IGF-I) and IGF-II occur in plasma and tissue fluids complexed to specific IGFbinding proteins (IGFBP) (1). The IGFBP are thought to modulate the biological activity of IGF-I and IGF-II (2-4) and possibly determine their distribution between blood and tissue compartments (5). Nucleotide (nt) sequences have been reported for cDNA clones encoding three IGFBP in man and rat: IGFBP-1 (6-9), IGFBP-2 (1012), and IGFBP-3 (13-15). Partial amino acid sequences provide preliminary evidence for at least two more BP: one that is present in human bone cells (16) and adult rat serum (17), and another that has been purified from human cerebrospinal fluid (18) and transformed lung fibroblasts(19). Although specific functions have not been identified for the different IGFBP, differences in subunit association, tissue expression, and developmental, hormonal, and metabolic regulation suggest that they have an important biological role. For example, only IGFBP-3 is capable of associating with a second acid-labile nonbinding subunit to form the predominant 150-kDa IGFBP complex in adult human and rat serum (20, 21). IGFBP-1 is synthesized by decidualized endometrium (22) and is the major IGFBP in human amniotic fluid (23). Human IGFBP-2 (24) and a second 30- to 32-kDa IGFBP (18, 25) are the predominant IGFBP in human cerebrospinal fluid. IGFBP-3 in human plasma increases during puberty and is positively regulated by GH (26); IGFBP-1 decreases after birth and is increased in pregnancy (27), after fasting (28, 29), and in diabetes (30, 31). Inhibition of IGF action has been reported for IGFBP-1 (32-34), IGFBP-2 (2, 35), IGFBP-3 (36-38), and bone IGFBP (16), whereas synergism with IGF-I

proteins are conserved. Exon 2 shows negligible homology. Primer-extended reverse transcription indicated that the 5' end of IGFBP-2 mRNA is 151 nucleotides up-stream from the translation start site [designated nucleotide (nt) -151]. Consistent with this result, IGFBP-2 mRNA protected a genomic fragment terminating at approximately nt -148, as well as smaller fragments. A 1260 nt fragment containing 1144 nt of 5' flanking region had promoter activity when inserted in the correct orientation into a plasmid containing a promoterless luciferase reporter gene and transiently transfected into BRL-3A rat liver cells, which express IGFBP-2, but not when transfected into H4-II-E cells, which do not express IGFBP-2. The IGFBP-2 gene lacks a TATA box immediately up-stream from the transcription initiation site. It is GC rich (66% between nt -270 and +385) and contains GC boxes that might be recognized by transcription factors Sp1 or ETF. The promoter region contains multiple direct and indirect repeats. One direct repeat contains a variant Sp1 site (-158 to -150) near the consensus Sp1 site at nt -138 to -130. The 5' flanking region also contains motifs that might be recognized by transcription factors AP-1 {Jun/Fos), AP-2, and liver factor B1. The role of these sites in basal and regulated expression of 0888-6809/90/2039-2051 $02.00/0 Molecular Endocrinology Copyright © 1990 by The Endocrine Society

2039

Downloaded from https://academic.oup.com/mend/article-abstract/4/12/2039/2526332 by guest on 05 August 2018

Vol4No. 12

MOL ENDO-1990 2040

has been reported for IGFBP-1 (3, 33) and IGFBP-3 (36, 39, 40). Recent studies indicate that an important component in the regulation of IGFBP expression may occur at the level of mRNA abundance. Hepatic IGFBP-1 mRNA is rapidly, reversibly, and profoundly increased in streptozotocin-diabetic rats (41) and after fasting (9), and dexamethasone increases IGFBP-1 mRNA synthesis in a rat hepatoma cell line (42). IGFBP-2 mRNA levels also are highly regulated. Levels are high in fetal liver (10, 43) and in adult liver after fasting (41, 43) or diabetes (41, 44). In fetal rat brain, IGFBP-2 mRNA is selectively expressed in the epithelial layer of the choroid plexus, the infundibulum (progenitor of the posterior pituitary), and the floor plate (a region involved in the guidance of axons of commissural neurons) (45). Expression persists in the adult rat brain and remains localized to the choroid plexus (46). To understand the regulation of IGFBP-2 mRNA expression more precisely, we now report the cloning of the rat IGFBP-2 gene. We have identified the transcription initiation site and demonstrate the presence of functional promoter activity in the 5' flanking region.

shown in Fig. 1 was deduced, and exon positions confirmed by nucleotide sequencing (see below). The rat IGFBP-2 gene spans at least 8 kilobases (kb; Fig. 1). It has four exons, each of which contains protein-coding sequences. Exon 1 is contained on a 4.5-kb EcoRI insert in plasmid E12-3. Exons 2, 3, and 4 are contained on a 4.2-kb H/ndlll insert in plasmid H10-2. Southern blots of H/ndlll or BglW digests of rat liver genomic DNA were hybridized with IGFBP-2 cDNA probes, and the positive fragments compared with the restriction map of the IGFBP-2 genomic clones (Figs. 1

SmalSacI H Bg

NhelHindlll H Bg

RESULTS Organization of the Rat IGFBP-2 Gene A rat liver genomic library in Charon 4A was screened with rat IGFBP-2 cDNA probes. Two positive phages, 10 and 12, were identified. Phage DNA was digested with EcoRI or H/ndlll and subcloned into pGEM-7Zf(-). Restriction digests of positive subclones (H12-9, E123, H10-2, E10-1, and E10-7) were analyzed by Southern blotting and hybridized to probes corresponding to different regions of the cDNA. The restriction map

1.5— Bg H

X NHS

I I

I -UL

PB,

X PHP

EPBgSaBcPH

II I

H12-9

i-JI

H10-2 E10-7

E12-3

1.0—

E10-1

Fig. 1. Restriction Map of the Rat IGFBP-2 Gene Restriction digests of positive genomic subclones (E12-3, H12-9, E10-1, E10-7, and H10-2) were Southern blotted and hybridized with exon-specific probes. The deduced restriction map is shown above and drawn to scale; 1 kb is indicated. Restriction sites are: Bg, 8g/ll; X, Xho\; N, Nhe\; H, H/ndlll; P, Pst\, and E, EcoRI. The endpoints of the Smal-Sacl cDNA probe (10) are indicated by dashed lines: S, Smal; Sa, Sacl. Exons are shown by boxes; solid areas indicate the proteincoding region. Introns are indicated by shaded lines. EcoRI sites at the ends (not shown) may be present in the IGFBP-2 gene or may have been created during cloning. Regions spanned by the different genomic clones are shown below. Since clones E12-3 and E10-1 do not overlap, the size of intron 1 is unknown.

Downloaded from https://academic.oup.com/mend/article-abstract/4/12/2039/2526332 by guest on 05 August 2018

1 2

3

4

Fig. 2. Southern Blot Analysis of Rat Liver Genomic DNA Rat liver genomic DNA (20 ^g/lane) was incubated overnight with either H/ndlll (lanes 1 and 3) or BglW (lanes 2 and 4) and electrophoresed on a 1 % agarose gel. The DNA was transferred to GeneScreen by Southern blotting, and the blots hybridized with the Smal-Sacl cDNA probe containing the 3' portion of exon 1 and spanning exons 2-4 (lanes 1 and 2). After autoradiography for 3 days, the probe was stripped, and the same blot was hybridized with the A/nel-H/ndlll cDNA probe (lanes 3 and 4) and again exposed for autoradiography for 3 days. The Nhel-Hin6\\\ probe, nt 228-502 in the cDNA sequence (10), corresponds to the 5' end of exon 1 (Fig. 1). Sizes of hybridizing bands are indicated in kilobases.

2041

Rat IGFBP-2 Gene

and 2). Only bands of the expected size were seen. Using Hind\\\ digests, the Sma\Sac\ cDNA probe (which contains the 3' end of exon 1 and spans exons 2-4) hybridized to a major band of 4.2 kb and a minor band of 3.5 kb (Fig. 2, lane 1), whereas the Nhe\-Hind\\\ probe (corresponding to the 5' end of exon 1) hybridized only to a 1.5-kb band (Fig. 2, lane 3). The 4.2-kb band (lane 1) corresponds to the H/ndlll-H/ndlll insert of plasmid H10-2 (Fig. 1) and contains exons 2, 3, and 4. The minor 3.5-kb band corresponds to the 3' end of exon 1 extending into intron 1, since it hybridizes to the Sma\Sac\ probe, but not to the 5' Nhe\-Hind\\\ probe (lane 3). The 1.5-kb band seen with the Nhe\-Hind\\\ probe is equivalent to the insert of H12-9 (Fig. 1). BglW digests of rat liver DNA show a predominant 4.1-kb band with the Nhe\-Hind\\\ probe (Fig. 2, lane 4) and a major 6.5-, minor 4.1-, and faint 1-kb band with the Sma\Sac\ probe (Fig. 2, lane 2). The 4.1-kb band is contained within the insert of clone E12-3 (Fig. 1) and includes the 5' flanking region, exon 1, and part of intron 1. The 6.5-kb band contains exons 2 and 3 and extends into intron 1. The 1-kb band (seen only on longer exposures) brackets exon 4. Nucleotide Sequence of Exons and Exon-lntron Boundaries Exons were sequenced using exon-specific oligonucleotide primers (Fig. 3). Exon 1 (~536 nt) encodes the prepeptide and amino-terminus of the mature BP. Exons 2 and 3 are 224 and 141 nt long, respectively. Exon 4 is 474 nt long and includes 311 nt of 3 untranslated sequence to the point of divergence from

Exon

Exon size bp

5' splice donor

Gin Val Ala 1 2 8 -536

CAG GTT GCA Ggtaatgcggact

224

Pro Ala Arg 2 0 3 CCT GCC AGGgtcagtggagg

141

CTC AAA CAGgtgagtgtggg

Leu Lys Gin 2 5 0

4

the cDNA sequence (10). The last 5 As of the cDNA sequence, occurring at the end of an A-rich stretch, are not present in the genomic clone. A potential polyadenylation signal (ATTAAA) is present 18 nt up-stream from the poly(A) addition site, TA, which is followed by a G/T cluster down-stream in the genomic sequence (47).1 The mRNA length is calculated to be 1375 nt from the sizes of the exons. The nucleotide sequences of the four exons and the 3' untranslated region are nearly identical to those previously reported for IGFBP-2 cDNA. The genomic sequence differs at three positions from that reported by Brown et al. (10), but confirms the sequence of Margot et al. (11): a) nt 1356 in the 3' untranslated region is a C instead of T; b) nt 716 in exon 2 is G instead of A, but the amino acid (Leu) is not changed; and c) nt 1156 in exon 4 changes GTT (Val 298) to GCT (Ala). The exon/intron boundaries and sizes of introns are summarized in Fig. 3. Intron 1 is estimated as more than 2.3 kb. Overlapping clones through this region were not identified. Intron 2 is 687 nt long and was sequenced in its entirety (not shown).2 Intron 3 is approximately 1.9 kb. The sequences of donor and acceptor splice sites are consistent with the known consensus sequences (48). The exon-intron boundaries correspond to those reported for human IGFBP-1 (49, 1

The genomic nucleotide sequence beginning at the nt corresponding to nt 1482 of the cDNA sequence (10) is TAAAAAGTGTGTGTCTTATTTGAGATC. 2 The nucleotide sequences of intron 2 and the 5' untranslated region have been submitted to the GenBank/EMBL Data Bank.

3' splice acceptor

Intron size kbp

Asp Ser Glu tcttctctctgtagAC AGT GAG

Thr Pro Cys tttgtctcttcag ACC CCT TGC

>2.3

0.7

Cys Lys Met cctcttacctttcagTGC AAG ATG

-1.9

474

Fig. 3. Sequence of Exon-lntron Boundaries Exons 1-4 and exon-intron boundaries were sequenced as described in Materials and Methods. Exon numbers and sizes in base pairs are shown. Boundary exon sequences are capitalized, while intron sequences are shown in lower case letters. Dotted lines indicate intervening intron sequences. Three-letter abbreviations for deduced amino acids are shown above each exon sequence. Superscript numbers refer to the amino acid position in the IGFBP-2 precursor (10). Intron sizes are shown in kilobase pairs (kbp).

Downloaded from https://academic.oup.com/mend/article-abstract/4/12/2039/2526332 by guest on 05 August 2018

MOL ENDO-1990 2042

Vol4No. 12

(c)

(b)

(a)

Xbal

•87

•92

1 2

870-

1 A 3 4

5 6

ATG

-75

1

(a)

2 3

4

5 6

(b)

-65

+ 244 Fig. 4. Primer Extension Mapping of the 5'-end of Rat IGFBP2mRNA Top, Oligonucleotides complementary to different 5' regions of the rat IGFBP-2 gene were end labeled with [7-32P]ATP, hybridized overnight at 35 C with 50 fig of total BRL-3A RNA, and primer extended using reverse transcriptase, as described in Materials and Methods. Lanes 1 and 2, Oligonucleotide a (nt +4 to -22); lanes 3 and 4, oligonucleotide b (nt - 6 5 to -104); lanes 5 and 6, oligonucleotide c (nt - 7 6 to -99). Primer extension products were examined by electrophoresis on a 6% acrylamide sequencing gel. Lanes 1, 3, and 5 are control lanes in which the oligonucleotide primers were hybridized with 50 ng of yeast tRNA. Lanes 2, 4, and 6 show the primer extension products obtained when the oligonucleotides were hybridized with 50 ^g of total RNA from BRL-3A cells. For accurate size determination, sequencing reactions of appropriate genomic fragments and the same primers were run in parallel lanes (not shown). The sizes of the primer extension products (solid arrows) are shown in nucleotides. Open arrows indicate the positions of the nonextended primers. Bottom, Schematic diagram of a portion of exon 1 and the 5' flanking region, showing the location of oligonucleotides a, b, and c and the extent of the primer extension products. The translation start site (ATG, +1) is indicated as well as the point of sequence divergence between the cDNA and genomic clones (c/g; nt - 7 5 ; see text) (10). The oligonucleotide primers are shown by open boxes, and the 5' end labels are indicated by asterisks. The end points of reverse transcription deduced from the sizes of the primer extension products are shown by the horizontal arrows extending from the open boxes.

sty' Fig. 5. Ribonuclease Protection Assays to Define the 5' End of Rat IGFBP-2 mRNA Top, Antisense riboprobes Xbal-H/ndlll (nt -581 to +244; lanes 1-3) or Sfyl-H/ndlll (nt - 1 8 9 to +244; lanes 4-6) were hybridized overnight at 61 C to 15 ^g total BRL-3A RNA (lanes 2 and 5) or yeast tRNA (lanes 3 and 6). After hybridization, unprotected (single stranded) portions of the probes were digested with RNAases-A and -T1, and the samples were analyzed by electrophoresis on a 6% acrylamide sequencing gel, as described in Materials and Methods. Control lanes of each undigested probe (lanes 1 and 4) were also examined. The lengths (nt) of the undigested and protected probes are indicated. Bottom, Schematic diagram of a portion of exon 1 and the 5' flanking region showing the regions of the two riboprobes that were protected. The translation start site (ATG, +1) and the point of divergence between the cDNA and genomic clones (arrowhead) are indicated. Protected portions of the riboprobes are shown by the hatched boxes; unprotected portions are shown by the narrow lines.

Identification of the Transcription Start Site

mentary to nt +4 to - 2 2 relative to the translation start site, gave a specific band of 92 nucleotides when BRL3A RNA was used as a template (Fig. 4, lane 2), but not when yeast tRNA was the template (lane 1), indicating termination of reverse transcription at nt - 8 8 . The primer extension product was amplified using onesided polymerase chain reaction methodology (52). Its sequence was identical to that of the cDNA and genomic DNA from nt +4 to - 7 5 . From nt - 7 5 to - 8 8 , the sequence was identical to that of genomic DNA, but different from the cDNA sequence (10), suggesting a cloning error in the 5' end of the cDNA.

Primer Extension Primer extension mapping was performed to define the precise 5' end of IGFBP-2 mRNA (Fig. 4). Antisense oligonucleotide a, comple-

To determine whether nt - 8 8 corresponded to an authentic transcription initiation site or resulted from premature reverse transcriptase termination, additional primer extension assays were performed using anti-

50) and human IGFBP-3 (51). The locations of the 18 cysteine residues are conserved in the three BP genes: 12 in exon 1, 2 in exon 3, and 4 in exon 4.

Downloaded from https://academic.oup.com/mend/article-abstract/4/12/2039/2526332 by guest on 05 August 2018

Rat IGFBP-2 Gene

2043

Table 1. Promoter Activity of Constructs Containing the 5' Flanking Region of the rat IGFBP-2 Gene Fused to a Luciferase Reporter Gene Exp No.

1

2

3

4

5

Method

Electroporation

Cell

3A

Construct

Sense (n = 4) Antisense (n = 4) Promoterless (n = RSVLUC (n = 4) Electroporation 3A Sense (n = 4) Promoterless (n = RSVLUC (n = 3) Electroporation 3A Sense (n = 4) Promoterless (n = RSVLUC (n = 3) Sense (n = 1) Calcium phosphate 3A Antisense (n = 1) RSVLUC (n = 1) Electroporation H4IIE Sense (n = 3) Promoterless (n = RSVLUC (n = 2)

Luciferase (U)

GH (ng/ml)

6,130 ± 1,160 1.1 287 ± 95 0.9 9±8 3) 1.6 59,900 ±17,900 1.5 1,100 ±180 1.0 3±4 3) 1.5 14,100 ±4,300 1.8 1,800 ± 775 3.5 2±2 3) 2.9 25,600 ± 3,960 3.6 608 71

12,500 79 ± 17 1)

4

44,510 ±3,870

Normalized Luciferase/GH (U/ngml)a

±0.1 5,610 ±1,270 ± 0.4 324 ± 37 4±4 ±0.3 ±0.7 46,100 ±23,100 ±0.1 1,190 ±273 3±3 ±0.3 ±0.5 7,780 ± 894 500 ±139 ± 0.8 0.7 ± 0.7 ± 0.9 ± 0.6 7,160 ±662

ND" ND ND ND ND ND

% RSVLUC

% RSVLUC Corrected"

10.0 ±2.0 12.0 ± 3 . 0 0.7 ± 0.01 0.5 ± 0.2 0.01 ± 0.01 0.01 ± 0.01 100

100

15±4 7.7 ±1.3 0.02 ± 0.03 0.03 ± 0.04 100

100

7.0 ± 3.0 7.0 ± 2.0 0.01 ± 0.01 0.01 ± 0.01 100 4.8 0.6 100

100

0.2 ± 0.04 0.01 100

Plasmids containing the 5' flanking region of the IGFBP-2 gene fused to a luciferase reporter gene in the sense and antisense orientations, promoterless plasmids, and plasmids containing the RSV promoter region were cotransfected with plasmid pTKGH into BRL-3A (Exp 1-4) or H4-II-E (Exp 5) cells. Constructs are described in Materials and Methods and Fig. 6. Luciferase activity in cell lysates (expressed in relative light units) and GH in conditioned medium (nanograms per ml by RIA) were determined 48 h after transfection by electroporation (Exp 1-3 and 5) or with calcium phosphate precipitates (Exp 4). The mean, SD, and number of replicate samples are given for each assay in each experiment. " Normalized, Mean and SD of luciferase/GH determined for individual samples. 0 % RSVLUC, Mean luciferase activity (units) for each construct/Mean luciferase activity for RSVLUC in the same experiment. c % RSVLUC corrected, [Mean luciferase/GH] for each construct/[Mean luciferase/GH] for RSVLUC in the same experiment. " Not determined.

sense oligonucleotide primers that spanned nt - 8 8 (Fig. 4, lanes 3-6). Primer extension products of 87 bp (lane 4) and 76 bp (lane 6) were observed with oligonucleotide b (nt - 6 5 to -104) and oligonucleotide c (nt - 7 6 to -99), respectively, using BRL-3A RNA as template. The extended products using either oligonucleotide corresponded to termination of extension at nt - 1 5 1 . These results suggest that nt - 1 5 1 is the transcription initiation site and that the termination at nt - 8 8 observed with the oligonucleotide a primer represented premature termination of reverse transcription. This may have resulted from the formation of a potential stem-loop structure between nt - 1 1 3 to - 9 4 and - 7 2 to - 5 0 , as indicated by computer analysis of RNA secondary structure (not shown). Ribonuclease Protection Ribonuclease protection experiments were performed to confirm that nt - 1 5 1 was a transcription start site (Fig. 5). Antisense riboprobes which extended from the H/r?dlll site at nt +244 to the Xba\ site (nt -581) or the Sty\ site (nt -189) were transcribed using SP6 polymerase and [a-32P]UTP. Hybridization of either riboprobe to 15 ^g BRL-3A RNA protected several bands from digestion by single strand specific ribonucleases-A and -T1. By contrast, riboprobes hybridized to yeast tRNA were not protected against nuclease digestion. The protected bands range in size from approximately 359-392 nt. The longer 392nt band corresponds to protection of the region extend-

Downloaded from https://academic.oup.com/mend/article-abstract/4/12/2039/2526332 by guest on 05 August 2018

ing from nt +244 to - 1 4 8 , three nucleotides short of the putative transcription initiation site at nt - 1 5 1 that had been identified by primer extension. Demonstration of Promoter Activity Using Transient Transfection Assays Transient transfection assays were performed to demonstrate that the region upstream from the putative transcription initiation site contained a functional promoter. A 1260-basepair (bp) Hind\\\-Nhe\ fragment from the 5' flanking region (nt - 3 5 to -1295 with respect to ATG) was subcloned in sense and antisense orientations into plasmid pA3LUC up-stream from a luciferase reporter gene that contains the luciferase-coding region but lacks a promoter. The chimeric plasmids were transfected by electroporation into BRL-3A cells, a cell line known to express IGFBP2. After 48 h, the cells were lysed, and the cell extracts assayed for luciferase activity. The results are summarized in Table 1 and Fig. 6. Plasmids consisting of the putative rat IGFBP-2 promoter region ligated in the sense orientation had approximately 1 1 % of the activity of a construct, RSVLUC, in which the luciferase gene is driven by the strong RSV promoter. By contrast, plasmids in which this region of the rat IGFBP-2 gene was inserted in the reverse orientation had only 0.7% as much activity as RSVLUC (Fig. 6). Similar results were obtained after correction for the efficiency of transfection using cotransfected plasmids containing the human GH gene

Vol4No. 12

MOL ENDO-1990 2044

controlled by a thymidine kinase promoter or when calcium phosphate precipitates were used for transfection (Table 1). Transfection of the sense construct of the rat IGFBP-2 promoter into H4-II-E cells, a cell line that does not express IGFBP-2, showed negligible luciferase activity (0.2% relative to RSVLUC; Table 1). We conclude that the 5' flanking region of the IGFBP2 gene contains a functional and cell-specific promoter. Identification of Putative Regulatory Sequence Elements The nucleotide sequence of the 5' flanking region of the IGFBP-2 gene was determined (Fig. 7). Exon 1 and the region immediately up-stream of the putative transcription initiation site (nt +385 to -270) is 66% GC, but does not contain a consensus TATA or CCAAT box (53). Multiple direct and inverted repeats are clustered around the transcription start site. The region contains several DNA motifs that are potentially recognized by one or more frans-acting proteins that regulate transcription. GGGGCGGGG at positions -138 to -130 is a putative binding site for the Sp1 transcription factor (54). Two additional Sp1 sites are present within the 5' translated region of exon 1 (nt +15 to +20 and +75 +80). A modified Sp1 site in which A is substituted for C occurs between nucleotides -158 to -150. The sequence CCCAGGC at positions -1031 to -1025 is identical to an AP-2 site in the human GH gene, which is recognized by factors that typically are regulated by cAMP and phorbol esters (55). An AP-1 element (TGACTCA) at -962 to -956 can potentially be recognized by Jun/Jun or Jun/Fos dimers (56). Potential Pan-binding elements identical to the ones found in the insulin gene, CATCTGT, and human immunoglobulin (^-heavy chain and *-light chain), CACCTGC, are present at nt -655 to -649 and - 4 5 to - 3 9 , respectively (57). The sequence GTCAATAATTAAG between nt -1018 and -1006 agrees with the consensus sequence for liver factor B1 at 11 of 13 positions (58). Two ATTGG motifs at -1266 to -1262 and +12 to +16 are potential CTF sites (59), and the TCCCCAG sequence at position -473 to -467 is a TC motif (60).

DISCUSSION

In order to understand the transcriptional regulation of the rat IGFBP-2 gene, we have isolated genomic clones encoding rat IGFBP-2 and determined the structure of the IGFBP-2 gene, the transcription initiation site, and the nucleotide sequence of its 5' flanking region. Southern blots of restriction digests of cloned genomic DNA and rat liver genomic DNA are similar, suggesting that there is a single IGFBP-2 gene. The gene spans at least 8 kb and is organized similarly to the human IGFBP-1 (49, 50) and human IGFBP-3 (51) genes. The coding region is present on four exons; IGFBP-3 has a fifth exon containing 3' untranslated sequences (51). The amino acid sequence is virtually identical to that deduced from rat IGFBP-2 cDNA clones (10, 11). Exonintron boundaries occur at consensus splice sites (48)

Downloaded from https://academic.oup.com/mend/article-abstract/4/12/2039/2526332 by guest on 05 August 2018

12 -

8 -

4 -

PFig. 6. Promoter Activity of an IGFBP-2 5' Flanking Region A H/ndlll-A//jel restriction fragment of the rat IGFBP-2 gene (nt -1295 to -35) was inserted up-stream of a promoterless luciferase gene (P—) in plasmid pA3LUC in sense (S) or antisense (A) orientations. Plasmids (50 ng) were cotransfected with plasmid pTKGH (50 ^g) by electroporation into BRL-3A cells. After 48 h, the cells were lysed, and luciferase activity in the lysates was measured. GH in the medium was determined by RIA. In each experiment transfections were performed in triplicate or quadruplicate (see Table 1). Luciferase activity is expressed as a percentage of the activity in transfections with RSVLUC in the same experiment. Results are the average of Exp 1-3 in Table 1 and are plotted with (shaded bars) or without (open bars) normalization for GH expression.

and in homologous positions in IGFBP-1 and IGFBP-3 genes (49-51). The three genes are more closely related in exons 1, 3, and 4 than in exon 2 (Table 2). The percentage of identical amino acids in these three exons is 32-50%, compared with 87-91% for human IGFBP2, confirming that they are members of a family of IGFBP. The positions of the 18 cysteine residues in the mature BP, localized to exons 1, 3, and 4, are conserved. No significant homologies are apparent within exon 2. Primer extension analysis indicates that transcription initiates at nt - 1 5 1 . This was confirmed by ribonuclease protection experiments using 5' genomic fragments, in which a protected fragment whose 5' end corresponded to approximately nt -148 was observed. (Sizing of the protected fragments is less accurate than primer-extension because of their larger size.) Primer extension using a more 3' primer that spanned the translation start site gave an extended fragment that terminated at nt - 8 8 instead of nt - 1 5 1 . However, ribonuclease protection experiments failed to identify a fragment whose 5' end corresponded to nt - 8 8 , suggesting that the observed primer-extended fragment represented premature termination of the reverse transcription reaction, rather than an authentic transcription initiation site. Multiple fragments with 5' ends between nt -115 and -148 were observed to be protected from ribonuclease digestion. This may represent aberrant protection resulting from secondary structure in the mRNA or transcription initiation at multiple sites, as reported for other promoters lacking TATA boxes (61, 62).

Rat IGFBP-2 Gene

-1296

2045

AAGCTTTAATTTCACACCCGTCCCCCTTCTAHGHGATAGTTGTCTTTTCTACAAAGTCCAAACTCTCCTACACGCTTTCTCTCCTAGTTTCTT

-1200 -1100

GGATGGTTTRfiAGAAGTr.TTGTGGGGGAAGGGAGACGCCTCACTGAGCAAAGGTCTTTGTTAAGGTCACAACCCAGGCAGAGGAGTCAATAATTAAGGTC

-1000

CTGTCCGTGCTGGAGTGAGGTTGGGGGCAGCTAGGCTGAGTGACTCAATCAGAACAATGGAGGCAGCCTCACGTTTCCGTTTGTGTACCTGGGCGAGCTC

-900 -800 -700

GCTCGTGGGGTGGAGGTTTATAAGGCATCAGGAAAGACACCAGGTTTCATCTGTTGTCGCCGTGAGCTCTGGCTTGGGAAAATGAAGTTGTTGCTACGAG

-600 -500

ATTTCTAAGGTCAAGATTGCTTTTGTGTTTCCCCAGCAGTCAGTTCACAGCCGGCCACGTGGGAAGTGAGCAAACTAAGTCCTTCCAAATCGAACTAAAC

-400 -300 -200

AGGAGTGCCTTGGGGGGGAAGGGAGTGGTCTCCAAAAG|3GGGAGGGG>GAAGGCAGGG|3GGGCGGGGfiGAAGCAGGCTTTTTAGGACCCGGCAGCAGCGG

-100 *

l

ATGCTG

Fig. 7. Nucleotide Sequence of the Rat IGFBP-2 Gene 5' Untranslated and 5' Flanking Regions The sequence of the rlGFBP-2 gene from the translation start site (ATG + 1 ; shown in bold type) to the H/ndlll site at nt -1296 is shown. The putative transcription start site at - 1 5 1 , indicated by primer extension, is shown by an upward solid arrow. The 5' ends of genomic fragments protected from RNase by hybridization to BRL-3A RNA are bracketed by arrowheads (estimated as -148 to -115). Direct repeat sequences that contain the variant Sp1 site (-158 to -150) and the consensus Spi site (-138 to -130) are indicated by horizontal arrows. The Sp1 and Sp1 variant sites are boxed; the C to A substitution site in the variant site is underlined. The DNA motifs recognized by trans-acting DNA-binding transcription factors (CTF, AP-2, AP-1, LF-B1, TFIID, Pan, and the TC box) are underlined.

Table 2. Amino Acid Identities of Rat IGFBP-2 Exons to Human IGFBP-1, IGFBP-2, and IGFBP-3

IGFBP-1 IGFBP-2 IGFBP-3

Exon 1

Exon 2

Exon 3

Exon 4

43.9 (40/91) 87.2 (82/94) 50.0 (47/94)

14.0 (8/57) 86.8 (66/76) 16.0 (12/75)

32.6 (14/43) 100 (47/47) 42.5 (17/40)

32.8 (22/67) 90.7 (49/54) 35.7 (15/42)

Amino acid sequences of rat IGFBP-2 (Refs. 10 and 11 and present study) were compared with those of human IGFBP-1, (49,50), human IGFBP-2 (12), and human IGFBP-3 (13). Exonintron boundaries were inferred for human IGFBP-2 by analogy with rat IGFBP-2. Nucleotide insertions were placed to maximize homologies and preserve cysteine alignment. The percentage of identical residues is given based on the fraction of identical vs. total residues compared in the shorter sequence (shown in parentheses below).

Downloaded from https://academic.oup.com/mend/article-abstract/4/12/2039/2526332 by guest on 05 August 2018

A functional promoter was demonstrated in the 5' flanking region of the rat IGFBP-2 gene in transient expression assays using constructs in which a W/ndlllNhe\ fragment (nt -1295 to - 3 5 with respect to the translation start site) was fused to a luciferase reporter gene. Luciferase expression was observed after transfection into BRL-3A cells, which express IGFBP-2, but not after transfection of H4-II-E cells, which do not express IGFBP-2. Expression was similar whether transfection was by electroporation or using calcium phosphate precipitates, but only when the IGFBP-2 genomic fragment was in the correct orientation with respect to the luciferase-coding region. These results indicate that the 5' flanking region of the rat IGFBP-2 gene contains functional cell-specific promoter elements. Preliminary results indicate that promoter activity is retained when an Xba\-Nhe\ fragment (-581 to -35) corresponding to the proximal flanking region is used, but greatly reduced using a Sty\-Nhe\ fragment (-189 to -35) (our unpublished results). Unlike IGFBP-1 (49, 50) and IGFBP-3 (51), the rat IGFBP-2 gene lacks a TATA box near the transcription

MOL ENDO-1990 2046

initiation site. TATA boxes are typically located 30 nucleotides up-stream from the transcription initiation site and are thought to be important for accurate initiation of transcription. The TATA box is recognized by the transcription factor TFIID, which forms part of the initial complex with RNA polymerase-ll (63). Like other TATA-less genes, including genes that are expressed in many tissues [e.g. hypoxanthine phosphoribosyltransferase, adenosine deaminase, and hydroxy-3methylglutaryl coenzyme-A reductase (61)] and receptors for epidermal growth factor (64), nerve growth factor (65), and insulin (62, 66), the IGFBP-2 gene is highly GC rich in exon 1 and the first 120 nt of the 5' flanking region. Common features of these genes appear to be the presence of GC boxes that might be recognized by positive transcription factors, such as Sp1 (54) or ETF (67). A potential Sp1 site is present at -138/-130 of the rat IGFBP-2 gene within the transcribed region, although it remains to be determined whether this site is used. Although the consensus recognition sequence for ETF has not yet been precisely defined, it contains a core sequence of either four Cs or four Gs (67). ETF-binding elements are more active in TATA-less promoters than promoters containing a TATA box, and those containing four Cs are more active than those containing four Gs (67). Fifteen G4 sequences and four C4 sequences are present in the IGFBP-2 flanking region. However, the C4 sequences are bracketed by AT rather than GC, making it less likely that these sites are significant. The rat IGFBP-2 promoter region has multiple direct and inverted repeats. One that is particularly intriguing is a modified Sp1 site that overlaps the putative transcription initiation site at nt -151 (-158/-150). Compared with the consensus Sp1 site at —138/—130, the variant site has an A for C substitution at position -154. In the low density lipoprotein receptor gene (68), a variant Sp1 sequence in tandem with a consensus Sp1 site appears critical to the regulation of transcription by sterols. The consensus site is a positive constitutive transcriptional element that is not regulated by sterols. The tandem modified Sp1 site confers strong repression of transcriptional activity by sterols. Whether the variant Sp1 sequence in the rat IGFBP-2 gene has a similar regulatory role remains to be determined. The up-stream nucleotide sequence was analyzed for possible sequences that might bind known transcription factors. Like IGBFP-3 (51), but unlike the IGFBP-1 gene (49, 50), the rat IGFBP-2 gene does not have a CCAAT (53) box near the start of transcription. Several potential cis regulatory elements were observed, however, including sites for AP-1, AP-2, liver factor-B1 (LFB1), Pan, and a TC box (Fig. 7). An AP-1 site that can potentially be recognized by Jun/Jun and Jun/Fos dimers is present at -959/-952 (53, 56). Most AP-1 proteins are regulated by phorbol esters (53). Preliminary results indicate that IGFBP-2 mRNA in sheep thyroid cells is induced by tetradecanoyl-phorbol-13-

Downloaded from https://academic.oup.com/mend/article-abstract/4/12/2039/2526332 by guest on 05 August 2018

VoUNo. 12

acetate.3 An AP-2 site is found 1031 nt up-stream from the translation start site (55). Trans-activating factors that recognize the AP-2 site are typically regulated by cAMP and phorbol esters (55). An AP-2 site also is present in the human IGFBP-3 gene (51), but not in human IGBFP-1 (49, 50). Two sequences recognized by Pan-binding factors are present; one at positions -655/-648 (identical to a site in rat insulin), and the second at positions - 4 5 / - 3 9 (identical to a site in human immunoglobulin genes) (57). A potential LF-B1 site occurs at —1018/—1003. LFB1 has regions of homology with the homeodomain of DNA-BP and is a transcriptional activator required for the expression of several liver-specific genes, including fibrinogen-a and -b, albumin, a-antitrypsin, a-fetoprotein, transthyretin, aldolase, pyruvate kinase, and the hepatitis B large surface protein gene (58). The putative LF-B1 site in the IGFBP-2 gene has an 11/13-nt match to the core of the LF-B1 consensus sequence. A possible LF-B1 site with an 11/13-nt match to the consensus sequence also is present 72 nt up-stream from the transcription initiation site in the IGFBP-1 gene. The LFB1 site in the IGFBP-2 gene (-865 relative to the putative CAP site) is further from the CAP site than those previously reported for other genes (-44 to -358). Although IGFBP-1 and IGFBP-2 mRNAs are expressed at highest levels in the liver of fetal rats, whether any of these potential regulatory sites affect IGFBP-2 gene transcription remains to be determined. Sites distal to nt -581 do not appear to be required for basal promoter expression in BRL-3A cells, since constructs containing this truncated 5' flanking region are expressed (our unpublished results). Regulation of IGFBP-2 mRNA in vivo occurs with developmental age, in different tissues, and with hypoinsulinemia in diabetes, fasting, and hypophysectomy (10,11,41, 43, 44). Insulin appears to directly regulate IGFBP-2 mRNA levels in hepatocytes (69). Insulin regulates the transcription of many genes (70, 71), with effects observed within 30 min (72, 73). Insulin regulatory elements have been identified for the glyceraldehyde-3-phosphate dehydrogenase (73) and the phosphoenolpyruvate carboxykinase (74) genes. Further analysis of the regulatory elements of the IGFBP-2 gene by deletion/mutation analysis and DNAse footprinting will be required to determine which cis elements and frans-acting factors are involved in the regulation of IGFBP-2 transcription in vivo.

MATERIALS AND METHODS Chemicals and Enzymes Enzymes were purchased from the following commercial suppliers: Promega (Madison, Wl), Boehringer Mannheim (Indianapolis, IN), New England Biolabs (Beverly, MA), Amersham Corp. (Arlington Heights, IL), Bethesda Research Laboratories 3 Eggo, M. C , L. K. Bachrach, A. L. Brown, and G. N. Burrow, manuscript submitted.

Rat IGFBP-2 Gene

(Gaithersburg, MD), Pharmacia PL Biochem (Piscataway, NJ), U.S. Biochemicals (Cleveland, OH), and Perkin Elmer Cetus (Norwalk, CT). Polymerase chain reactions were performed on a Perkin Elmer-Cetus thermocycler using a DNA amplification kit (GeneAmp, Perkin Elmer Cetus). Radionuclides were purchased from Amersham Corp. Oligonucleotides were synthesized using a Pharmacia Gene Assembler. Electroporation was performed using a Bethesda Research Laboratories Cell-Porator. Medium for cell growth was obtained from Gibco (Grand Island, NY). Fetal calf serum was obtained from HyClone (Logan, UT). The GH assay kit was obtained from Nichols (San Juan Capistrano, CA). Isolation and Restriction Mapping of Genomic Clones for Rat IGFBP-2 A genomic library of partial Haelll digests of rat liver DNA cloned into the EcoRI site of Charon 4A (75) was screened using rat IGFBP-2 cDNA probes. The library was plated at approximately 35,000 plaques/150-mm plate using the restrictionless suppressor F host E. coli LE392. Duplicate plaque lifts were performed using nitrocellulose filters. The baked filters were hybridized with two rat IGFBP-2 cDNA probes (10), Sma\Sac\ (nt 557-1087) and Msp\-Afl\\ (nt 1101-1457). Double stranded probes were labeled by random priming using [«-32P]dCTP (76). Hybridization conditions were described previously (77). Positive phages were purified by replating. DNA was isolated from seven positive clones by polyethylene glycol precipitation and glycerol step gradient centrifugation of phages, followed by proteinase-K digestion of phage coats and removal of protein by phenol-chloroform extraction (78). Phage DNA was digested with restriction enzymes and analyzed by electrophoresis on 1.5% agarose gels. The DNA was depurinated for 5 min by soaking the gel in 100 ml 0.25 N HCI, followed by soaking twice (15 min each) in 100 ml 0.5 N NaOH. The DNA was transferred to GeneScreen (New England Nuclear, Boston, MA) by quick blotting in 1 M ammonium acetate (79). Baked blots were hybridized sequentially with three IGFBP-2 cDNA probes (10): Nhe\-Hind\\\ (nt 228502); Smal^SacI (nt 557-1087) and Msp\-Afl\\ (nt 1101-1457). DNA from phages 10 and 12 was digested with EcoRI or H/ndlll, restriction fragments were separated by electrophoresis, and positive bands were subcloned into plasmid pGEM7Zf(-) (Promega) to give subclones E10-7, E10-1, and H102 from phage 10 and subclones E12-3 and H12-9 from phage 12. Aliquots of subcloned DNA were digested with restriction enzymes, either singly or in combination. The DNA fragments were electrophoresed on a preparative 1.5% agarose gel and transferred by Southern blotting to GeneScreen, as described above. The membrane was cut into strips, which were hybridized with deoxyoligonucleotide probes (18-mer to 60-mer) corresponding to different regions of the cDNA. Oligomer probes were end labeled using T4 polynucleotide kinase and [7-32P]ATP (80). Southern blots were hybridized with the oligomers as described previously (81). Southern Blot Analysis of Rat Liver Genomic DNA Rat liver genomic DNA (20 ^g/lane) was prepared from adult Sprague-Dawley rat liver which had been quick-frozen in liquid nitrogen and ground to a fine powder together with dry ice. Liver cells were lysed in 10 vol 1 IDM Tris-CI (pH 7.5), 0.5 M EDTA (pH 8.0), 100 ^g/ml proteinase-K, and 0.5% sarkosyl. Protein was removed by phenol extraction. The DNA was purified by cesium chloride equilibrium centrifugation and extensively dialyzed against 10 mM Tris-CI and 1 mM EDTA, pH 7.5 (78). The DNA was digested overnight with either Hind\\\ or flg/ll, after which the restriction fragments were separated by electrophoresis on a 1 % agarose gel (20 V, 18 h). The DNA in the gel was transferred to GeneScreen by Southern blotting as described above except that depurination was for 10 min. The blot was hybridized sequentially to the Sma\Sac\ and Nhe\-Hind\\\ IGFBP-2 cDNA probes (see above).

Downloaded from https://academic.oup.com/mend/article-abstract/4/12/2039/2526332 by guest on 05 August 2018

2047

Sequencing of Subcloned Genomic DNA Double stranded sequencing was performed by the dideoxy chain termination method (82) using a Sequenase kit (U.S. Biochemical) and [-32P]ATP (80): a) 5'-AGCATGTTGGCTAGTGGGAAACCGTA-3' (nt +4 to - 2 2 , relative to ATG = +1); b) 5'-GGGAGACGCCTCCTTGCCTTCTTTCTCCTCCCCCGCTGCT-3' (nt - 6 5 to -104); and c) 5'-CCTTGCCTTCTTTCTCCTCCCCCG3' (nt - 7 6 to -99). Labeled deoxyoligonucleotides were purified by elution from Elutip columns (Schleicher and Schuell, Keene, NH), followed by buffer exchange on Sephadex G-25 Quick Spin columns (Boehringer Mannheim). Approximately 2 x 105 cpm probe were added to 50 j*g total BRL-3A RNA and lyophilized to dryness. The pellet was taken up in 20 »\ hybridization buffer [80% formamide, 0.4 M NaCI, 40mM PIPES (pH 6.4), and 1 mM EDTA], transferred to a 50-^1 glass capillary tube, and sealed at both ends. The capillary tube was placed in a water bath at 75 C, and the temperature was immediately adjusted to 35 C and allowed to remain at 35 C overnight (15 h). The capillary tube was cut, and the contents were expressed on ice into a 40-/J mixture of 0.25 mg/ml tRNA, 0.45 M sodium acetate (pH 5.5), and 12.5 mM magnesium acetate (84). The DNA-RNA hybrid was ethanol precipitated, washed, dried, and resuspended in 12 ^l water. The oligonucleotide primer was extended with avian myeloblastosis virus reverse transcriptase (20 n\; 41 C; 1 h), using a cDNA synthesis kit (Boehringer Mannheim). After hydrolysis of the RNA, the primer extension product was extracted with phenol and chloroform, ethanol precipitated, and analyzed by electrophoresis on a 6% acrylamide sequencing gel. Polymerase Chain Reaction Amplification of the 5' Region of the Rat IGFBP-2 cDNA Single strand cDNA was synthesized from 2 ng BRL-3A poly(A) RNA using a cDNA synthesis kit (Boehringer Mannheim) and random hexanucleotide primers. The RNA-DNA hybrid was centrifuged through a Sephadex G-50 Quick Spin column (Boehringer Mannheim) to exchange buffers and remove excess random primers. The RNA-DNA hybrid was incubated with terminal deoxynucleotide transferase and dATP in a volume of 30 /J to add a 3' dA tail (78). The mixture was diluted to 150 n\, and aliquots of the DNA (1 and 10 Ail) were amplified using the one-sided polymerase chain reaction method (52). The 3' primer was complementary to nt +4 to - 2 2 : 5'-AGCATGTTGGCTAGTGGGAAACCGTA3'. The 5' primer contained a poly(dT) stretch complementary to the synthetic poly(dA) tail, and a 5' portion containing Xho\ and EcoRI restriction sites: 5'AAGACTCGAGAATTCl I I I I I I I I I I I I I I I I-3'. The polymerase chain reaction products were digested with Nhe\ (since an Nhe\ site is present at nt -35) and Xho\ (to

Vol4No. 12

MOL ENDO-1990 2048

digest the Xnol site incorporated using the 5' primer), separated from the primers by agarose gel electrophoresis, isolated, and subcloned into plasmid pGEM-7Zf(-). Subclones were screened by Southern blotting of minipreparations of plasmid DNA and hybridization with a rat IGFBP-2 cDNA fragment extending 341 nt 5' from the A/nel site at nt - 3 5 . Positive clones were sequenced. Ribonuclease Protection Assay Plasmid H12-9 contains a 1539 nt H/ndlll-H/ndlll insert (nt -1293 to +244) that includes the 5' region of exon 1 and upstream flanking sequences (see Results). To generate antisense riboprobes, plasmid H12-9 was digested with Xbal or Sty\ and transcribed in vitro using SP6 polymerase and [«-32P] UTP as described in the Promega catalog. The 870-nt Xbal riboprobe consisted of 45 nt of transcribed vector sequences between the SP6 transcription initiation site and the 3' H/ndlll site at nt +244, followed by 825 nt corresponding to the region between the H/ndlll site and the Xba\ site at nt - 5 8 1 . Similarly, the 478-nt Sty\ riboprobe consisted of 45 nt of transcribed vector sequences, followed by 433 nt between the 3' H/ndlll site at nt +244 and the Sty\ site at nt -189. The probes were hybridized to total BRL-3A RNA (15 ng) or yeast tRNA in solution, and single stranded RNA was digested with ribonucleases-A (0.9 fig/m\) and -T1 (0.73 U/ml), as described previously (77). Samples were analyzed by electrophoresis on a 6% acrylamide sequencing gel. Markers were provided by a set of sequencing reactions analyzed on the same gel. Preparation of Plasmids for Transfection Promoter activity in a 5' flanking fragment of IGFBP-2 gene DNA was identified by transient transfection assays in which the test fragments were fused to the firefly luciferase reporter gene (85). Genomic fragments were ligated into plasmid pA3LUC (kindly provided by Dr. William M. Wood, University of Colorado). This expression vector consists of the proteincoding region of the luciferase gene (LUC), a promoter insertion site, and three copies of the SV40 poly(A) termination signal preceding the promoter site to prevent run-on transcription from vector promoters, subcloned into a modified pGEM7Zf(+) (Promega) (86, 87). Plasmid E12-3 was digested with H/ndlll and Nhe\, and a 1260 nt fragment was isolated, consisting of 1144 nt up-stream of the putative transcription start site and 116 nt of 5' untranslated region. After the addition of H/ndlll linkers, this fragment was ligated into plasmid pA3LUC to give two plasmids in which the insert was present in the sense and antisense orientations, respectively. Plasmid pA3RSVLUC (also provided by Dr. Wood), in which the luciferase gene is under the control of the strongly expressed enhancer and promoter of the 3' long terminal repeat of Rous sarcoma virus, was used as a positive control. The efficiency of transfection was controlled by cotransfection of plasmid pTKGH (88), in which the human GH gene is under the control of the thymidine kinase promoter. Plasmids to be used for transfection were prepared by the alkaline lysis method, followed by double banding on cesium chloride gradients (78). Transfection of BRL-3A and H4-II-E Cells The Buffalo rat liver cell line (BRL-3A) was used as a transfection recipient, since it expresses rat IGFBP-2 mRNA and had been used to isolate the rat IGFBP-2 cDNA clone (10). For control experiments, rat H4-II-E hepatoma cells that express IGFBP-1, but not IGFBP-2 mRNA (89), were used. BRL-3A cells were grown to confluence (2-3 x 106 cells/100-mm dish) in Ham's F-12 medium containing 5% fetal calf serum. H4-II-E cells were grown to confluence in RPMI-1640 medium supplemented with 10% fetal calf serum. Before transfection experiments, the cells were detached from the culture dishes using 0.05% trypsin-0.02% EDTA for 3 min at 37 C and replated at

Downloaded from https://academic.oup.com/mend/article-abstract/4/12/2039/2526332 by guest on 05 August 2018

1:3 dilution. After 48 h, the cells were again suspended using trypsin-EDTA, washed, resuspended in HeBS [20 mM HEPES (pH 7.0), 137 mM NaCI, 5 mM KCI, 0.7 mM Na2HPO4, and 6 mM dextrose; 1 ml/plate) containing the DNAs to be transfected (50 ng luciferase plasmid and 50 fig pTKGH), and transferred to disposable electroporation chambers. Electroporation was performed at 300 V and 800 mF at room temperature using a BRL electroporation apparatus (Bethesda Research Laboratories, Gaithersburg, MD) (90). The electroporated cells were allowed to sit at room temperature for 10 min before being replated in complete medium. Each point was the average of triplicate or quadruplicate electroporations. Approximately 48 h after transfection, medium was collected, centrifuged to remove floating cells, and stored at - 8 0 C for GH analysis. The cells attached to the plates were lysed in 1 ml 1 % Triton X-100, 25 mM glycylglycine (pH 7.8), 15 mM MgSO4, 4 mM EGTA, and 1 mM dithiothreitol. Luciferase activity in the cell extracts was assayed immediately by the ATP-dependent oxidation of luciferin (91), using an automated luminometer (Berthold Clini-Lumat, London Diagnostics, Eden Prairie, MN). To aliquots of lysate (0.1 ml) and buffer (0.36 ml), luciferin (0.2 ml 0.2 mM) was injected for 1.2 sec, and light emission (390-620 nm) was quantitated for 2 sec at 25 C. Under these conditions, light output (relative light units) is proportional to luciferase activity. GH secreted into the medium was assayed using a solid phase RIA kit. All samples were assayed in duplicate. GH content was determined from a human GH standard curve (0.5-50 ng/ml). Note Added in Proof An insulin response element (IRE-A) has been identified in the glyceraldehyde-3-phosphate dehydrogenase gene (92). Nucleotides -795 to -787 of the rat IGFBP-2 gene are identical to the 8 nucleotide core sequence of IRE-A.

Acknowledgments We thank D. E. Graham for helpful discussions and for performing the computer analysis of nucleotide sequences. We thank D. E. Graham, C. McKeon, G. T. Merlino, and G. T. Ooi for critical reading of the manuscript.

Received August 20, 1990. Revision received September 25,1990. Accepted September 26,1990. Address requests for reprints to: Dr. Alexandra L. Brown, Growth and Development Section, Molecular, Cellular, and Nutritional Endocrinology Branch, National Institutes of Health, Building 10, Room 8D14, Bethesda, Maryland 20892. Presented in part at the 72nd Annual Meeting of The Endocrine Society, Atlanta, GA, 1990 (Abstract 282).

REFERENCES 1. Nissley SP, Rechler MM 1984 Insulin-like growth factors: biosynthesis, receptors, and carrier proteins. In: Li CH (ed) Hormonal Proteins and Peptides. Academic Press, New York and London, vol 12:127-203 2. Knauer DJ, Smith GL 1980 Inhibition of biological activity of multiplication-stimulating activity by binding to its carrier protein. Proc Natl Acad Sci USA 77:7252-7256 3. Elgin GR, Busby WH Jr, Clemmons DR 1987 An insulinlike growth factor (IGF) binding protein enhances the biologic response to IGF-I. Proc Natl Acad Sci USA 84:3254-3258 4. Rechler MM, Nissley SP 1990 Insulin-like growth factors. In: Sporn MB, Roberts AB (eds) Handbook of Experimen-

Rat IGFBP-2 Gene

5.

6.

7.

8.

9.

10.

11.

12.

13.

14.

15.

16.

17.

18.

19.

20.

tal Pharmacology. Peptide Growth Factors and Their Receptors I. Springer-Verlag, Heidelberg, vol 95/1:263-367 Bar RS, Boes M, Clemmons DR, Busby WH, Sandra A, Dake BL, Booth BA1990 Insulin differentially alters transcapillary movement of intravascular IGFBP-1, IGFBP-2 and endothelial cell IGF-binding proteins in the rat heart. Endocrinology 127:497-499 Brewer MT, Stetler GL, Squires CH, Thompson RC, Busby WH, Clemmons DR 1988 Cloning, characterization, and expression of a human insulin-like growth factor binding protein. Biochem Biophys Res Commun 152:1289-1297 Brinkman A, Groffen C, Kortleve DJ, van Kessel AG, Drop SLS 1988 Isolation and characterization of a cDNA encoding the low molecular weight insulin-like growth factor binding protein (IBP-1). EMBO J 7:2417-2423 Julkunen M, Koistinen R, Aalto-Setala K, Seppala M, Janne OA, Kontula K 1988 Primary structure of human insulin-like growth factor-binding protein/placental protein 12 and tissue-specific expression of its mRNA. FEBS Lett 236:295-302 Murphy LJ, Seneviratne C, Ballejo G, Croze F, Kennedy TG 1990 Identification and characterization of a rat decidual insulin-like growth factor-binding protein complementary DNA. Mol Endocrinol 4:329-336 Brown AL, Chiariotti L, Orlowski CC, Mehlman T, Burgess WH, Ackerman EJ, Bruni CB, Rechler MM 1989 Nucleotide sequence and expression of a cDNA clone encoding a fetal rat binding protein for insulin-like growth factors. J Biol Chem 264:5148-5154 Margot JB, Binkert C, Mary J-L, Landwehr J, Heinrich G, Schwander J 1989 A low molecular weight insulin-like growth factor binding protein from rat: cDNA cloning and tissue distribution of its messenger RNA. Mol Endocrinol 3:1053-1060 Binkert C, Landwehr J, Mary J-L, Schwander J, Heinrich G 1989 Cloning, sequence analysis and expression of a cDNA encoding a novel insulin-like growth factor binding protein (IGFBP-2). EMBO J 8:2497-2502 Wood Wl, Cachianes G, Henzel WJ, Winslow GA, Spencer SA, Hellmiss R, Martin JL, Baxter RC 1988 Cloning and expression of the growth hormone-dependent insulin-like growth factor-binding protein. Mol Endocrinol 2:11761185 Shimasaki S, Koba A, Mercado M, Shimonaka M, Ling N 1989 Complementary DNA structure of the high molecular weight rat insulin-like growth factor binding protein (IGFBP3) and tissue distribution of its mRNA. Biochem Biophys Res Commun 165:907-912 Albiston AL, Herington AC 1990 Cloning and characterization of the growth hormone-dependent insulin-like growth factor binding protein (IGFBP-3) in the rat. Biochem Biophys Res Commun 166:892-897 Mohan S, Bautista CM, Wergedal J, Baylink DJ 1989 Isolation of an inhibitory insulin-like growth factor (IGF) binding protein from bone cell-conditioned medium: A potential local regulator of IGF action. Proc Natl Acad Sci USA 86:8338-8342 Shimonaka M, Schroeder R, Shimasaki S, Ling N 1989 Identification of a novel binding protein for insulin-like growth factors in adult rat serum. Biochem Biophys Res Commun 165:189-195 Roghani M, Hossenlopp P, Lepage P, Balland A, Binoux M 1989 Isolation from human cerebrospinal fluid of a new insulin-like growth factor-binding protein with a selective affinity for IGF-II. FEBS Lett 255:253-258 Martin JL, Willetts KE, Baxter RC 1990 Purification and properties of a novel insulin-like growth factor-ll binding protein from transformed human fibroblasts. J Biol Chem 265:4124-4130 Baxter RC 1988 Characterization of the acid-labile subunit of the growth hormone-dependent insulin-like growth factor binding protein complex. J Clin Endocrinol Metab 67:265-272

Downloaded from https://academic.oup.com/mend/article-abstract/4/12/2039/2526332 by guest on 05 August 2018

2049

21. Baxter RC, Martin JL 1989 Structure of the Mr 140,000 growth hormone-dependent insulin-like growth factor binding protein complex: determination by reconstitution and affinity-labeling. Proc Natl Acad Sci USA 86:68986902 22. Rutanen EM, Koistinen R, Sjoberg J, Julkunen M, Wahlstrom T, Bohn H, Seppala M 1986 Synthesis of placental protein 12 by human endometrium. Endocrinology 118:1067-1071 23. Povoa G, Roovete A, Hall K1984 Cross-reaction of serum somatomedin-binding protein in a radioimmunoassay developed for somatomedin-binding protein isolated from human amniotic fluid. Acta Endocrinol (Copenh) 107:563570 24. Romanus JA, Tseng LY-H, Yang YW-H, Rechler MM 1989 The 34 kilodalton insulin-like growth factor binding proteins in human cerebrospinal fluid and the A673 rhabdomyosarcoma cell line are human homologues of the rat BRL-3A binding protein. Biochem Biophys Res Commun 163:875-881 25. Roghani M, Lassarre C, Segova B, Binoux M, Presence in human cerebrospinal fluid (CSF) of two IGF binding proteins (BP) with a preferential affinity for IGF-II. 72nd Annual Meeting of The Endocrine Society, Atlanta GA, 1990, p 70 (Abstract) 26. Baxter RC, Martin JL 1986 Radioimmunoassay of growth hormone-dependent insulin-like growth factor binding protein in human plasma. J Clin Invest 78:1504-1512 27. Drop SLS, Kortleve DJ, Guyda HJ, Posner Bl 1984 Immunoassay of a somatomedin-binding protein from human amniotic fluid: levels in fetal, neonatal, and adult sera. J Clin Endocrinol Metab 59:908-915 28. Cotterill AM, Cowell CT, Baxter RC, McNeil D, Silinik M 1988 Regulation of the growth hormone-independent growth factor-binding protein in children. J Clin Endocrinol Metab 67:882-887 29. Busby WH, Snyder DK, Clemmons DR 1988 Radioimmunoassay of a 26,000-dalton plasma insulin-like growth factor-binding protein: control by nutritional variables. J Clin Endocrinol Metab 67:1225-1230 30. Suikkari AM, Koivisto VA, Rutanen EM, Yki-Jarvinen H, Karonen SL, Seppala M 1988 Insulin regulates the serum levels of low molecular weight insulin-like growth factorbinding protein. J Clin Endocrinol Metab 66:266-272 31. Brismar K, Gutniak M, Povoa G, Werner S, Hall K 1988 Insulin regulates the 35 kDa IGF binding protein in patients with diabetes mellitus. J Endocrinol Invest 11:599-602 32. Ritvos O, Ranta T, Jalkanen J, Suikkari A-M, Voutilainen R, Bohn H, Rutanen EM 1988 Insulin-like growth factor (IGF) binding protein from human decidua inhibits the binding and biological action of IGF-I in cultured choriocarcinoma cells. Endocrinology 122:2150-2157 33. Busby Jr WH, Klapper DG, Clemmons DR 1988 Purification of a 31,000-dalton insulin-like growth factor binding protein from human amniotic fluid. Isolation of two forms with different biologic actions. J Biol Chem 263:1420314210 34. Frauman AG, Tsuzaki S, Moses AC 1989 The binding characteristics and biological effects in FRTL5 cells of placental protein-12, an insulin-like growth factor-binding protein purified from human amniotic fluid. Endocrinology 124:2289-2296 35. Han VK, Lauder JM, D'Ercole AJ 1988 Rat astroglial somatomedin/insulin-like growth factor binding proteins: characterization and evidence of biologic function. J Neurosci 8:3135-3143 36. De Mellow JSM, Baxter RC 1988 Growth hormone-dependent insulin-like growth factor (IGF) binding protein both inhibits and potentiates IGF-l-stimulated DNA synthesis in human skin fibroblasts. Biochem Biophys Res Commun 156:199-204 37. Blat C, Delbe J, Villaudy J, Chatelain G, Golde A, Harel L 1989 Inhibitory diffusible factor 45 bifunctional activity as a cell growth inhibitor and as an insulin-like growth factor

MOL ENDO1990 2050

l-binding protein. J Biol Chem 264:12449-12454 38. Shimasaki S, Shimonaka M, Ui M, Inouye S, Shibata F, Ling N 1990 Structural characterization of a follicle-stimulating hormone action inhibitor in porcine ovarian follicular fluid. Its identification as the insulin-like growth factorbinding protein. J Biol Chem 265:2198-2202 39. Blum WF, Jenne EW, Reppin F, Kietzmann K, Ranke MB, Bierich JR 1989 Insulin-like growth factor I (IGF-l)-binding protein complex is a better mitogen than free IGF-I. Endocrinology 125:766-772 40. Conover CA, Biological actions of insulin-like growth factor binding protein-3 in cultured bovine fibroblasts. 72nd Annual Meeting of The Endocrine Society, Atlanta GA, 1990, p 71 (Abstract) 41. Ooi GT, Orlowski CC, Brown AL, Becker RE, Unterman TG, Rechler MM 1990 Different tissue distribution and hormonal regulation of mRNAs encoding rat insulin-like growth factor binding proteins rlGFBP-1 and rlGFBP-2. Mol Endocrinol 4:321-328 42. Orlowski CC, Ooi GT, Rechler MM 1990 Dexamethasone stimulates transcription of the insulin-like growth factor binding protein-1 (IGFBP-1) gene in H4-II-E rat hepatoma cells. Mol Endocrinol 4:1592-1599 43. Orlowski CC, Brown AL, Ooi GT, Yang YW-H, Tseng LYH, Rechler MM 1990 Tissue, developmental and metabolic regulation of mRNA encoding a rat insulin-like growth factor binding protein (rlGFBP-2). Endocrinology 126:644-652 44. Boni-Schnetzler M, Binz K, Mary J-L, Schmid C, Schwander J, Froesch ER 1989 Regulation of hepatic expression of IGF I and fetal IGF binding protein mRNA in streptozotocin-diabetic rats. FEBS Lett 251:253-256 45. Wood TL, Brown AL, Rechler MM, Pintar JE 1990 The expression pattern of an insulin-like growth factor binding protein gene is distinct from IGF-II in the midgestational rat embryo. Mol Endocrinol 4:1257-1263 46. Tseng LY-H, Brown AL, Yang YW-H, Romanus JA, Orlowski CC, Taylor T, Rechler MM 1989 The fetal rat binding protein for insulin-like growth factors is expressed in the choroid plexus and cerebrospinal fluid of adult rats. Mol Endocrinol 3:1559-1568 47. Birnstiel ML, Busslinger M, Strub K 1985 Transcription termination and 3' processing: the end is in site. Cell 41:349-359 48. Padgett RA, Grabowski PJ, Konarska MM, Seiler S, Sharp PA 1986 Splicing of messenger RNA precursors. Annu Rev Biochem 55:1119-1150 49. Cubbage ML, Suwanichkul A, Powell DR 1989 Structure of the human chromosomal gene for the 25 kilodalton insulin-like growth factor binding protein. Mol Endocrinol 3:846-851 50. Brinkman A, Groffen CAH, Kortleve DJ, Drop SLS 1988 Organization of the gene encoding the insulin-like growth factor binding protein IBP-1. Biochem Biophys Res Commun 157:898-907 51. Cubbage ML, Suwanichkul A, Powell DR 1990 Insulin-like growth factor binding protein-3. Organization of the human chromosomal gene and demonstration of promoter activity. J Biol Chem 265:12642-12649 52. Frohman MA, Dush MK, Martin GR 1988 Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proc Natl Acad Sci USA 85:8998-9002 53. Mitchell PJ, Tjian R 1989 Transcriptional regulation in mammalian cells by sequence-specific DNA binding proteins. Science 245:371-378 54. Kadonaga JT, Jones KA, Tjian R 1986 Promoter-specific activation of RNA polymerase II transcription by Sp 1. Trends Biochem 11:20-23 55. Roesler WJ, Vandenbark GR, Hanson RW 1988 Cyclic AMP and the induction of eukaryotic gene transcription. J Biol Chem 263:9063-9066 56. Curran T, Franza BR 1988 Fos and Jun: the Ap-1 connection. Cell 55:395-397

Downloaded from https://academic.oup.com/mend/article-abstract/4/12/2039/2526332 by guest on 05 August 2018

Vol4No. 12

57. Nelson C, Shen L-P, Meister A, Fodor E, Rutter WJ 1990 Pan: a transcriptional regulator that binds chymotrypson, insulin, and AP-4 enhancer motifs. Genes Dev 4:10351043 58. Frain M, Swart G, Monaci P, Nicosia A, Stampfli S, Frank R, Cortese R 1989 The liver-specific transcription factor LF-B1 contains a highly diverged homeobox DNA binding domain. Cell 59:145-157 59. Morgan WD, Williams GT, Morimoto Rl, Greene J, Kingston RE, Tjian R 1987 Two transcriptional activators, CCAAT-box-binding transcription factor and heat shock transcription factor, interact with a human hsp70 gene promoter. Mol Cell Biol 7:1129-1138 60. Wasylyk B 1988 Transcription elements and factors of RNA polymerase B promoters of higher eukaryotes. CRC Crit Rev Biochem 23:77-120 61. Reynolds GA, Basu SK, Osborne TF, Chin DJ, Gil G, Brown MS, Goldstein JL, Luskey KL 1984 HMG CoA reductase: a negatively regulated gene with unusual promoter and 5' untranslated regions. Cell 38:275-285 62. McKeon C, Moncada V, Pham T, Salvatore P, Kadowaki T, Accili D, Taylor S11990 Structural and functional analysis of the insulin receptor promoter. Mol Endocrinol 647656 63. Saltzman AG, Weinmann R 1989 Promoter specificity and modulation of RNA polymerase II transcription. FASEB J 3:1723-1733 64. Ishii S, Xu Y-H, Stratton RH, Roe BA, Mcrlino GT, Pastan I 1985 Characterization and sequence of the promoter region of the human epidermal growth factor receptor gene. Proc Natl Acad Sci USA 82:4920-4924 65. Sehgal A, Patil N, Chao M 1988 A constitutive promoter directs expression of the nerve growth factor receptor gene. Mol Cell Biol 8:3160-3167 66. Araki E, Shimada F, Uzawa H, Mori M, Ebina Y 1987 Characterization of the promoter region of the human insulin receptor gene. J Biol Chem 262:16186-16191 67. Kageyama R, Merlino GT, Pastan I 1989 Nuclear factor ETF specifically stimulates transcription from promoters without a TATA box. J Biol Chem 264:15508-15514 68. Dawson PA, Hofmann SL, van der Westhuyzen DR, Sudhof TC, Brown MS, Goldstein JL 1988 Sterol-dependent repression of low density lipoprotein receptor promoter mediated by 16-base pair sequence adjacent to binding site for transcription factor Sp1. J Biol Chem 263:33723379 69. Boni-Schnetzler M, Schmid C, Mary J-L, Zimmerli B, Meier PJ, Zapf J, Schwander J, Froesch ER 1990 Insulin regulates the expression of the insulin-like growth factor binding protein 2 mRNA in rat hepatocytes. Mol Endocrinol 4:1320-1326 70. O'Brien RM, Granner DK 1990 PEPCK gene as model of inhibitory effects of insulin on gene transcription. Diabetes Care 13:327-339 71. Meisler MH, Howard G 1989 Effects of insulin on gene transcription. In: Hoffman JF (ed) Annual Review of Physiology. Annual Review, Palo Alto, pp 701-714 72. Messina JL 1990 Insulin's regulation of c-fos gene transcription in hepatoma cells. J Biol Chem 265:1170011705 73. Alexander MC, Lomanto M, Nasrin N, Ramaika C 1988 Insulin stimulates glyceraldehyde-3-phosphate dehydrogenase gene expression through c/s-acting DNA sequences. Proc Natl Acad Sci USA 85:5092-5096 74. O'Brien RM, Lucas PC, Forest CD, Magnuson MA, Granner DK 1990 Identification of a sequence in the PEPCK gene that mediates a negative effect of insulin on transcription. Science 249:533-537 75. Sargent TD, Wu J-R, Sala-Trepat JM, Wallace RB, Reyes AA, Bonner J 1979 The rat serum albumin gene: analysis of cloned sequences. Proc Natl Acad Sci USA 76:32563260 76. Lowe Jr WL, Roberts Jr CT, Lasky SR, LeRoith D 1987 Differential expression of alternative 5' untranslated re-

2051

Rat IGFBP-2 Gene

77.

78.

79.

80.

81.

82.

83.

84.

gions in mRNAs encoding rat insulin-like growth factor I. Proc Natl Acad Sci USA 84:8946-8950 Chiariotti L, Brown AL, Frunzio R, Clemmons DR, Rechler MM, Bruni CB1988 Structure of the rat insulin-like growth factor II transcriptional unit: heterogeneous transcripts are generated from two promoters by use of multiple polyadenylation sites and differential ribonucleic acid splicing. Mol Endocrinol 2:1115-1126 Maniatis T, Fritsch EF, Sambrook J 1982 Molecular Cloning-A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor Brown AL, Graham DE, Nissley SP, Hill DJ, Strain AJ, Rechler MM 1986 Developmental regulation of insulin-like growth factor II mRNA in different rat tissues. J Biol Chem 261:13144-13150 Rechler MM, Bruni CB, Whitfield HJ, Yang YW-H, Frunzio R, Graham DE, Coligan JE, Terrell JE, Acquaviva AM, Nissley SP 1985 Characterization of the biosynthetic precursor for rat insulin-like growth factor-ll by biosynthetic labeling, radiosequencing, and nucleotide sequence analysis of a cDNA clone. Cancer Cells 3:131-138 Frunzio R, Chiariotti L, Brown AL, Graham DE, Rechler MM, Bruni CB 1986 Structure and expression of the rat insulin-like growth factor II (rIGF-ll) gene. rIGF-ll RNAs are transcribed from two promoters. J Biol Chem 261:1713817149 Sanger F, Nicklen S, Coulson AR 1977 DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 74:5463-5467 Devereux J, Haeberli P, Smithies O 1984 A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res 12:387-395 Calzone FJ, Britten RJ, Davidson EH 1987 Mapping of gene transcripts by nuclease protection assays and cDNA

Downloaded from https://academic.oup.com/mend/article-abstract/4/12/2039/2526332 by guest on 05 August 2018

85. 86.

87.

88.

89.

90. 91. 92.

primer extension. In: Berger SL, Kimmel AR (eds) Guide to Molecular Cloning Techniques. Academic Press, Orlando, San Diego, New York, and Austin, pp 611-632 deWet JR, Wood KV, DeLuca M, Helinski DR, Subramani S 1987 Firefly luciferase gene: structure and expression in mammalian cells. Mol Cell Biol 7:727-737 Wood WM, Kao MY, Gordon DF, Ridgway EC 1989 Thyroid Hormone regulates the mouse thyrotropin /3-subunit gene promoter in transfected primary thyrotropes. J Biol Chem 264:14840-14847 Maxwell IH, Harrison GS, Wood WM, Maxwell F 1989 A DNA cassette containing a trimerized SV40 polyadenylation signal which efficiently blocks spurious plasmid-initiated transcription. BioTechniques 7:276-280 Selden RF, Howie KB, Rowe ME, Goodman HM, Moore DD 1986 Human growth hormone as a reporter gene in regulation studies employing transient gene expression. Mol Cell Biol 6:3173-3179 Yang YW-H, Brown AL, Orlowski CC, Graham DE, Tseng LY-H, Romanus JA, Rechler MM 1990 Identification of rat cell lines that preferentially express insulin-like growth factor binding proteins rlGFBP-1, 2, or 3. Mol Endocrinol 4:29-38 Chu G, Hayakawa H, Berg P 1987 Electroporation for the efficient transfection of mammalian cells with DNA. Nucleic Acids Res 15:1311-1326 Brasier AR, Tate JE, Habener JF 1989 Optimized use of the firefly luciferase assay as a reporter gene in mammalian cell lines. BioTechniques 7:1116-1122 Nasrin N, Ercolani L, Denaro M, Kong XF, Kang I, Alexander M 1990 An insulin response element in the glyceraldehyde-3-phosphate dehydrogenase gene binds a nuclear protein induced by insulin in cultured cells and by nutritional manipulations in vivo. Proc Natl Acad Sci USA 87:5273-5277