GENOMICS 1 4 , 153-161 (1992)

Cloning of the Human Cholesterol 7a-Hydroxylase Gene and Localization to Chromosome 8ql 1-ql 2

(CYP7)

JONATHAN C. COHEN,* JAMES J. CALl,* DIANE F. JELINEK,* MARGARETE MEHRABIAN, Ji" ROBERTS. SPARKES,~ ALDONS J. LUSlS,§ DAVID W. RUSSELL,*AND HELEN H. HOBBS* *Department of Molecular Genetics, University of Texas Southwestern Medical Center, Dallas, Texas 75235; and Divisions of t Cardiology and SMedical Genetics; §Departments of Medicine and Microbiology, and the Molecular Biology Institute, University of California, Los Angeles, Cafifornia 90024 Received April 1, 1992; revised June 10, 1992

released into the duodenum in response to food ingestion. In the intestine, bile acids solubilize ingested fats and facilitate their absorption by the intestinal mucosa. Approximately 95% of the bile acids secreted into the gut are reabsorbed in the distal ileum and returned to the liver via the enterohepatic circulation. More than a dozen enzymes are involved in the biosynthesis of the two major primary bile acids found in mammals--chenodeoxycholic and cholic acid (reviewed in Russell and Setchell, 1992). The action of the first enzyme in the pathway, 7a-hydroxylase (EC 1.14.13.17), commits cholesterol to bile acid biosynthesis (Danielsson et al., 1967; Shefer et al., 1970). 7a-Hydroxylase is a liver-specific, cytochrome P450-dependent monooxygenase that resides within the smooth endoplasmic reticulum and catalyzes the hydroxylation of carbon seven of cholesterol. The enzyme activity has a diurnal cycle, peaking at midnight and reaching its lowest level around noon. In both rats and humans, enzyme activity has been shown to be subject to feedback inhibition by both chenodeoxycholic and cholic acid human feedback (Shefer et al., 1970; Einarsson et al., 1973). Interruption of the enterohepatic circulation is associated with an increase in 7a-hydroxylase activity and bile acid synthesis (Danielsson et al., 1967). Conversely, if exogenous cholic, chenodeoxycholic, or deoxycholic acid is added to the diet, 7a-hydroxylase activity falls (Shefer et al., 1970). Both the rat and human cDNAs for 7a-hydroxylase have been cloned and are predicted to encode proteins of 503 and 504 amino acids in length, respectively (Noshiro et al., 1989; Jelinek et al., 1990; Noshiro and Okuda, 1990). Feedback inhibition of 7a-hydroxylase has been demonstrated to occur at the level of gene transcription (Jelinek et al., 1990; Sundseth and Waxman, 1990; Li et al., 1990; Shefer et al., 1991; Pandak et al., 1991), but the trans-acting factors and cis-acting DNA sequences that mediate this effect have not been determined. A total of 592 bp of the 5' flanking region of the rat gene has been reported (Jelinek and Russell, 1990), but the important regulatory sequences have not been identified. A recent

C h o l e s t e r o l 7 a - h y d r o x y l a s e ( 7 a - h y d r o x y l a s e ) is a m i c r o s o m a l c y t o c h r o m e P 4 5 0 t h a t c a t a l y z e s t h e first s t e p in bile acid synthesis. In this paper, we describe the cloning, characterization, and chromosomal mapping of the human 7a-hydroxylase gene (CYP7). The gene spans 10 kb and contains six exons and five introns. The exon-intron boundaries are completely conserved b e t w e e n t h e h u m a n a n d r a t g e n e s . S e q u e n c i n g o f t h e 5' f l a n k i n g r e g i o n r e v e a l e d c o n s e n s u s r e c o g n i t i o n sequences for a number of liver-specific transcription f a c t o r s . T h e h u m a n C Y P 7 g e n e w a s m a p p e d to c h r o m o some 8q11-q12 using both mouse-human somatic cell h y b r i d s a n d in situ c h r o m o s o m a l h y b r i d i z a t i o n s t u d i e s . A total of four single-stranded conformation-depend e n t D N A p o l y m o r p h i s m s a n d a n Alu s e q u e n c e - r e l a t e d polymorphism were identified. Of the individuals anal y z e d , 8 0 % w e r e h e t e r o z y g o u s f o r at l e a s t o n e o f t h e s e five polymorphisms. The localization and characterizat i o n o f t h e h u m a n 7 a - h y d r o x y l a s e g e n e , a s w e l l as t h e identification of polymorphisms, provide the molecular t o o l s n e c e s s a r y to i n v e s t i g a t e t h e r o l e o f t h i s g e n e i n disorders of cholesterol and bile acid metabolism. © 1 9 9 2 Academic Press, Inc.

INTRODUCTION The concentration of intracellular hepatic cholesterol reflects a balance between cholesterol acquisition and secretion. Hepatocytes can acquire cholesterol from the circulation by receptor-mediated endocytosis of cholesterol-rich lipoproteins (Hobbs et aL, 1990) or synthesize cholesterol de novo from acetyl-CoA (Goldstein and Brown, 1990). The major mechanism available for the removal of cholesterol from the body is via the biliary excretory pathway, either as free cholesterol or after conversion to bile acids (Turley and Dietschy, 1982). In man, approximately 50% of the daily cholesterol output is via the bile acid biosynthetic pathway (Myant and Mitropoulos, 1977). Newly synthesized bile acids are secreted into bile canaliculi, stored in the gall bladder, and 153

0888-7543/92 $5.00 Copyright © 1992 by Academic Press, Inc. All rights of reproduction in any form reserved.

154

COHEN ET AL.

p a p e r b y M o l o w a et al. (1992) r e p o r t e d t h e i s o l a t i o n a n d c h a r a c t e r i z a t i o n o f t h e 5' f l a n k i n g r e g i o n o f t h e h u m a n 7 ~ - h y d r o x y l a s e gene. E v i d e n c e s u p p o r t i v e of liver-specific t r a n s c r i p t i o n a n d t h e i n v o l v e m e n t o f h e p a t i c n u clear factor-3 ( H N F - 3 ) in the expression of the gene was presented. I n t h i s p a p e r we h a v e c l o n e d a n d c h a r a c t e r i z e d t h e h u m a n 7 a - h y d r o x y l a s e g e n e . U s i n g s o m a t i c cell h y b r i d s a n d in s i t u h y b r i d i z a t i o n t o m e t a p h a s e c h r o m o s o m e s , w e have mapped the gene to the centromeric region of chrom o s o m e 8. I n a d d i t i o n , five D N A s e q u e n c e p o l y m o r p h i s m s a r e d e s c r i b e d . T h e s e p o l y m o r p h i s m s p r o v i d e inf o r m a t i v e genetic m a r k e r s t h a t can be used to e x a m i n e the segregation of the 7 a - h y d r o x y l a s e gene in h u m a n d i s o r d e r s o f b i l e acid, c h o l e s t e r o l , a n d l i p o p r o t e i n m e t a b olism.

MATERIALS AND METHODS

Isolation of human 7a-hydroxylase clones A genomie library constructed from human placental DNA (No. 946203, Stratagene) was screened with 32p-labeled probes derived from the coding region of the human 7a-hydroxylase cDNA using standard methods (Sambrook et al., 1989). A total of 4 X 10s bacteriophage were screened, and four positive plaques were identified. Phage DNA from hybridization-positive plaques was purified from plate lysates (Sambrook et al., 1989), and the insert sizes were determined by restriction endonuclease digestion. A clone with a 17-kb insert, which contained the entire coding region of the 7a-hydroxylase gene, was identified. The 17-kb fragment was excised from the ~ vector by digestion with SalI and subcloned into the polylinker site of pUC 18. The resultant clone was designated pUC-HG7a. Characterization of 7c~-hydroxylase gene Oligonucleotides with sequence identity to the 7a-hydroxylase cDNA (Table 1) were end-labeled with [~-32p]ATP (6000 Ci/mmol, Amersham) and used as primers to sequence the exon-intron junctions from pUC-HG7a. The sequencing reactions were performed as described by Lee (1991) with the following modifications: the termination mixes contained C mix (20 uM dCTP, dTTP, dATP, dGTP and 400 gM ddCTP), T mix (20 ttM dCTP, dTTP, dATP, dGTP and 800 ttM ddTTP), A mix (20 ttM dCTP, dTTP, dATP, dGTP and 600 gM ddATP), and G mix (20 gM dCTP, dTTP, dATP, dGTP and 200 gM ddGTP). The sequencing reactions were performed in a 10-ttl volume containing 1 pmol sequencing primer, 0.1 #g purified plasmid DNA, 1 #l 10X PCR buffer (10X PCR buffer - 500 mM KC1, 100 mM Tris, 15 mM MgCl2), 5 ill termination mix, and 0.25 unit Thermus aquaticus DNA polymerase (Perkin-Elmer Cetus). The reactions were overlaid with mineral oil and subjected to 30 cycles of amplification in a thermal cycler (Perkin-Elmer Cetus). The temperatures for the first 20 cycles were 95°C for I mid, 55°C for i mid, and 700C for I mid, and for the last 10 cycles identical temperatures and times were used except the 1 mid annealing time at 550C was omitted. The four reactions were terminated by addition of 10 tzl formamide dye (98% formamide, 0.1% (w/v) bromophenol blue, 0.1% (w/v) xylene cyanol), denatured by heating to 95°C for 3 mid, and 3 #1 was loaded onto an 8% denaturing polyacrylamide gel in 1x TBE (1X TBE = 0.05 MTris, 0.05 Mborate, 10 mMEDTA). The sequencing gel was run for 2 h at 75 W, dried, and then exposed to XAR-5 film for 3 h at -70°C. The entire 3' untranslated region of the cholesterol 7a-hydroxylase was shown to be contained in exon 6. Oppositely oriented oligonucleotides corresponding to sequences in intron 5 (JC19) and the 3' flanking region (JCUT) were used to amplify by PCR the intervening sequences from both plasmid and human genomic DNA. The size of the resulting fragment (1600 bp) was exactly as expected based on the cDNA sequence indicating that the 3' untranslated region contained no introns.

Somatic cell hybrid analysis A panel of 14 mouse-human somatic cell hybrid clones was constructed and analyzed for chromosome content as described previously (Mohandas et al., 1986). DNA was isolated from these clones as well as from the parental mouse cell line GM0349A and from human lymphocytes using sodium dodecyl sulfate (SDS) and proteinase K followed by phenol-chloroform extraction. About 5 #g of HindIII-digested DNA was electrophoresed through a 1.0% agarose gel and transferred by blotting to a nylon filter. The filters were then probed with a rat 7a-hydroxylase cDNA insert (nucleotides 1-2172, clone pSAC7) (Jelinek et al., 1990). Following gel purification, the cDNA insert was labeled with 32p to a specific activity of about 109 cpm/ttg by random priming. The filters were hybridized for 24 h with 2 X 108 cpm/ml in 0.5 M sodium phosphate, pH 7.0, 7% SDS, 1% bovine serum albumin, 1 mM EDTA, and 250 pg/ml denatured salmon sperm DNA at 65°C for 24 h. Filters were washed twice for 20 mid in 2X SSC (1X SSC = 150 mM NaC1, 14 mM sodium citrate, pH 8.0), 0.1% SDS and then twice for 20 min in 0.2X SSC, 0.1% SDS at 55°C. The filters were then exposed to Kodak XAR-5 film at -80°C. In situ hybridization to chromosomes The 7a-hydroxylase human and rat cDNA inserts were labeled with 3H-labeled deoxynucleotides by oligonucleotide priming to a specific activity of about 4 X 10s cpm/ ttg. The probes were then hybridized to chromosomes from normal human lymphocytes using a method developed by Harper and Saunders (1981) as modified by Cannizzaro and Emanuel (1984). The slides were exposed for approximately 10 days, and all silver grains on or touching chromosomes were scored. Single-stranded conformational analysis for identification o[ DNA polymorphisms at the 7a-hydroxylase locus. The five introns and 700 bp of the 5' flanking region of the 7a-hydroxylase gene were screened for single-stranded conformational polymorphisms (SSCPs) using a modification of the methods of Orita et al. (1989). The introns were too large (600 to 1850 bp) to be analyzed directly by SSCP. Therefore, for each intron, a restriction enzyme that generated fragments betweed 200 and 400 bp was identified. To perform the SSCP analysis, each intron and the 5' flanking region was amplified by PCR in a thermal cycler in a total volume of 20 #1 containing 2 ~1 10x PCR buffer, 1 nmol of dNTP, 35 pmol of each 25-bp flanking primer (Table 1), 0.1 gg genomic DNA, 3.3 pmol [32p]dCTP (3000 mCi/mmol), and Thermus aquaticus DNA polymerase. The 5' flanking region was amplified using 30 cycles of 96°C X I mid for denaturation, 55°C x I mid for annealing, and 72°C X I mid for extension. To amplify the introns, the annealing and extension were performed in a single step (68°C for 3 mid). After amplification, 10 gl of the reaction was digested in a total volume of 50 ttl at 37°C for 2 h with 5 U of the appropriate restriction enzyme in the buffer supplied by the manufacturer (New England Biolabs, Beverly, MA). Of the digestion reaction, 5 ttl was diluted in 20 ~1 formamide dye and denatured at 95°C for 3 mid. Of the denatured sample, 3 #l was loaded on a 6% nondenaturing polyacrylamide gel in 2X TBE with 10% glycerol and subjected to electrophoresis at 300 V for 14 h.

RESULTS

S t r u c t u r e of the H u m a n 7 a - H y d r o x y l a s e Gene A 1 7 - k b SalI f r a g m e n t c o n t a i n i n g t h e e n t i r e c o d i n g region of the 7 a - h y d r o x y l a s e gene was subcloned into pUC18 (pUC-HG7a). The exon-intron junctions were s e q u e n c e d u s i n g 2 5 - b a s e o l i g o n u c l e o t i d e s i d e n t i c a l t o seq u e n c e s in t h e h u m a n c h o l e s t e r o l 7 a - h y d r o x y l a s e c D N A ( T a b l e 1) ( N o s h i r o a n d O k u d a , 1990). T h e s e q u e n c e s o f the amplified f r a g m e n t s were c o m p a r e d to the h u m a n cholesterol 7a-hydroxylase cDNA sequence, and the e x o n - i n t r o n j u n c t i o n s e q u e n c e s a r e g i v e n in T a b l e 2. T h e sizes o f t h e e x o n s w i t h i n t h e c o d i n g r e g i o n o f t h e gene are identical b e t w e e n h u m a n and rat (Jelinek a n d

HUMAN CHOLESTEROL 7a-HYDROXYLASE GENE TABLE 1 Oligonucleotides U s e d to C h a r a c t e r i z e 7 a - H y d r o x y l a s e Gene

Location Intron 1

Sequence (5' --~ 3')

OligoNo.

JC1 JC2 Intron 2 JC5 JC6 Intron 3 JC28 JC25 Intron 4 JC50 JC14 Intron 5 JC17 JC18 3' UT a REGION JC19 JCUT 5' FLANKING 7c~1 DJ95 3' ASRP ~ JC51 JC52

ATAGCAGCATGCTGTTGTCTATGG ATTTGCTCTGAGGAACTCAAGAGG TTGTCATACCATAAGGTGTTGTGC ACGTTGGAGGTTTTCCATCATGCT ACCATTCCAGCGACTTTCTGGAGT AGTAGCTGCTTTCATTGCTTCTGG AGTCAAGCAGAACTGAATGACCTGC ACTGGAAAGCCTCAGCGATTCCTT TCCCTCAACATCCGGACAGCTAAG TTGGCCCTCTATAAGCTCCAATTC TTGACTTTTAAATATGATAGGTAT ACTTTTATTTCTGAAAGATGAATCA AACATTGATAAACATTTTAGTCACA CCAAAATCTCTGAGGAAGAA AGCCTTGGCGAGAGGGTGAGACTCT AGGTATGAGTTATCAGCTCTATGTC

a Untranslated region. bAlu sequence-related polymorphism (Zuliani and Hobbs, 1990). Russell, 1990), except for exon 6 which c o n t a i n s 294 bp encoding 98 a m i n o acids in t h e rat, b u t c o n t a i n s 297 bp encoding 99 a m i n o acids in the h u m a n . In addition, the relative sizes of the h o m o l o g o u s i n t r o n s are very similar (Fig. 1). T h e coding regions of the h u m a n a n d r a t 7 a - h y d r o x y lase genes share 82% sequence identity (Noshiro a n d Okuda, 1990). A single-basepair difference was identified in the sequence of exon 4 w h e n our sequence was c o m p a r e d to the previously p u b l i s h e d h u m a n c D N A sequence (Noshiro a n d Okuda, 1990). An adenine was substituted for a guanine in t h e final nucleotide of exon 4. W h e n four alleles f r o m u n r e l a t e d C a u c a s i a n s were sequenced at this region, t h e y all c o n t a i n e d a n a d e n i n e at this position. S S C P was p e r f o r m e d using genomic D N A

155

f r o m 16 u n r e l a t e d individuals, as well as D N A f r o m the p l a s m i d p U C - H G 7 a , to e x a m i n e a 150-bp f r a g m e n t enc o m p a s s i n g the b a s e p a i r in question. T h e b a n d i n g p a t t e r n s were identical a n d indistinguishable f r o m p U C H G 7 a (data n o t shown). T h i s result is c o n s i s t e n t with the o b s e r v e d sequence difference b e i n g due to a sequencing e r r o r or to a n ethnic genetic p o l y m o r p h i s m . T h e res u l t a n t codon (amino acid 347), which is i n t e r r u p t e d b y i n t r o n 4, encodes an aspartic acid r a t h e r t h a n a n a s p a r a gine (the s u b s t i t u t e d residue is d e n o t e d b y f o o t n o t e a in T a b l e 2).

5' F l a n k i n g Region of H u m a n 7a-Hydroxylase Gene A t o t a l of 791 b p of the 5' flanking region was sequenced. W h e n this sequence was c o m p a r e d to the c o r r e s p o n d i n g sequence of the r a t 7 a - h y d r o x y l a s e gene, t h e r e was an overall sequence identity of 53% (Fig. 2). T h e degree of sequence i d e n t i t y was not u n i f o r m over the entire region. In the region b e t w e e n - 1 a n d - 3 0 0 bp, sequence i d e n t i t y was 67%. T h i s region c o n t a i n s a consensus T A T A A sequence t h a t is c o n s e r v e d b e t w e e n hum a n a n d r a t genes. T h e sequence does n o t a p p e a r to c o n t a i n a c o n s e n s u s sterol r e s p o n s e e l e m e n t (see below), which h a s b e e n p r e v i o u s l y identified a n d c h a r a c t e r i z e d in several cholesterol-regulated genes (Goldstein a n d Brown, 1990). T h e 5' flanking sequence was screened for t r a n s c r i p tion factor r e s p o n s e e l e m e n t s using a c o m m e r c i a l l y available c o m p u t e r p r o g r a m (MacVector). In addition to the t h r e e H N F - 3 recognition sequences at positions - 3 6 9 , -341, and -308 reported and characterized by Molowa et al. (1992), half-sites for the liver-specific b i n d i n g factors LF-A1 ( T G G A C T T ) (Ramji et al., 1991) a n d L F - B 1 ( G T T A N T ) ( H a r d o n et al., 1988) were p r e s e n t at - 2 0 3 a n d - 1 1 4 , respectively. T h e b i n d i n g sequence for ano t h e r liver-specific factor H N F - 5 ( T G T T T G C ) was f o u n d at - 1 3 7 (Grange et al., 1990). T h e s e t h r e e consensus sequences are c o n s e r v e d b e t w e e n the r a t a n d h u m a n

TABLE 2 E x o n - I n t r o n O r g a n i z a t i o n of H u m a n 7 a - H y d r o x y l a s e Gene

Sequence at exon-intron junction Exon number

Exon size (bp)

I 2

241

3 4

587 131

5

176

6

1577

5' splice donor

3' splice acceptor

GAAGgtaagtaat... 1500 bp ...gtctgacagGCAA GAAGgtaagtagt . . . 900 bp . . . tgctatcagGCAT TTAGgtgactaac...1850 bp ...ttttaatagGAAC TTAGgtgggtata...1850 bp ...aatgtttagATAG TTTGgtaagtcgc . . . 600 bp . . . ttattgcagACTT GAATCTatgtgt(attt)Tgagaaagagtctcaccctct cgcaaggctggagtgcagtggtgcgatctcggctcactg taactgccacctcctgagtcaagtgattctcatgcctca gcctaccgag

Amino acid(s) interrupted Arg27 Lys~°7/Ala~°S

Arg3°3 Asp3~7a Leu4~/Thr4°6

Note. Underlined region designates Alu sequence in 3' flanking region. a Base 1078 was reported to an adenine in the published cDNA sequence (Noshiro and Okuda, 1990). A guanine in this position changes the codon from Ash to Asp.

156

COHEN ET AL. SBSp

B

5

'

EXON

B

B

X BSpXX

S

~

1

2

.' 3

4

5

13,

6 1 kb

FIG. 1. Structureof the human 7a-h~broxylasegene. Exons are represented by solid boxes and introns by lines. S, SpeI; B, BglII; X, XhoI. genes (Fig. 2). Hexanucleotide sequences ( T G T T C T and AGTCCT) corresponding to the glucocorticoid re= ceptor binding elements in the uteroglobin promoter (Cato et al., 1984) were ,found at - 3 4 2 and -760, in the human but not the rat 5' flanking sequence (Fig. 2). T he consensus sequence for a cytochrome P450 transcription factor (BTE) found in the 5' flanking region of the rat (Jelinek and Russell, 1990) is not conserved in the human gene sequence.

for 7~-hydroxylase, designated C Y P 7 (Nebert et al., 1990), resides on human chromosome 8. Regional mapping of the C Y P 7 gene was performed by in situ hybridization to hum an metaphase chromosomes using both human and rat cDNA probes for 7a-hydroxylase. With the human probe, the only major peak of grain accumulation occurred over the q l l - q l 2 region of chromosome 8, consistent with the somatic cell hybrid studies (Figs. 3A and 3B). With the rat cDNA probe, an identical region of grain accumulation was observed (Fig. 3C). T he reason for the high level of background hybridization is not clear (Fig. 3A), but it is possible th a t other members of the cytochrome P450 gene family cross-hybridize weakly with the 7a-hydroxylase cDNA. T h e fact that the only peak of grain accumulation occurs over the proximal portion of the long arm of chromosome 8 indicates t hat the gene for 7a-hydroxylase, C Y P 7 , is present on human chromosome 8 q l l - q 1 2 .

Localization of H u m a n 7 a - H y d r o x y l a s e Gene

Chromosome assignment was initially determined by filter hybridization of the 7a-hydroxylase rat cDNA probe (pSac7) to DNA from a panel of 14 m ou se-hum an somatic cell hybrid clones (Mohandes et al., 1986; Davis et al., 1991). The rat probe hybridized to a 7.6-kb fragment in H i n d I I I digests of human DNA and to a doublet of 3.3 and 3.9 kb of mouse DNA (data not shown). Of the 14 mo u s e- h u man hybrids, 12 were positive for the presence of the human DNA fragment. Perfect concordance was observed between the presence of the 7a-hydroxylase hybridizing fragment and human chromosome 8 (Table 3), whereas all other chromosomes showed two or more discordancies. This result indicates t hat the gene -925

a

A°

-805

TA

-583 -685

T

G

C°

°

°GAA

TC

TGG

T

-476 -565

T h e introns and 700 bp of 5' flanking region were analyzed for DNA polymorphisms using the SSCP technique developed by Orita (Orita et al., 1989). A total of four SSCPs were identified. Each polymorphism was biallelic and segregated in a Mendelian fashion in families (Fig. 4). T he heterozygosity indices and polymorphic information content (PIC) of the polymorphisms were determined in 25 unrelated Caucasians and are summarized in Table 4. Oligonucleotides JC1 and DJ95 (Table 1)were used to amplify 700 bp of the 5' flanking region. T h e amplification product was digested with H p a I , denatured, and ACA

G

°

GT

ACACCGAG

-806

GGAC

.

G

D N A P o l y m o r p h i s m s at the 7 ~ - H y d r o x y l a s e Locus

.

.

.

.

TG

GGA

A

GCGTCCC

GA

TC

GTAA

.

CC

TAA

.

.

.

.

.

.

GGCAGC

T

.

.

.

.

.

GAAGC

C

-686

.

.

.

.

.

A

-566

GGAGG

oo

-404 -445

_5.

T

.

TCCTGG

TAGT

TAGTC

- 446

oooo

.

GTCGTGC

TC

-328 -325

C

-386

208 °o

208 -207

-88

.

FIG. 2.

.

.

.

.

.

.

.

.

.

.

.

.

~

Sequence identitybetween the 5'flanking regions of h u m a n (H) and rat (R) 7a-hydroxylase genes. The overlined region designates

the TATAbox. Consensus recognitionsequencesfor LF-B1 (#) (Frain et al., 1989;Baumhueter et al., 1989), HNF-5 (xxx) (Grangeet al., 1990), LF-A1 (OOO) (Ramji et al., 1991), and the glucocorticoidreceptor (©©©), (AAA) (Cato, 1989) are indicated. A comparisonof this promoter sequenceto that publishedby Molowaet al. (1992)indicates identity betweenpositions -1 and -513, thereafter the two sequencesare only 90% identical. The sequencein this regionshown here was determinedfrom the genomicDNA of two unrelated individuals in separate sequencing experiments. We therefore attribute the differencesbetween this sequenceand that of Molawa et al. (1992) to errors.

HUMAN CHOLESTEROL 7a-HYDROXYLASE GENE

157

TABLE 3

Segregation of C Y P 7 Gene with Human Chromosome 8 in Mouse-Human Somatic Cell Hybrids 4

Human

chromosomes

b

Hybrid

CY"P7~

clone

1

2

3

4

5

6

7

8

84-2

+

+

+

-

+

+

+

+

+

84-4

+

+

+

+

+

-

+

+

+

84-7

+

-

-

+

+

-

+

+

+

84-20

+

-

(+)

+

+

+

-

+

+

84-21

-

-

-

+

-

+

-

-

84-25

+

-

84-26

+

+

84-27

+

-

+

84-30

-

-

84-34

+

84-35

+

+

-

+

12

+

-

-

+

+

-

+

-

+

+

+

-

-

(+)

(+)

+

+

+

+

-

+

+

+

+

+

+ +

(+) +

+

+

-

+

+

+

-

+

+

+

+

-

-

-

+

-

+

-

-

-

+

-

+

+

+

-

+

+

-

-

+

+

-

+

+

+ (+) +

84-39

+

-

+

+

21

21

0

+

% Discordancy

57

Note. C e l l s +, C Y P 7

sequences

57

containing of the

analyzed;

43

21

chromosomes in the human -,

hybrid

50

in 10-30% clone

chromosome

indicates

absence

+

85

greater

of the

human

by the than

-

+

+

+

-

+

-

+

+

+

36

were

ignored

presence

of the

30%

+

-

+

+

64

of metaphases

determined in

-

--

+

+

+

+

-

+

+

-

+

+

+

+

+

+

-

+

+

+

Y

+

-

+

X

--

-

(+)

22

+

+

+

21

+

+

+

20

+

+

+

19

+

-

-

18

-

+

-

17

+

+

-

16

+

+

-

15

-

+

+

14

-

+

+

13

+

+

+

metaphases

-

11

-

84-38

presence

10

+

84-37

b +,

9

36

64

36

in calculations human

of metaphases

DNA

analyzed;

+

+

+

(+)

-

+

+

-

-

(+)

-

+

-

-

-

+

+

+

+

+

+

+

+

-

+

+

-

+

+

-

+

+

-

-

-

+

+

-

+

+

+

-

-

+

-

(+)

+

-

+

-

-

+

+

.

. +

+

+

-

-

+

+

(+)

-

+

-

-

+

-

+

-

+

+

-

+

36

64

14

+

.

.

43

50

36

64

of the

gene.

50

79

in

10-30%

79

of % discordancy. fragment; (+)

-,

presence

absence of the

chromosome

of

chromosome.

size-fractionated on a nondenaturing gel. The 260-bp fragment generated a biallelic polymorphism (Fig. 4A) with a heterozygosity index of 46%. A second SSCP polymorphism (Fig. 4B) was revealed when intron 2 was amplified by PCR using oligos JC5 and JC6 (Table 1), digested with RsaI, and subjected to denaturation and gel electrophoresis. This SSCP polymorphism was slightly more frequent than the one found in the 5' flanking region and had a heterozygosity index of 50%. A third and fourth SSCP were identified in intron 4. Oligos JC50 and JC14 were used to amplify intron 4, and the amplification product was digested with MboI. Two restriction fragments 450 and 300 bp in length were found to be polymorphic. The polymorphism in the 450-bp fragment (Fig. 4C) had a heterozygosity index of only 8%. The polymorphism in the 300 bp (Fig. 4D) fragment was more frequent and had a heterozygosity index of 28%. In addition, a length polymorphism was identified in the 3' flanking region of the gene. Sequence analysis of this region revealed the presence of seven tandem copies of the tetranucleotide repeat (TTTA) within 5 bp of the 3' end of exon 6. When flanking oligonucleotides were used to amplify the repetitive sequence, the length of the resulting fragment was polymorphic (Fig. 4E). Two alleles that differed in size by one repeat unit were identified, and the heterozygosity index for this polymorphism was 15%. Further DNA sequencing in the region revealed that the tetranucleotide repeat was located at the 3' end of an A l u sequence. All five polymorphisms were used to examine the 7a-hydroxylase gene in 20 unrelated Caucasians, and 80% were heterozygous for at least one of the sequence differences.

DISCUSSION In this paper we describe the cloning and characterization of the human cholesterol 7a-hydroxylase gene. The gene is 12 kb in length and contains six exons and five introns. The organization of the 7a-hydroxylase gene is conserved between the rat and human. By using somatic cell hybrids and in situ hybridization studies of human chromosomes, the gene was mapped to the centromeric region of chromosome 8qll-q12. A total of four SSCP and one length polymorphism were identified, and out of 20 unrelated individuals examined, 16 were heterozygous for at least one of the polymorphisms. The DNA sequences and factors responsible for the regulation of 7a-hydroxylase gene transcription by bile acids and sterols have yet to be identified. Examination of the immediate 5' flanking region of the human and rat 7a-hydroxylase genes provides few clues as to the sequences necessary for regulation either by bile acids or sterols. The octanucleotide sterol responsive elements (SRE) found in the LDL receptor, 3-hydroxy-3-methylglutaryl coenzyme A (HMG CoA) reductase, and HMG CoA synthase genes (Goldstein and Brown, 1990) are not present in the examined 5' regions of the 7a-hydroxylase genes. Molowa et al. (1992) have identified a sequence of 8 bp at nucleotide position -328 that has six nucleotides identical to the consensus SRE, but a role for this motif in the regulation of 7a-hydroxylase gene transcription has not yet been demonstrated. In the rat, glucocorticoids cause a decrease in 7a-hydroxylase enzyme activity and mRNA levels (Li et al., 1990). Two hexanucleotide sequence elements that bind glucocorticoid receptors in the promoter of the uteroglobin gene (Cato et al., 1984) are present in the 5' flanking

158

COHEN ET AL.

A 1510-5-,,,

""1

O') Z

< rc (9

I..1_ O

P

15-

,i,,,,

i,

Ip'

q

,,,,,,,i

I'

q

2

,,,

P

,,,,,

L'

q

,

P

3

q

4

I

,

l'

,,

P

q

5

10-5--

I:I:

,,,,,,,,,,

uJ rn Z

II

P 15~

'

,,,,,11,,,,I

I'P

q

6

q

7

I'P

q

8

,,,

i'P

9

,,

,,

, ,I

,,,

I'

I'i'

q P q P q P q 10 11 12

I

105I,,,tl

,,

,,,I

,,

,,

,,I

,i,,

,,,

I,

,,

I I I '1 Ipq} Pl qlplq Iplq IP Iq IPq' }Pi q }plqlplqlpqlpql p q 13 14 15 16 17 18 19202122 X Y CHROMOSOMES B

C O0

O0

OOOOO0 OOOOOO0

O0 OOOO0 OOOOO0

1

O0

O0 O0

O000

OOO0

O00 •

ooo

8

8

FIG. 3. In situ hybridization of 7a-hydroxylase cDNA to human metaphase chromosomes. (A) Schematic representation of the distribution of grains on metaphase chromosomes observed in 252 cells after hybridization with human 7a-hydroxylase cDNA labeled by nick translation with SH-labeled deoxynucleotides to a specific activity of about 4 × 10s cpm/#g. Of 100 cells labeled with silver grains, 16 had grains localized to chromosome 8. Idiogram showing distribution of silver grains along chromosome 8: (B) by the use of the human probe, 42% (13/31) were localized to q l l - q 1 2 , and (C) by the use of the rat cDNA probe, of 438 cells scored for silver grain distribution, 78 cells were labeled and of these, 24 were labeled on chromosome 8 with silver grains localized to 8 p l l . l - q ] 2 in 15 cells; 46% (11/24) were localized to q l l - q 1 2 .

159

H U M A N C H O L E S T E R O L 7a-HYDROXYLASE GENE

A

450bp- ~

C

~ 450bp- ~

260bpD

F I G . 4.

i

E

Single-stranded conformation polymorphisms and an

Alu sequence-related polymorphism in the h u m a n 7a-hydroxylase

gene. For each polymorphism, genomic DNA from individual members of four nuclear families was used to amplify and universally label the intron of interest as described under Materials and Methods. The resultant fragment was digested with a restriction enzyme and subjected to electrophoresis in a 6% polyacrylamide nondenaturing gel. (A) SSCP polymorphism in the 5' flanking region digested with HpaI. (B) SSCP in intron 2 digested with RsaI. (C) SSCP in intron 4 digested with MboI. (D) SSCP in intron 4 digested with MboI. (E) Alu sequence-related polymorphism detected by denaturing-gel electrophoresis.

sequence of the human 7a-hydroxylase gene, but it remains to be determined whether these sequences mediate glucocorticoid regulation of either the uteroglobin or 7a-hydroxylase genes. Cholesterol 7a-hydroxylase is expressed exclusively in the liver (Jelinek et al., 1990). In all promoters studied to date, liver specificity is conferred by multiple cis-acting transcription elements, usually positioned between 100 and 300 bp upstream of the transcription start site. Partial consensus sequences for several liver-specific transcription factors are present in the 5' flanking regions of both the rat and human 7a-hydroxylase genes. The halfsite (GTTANT) for the liver-specific transcription activator LF-B1 (HNF-1) (Frain et al., 1989; Baumhueter et al., 1989), which was noted in the 5' flanking sequence of rat 7a-hydroxylase (Jelinek and Russell, 1991) is conserved in the human gene. The 5' flanking sequences of both the human (Fig. 2) and rat genes also contain the heptanucleotide sequence (TGGACTT) that comprises the 5' portion of the recognition sequence for LF-A1 (Ramji et al., 1990), a transcription factor required for liver-specific expression of the al-antitrypsin (De Simone et al., 1987) and pyruvate kinase (Vaulont et al., 1989) genes. In addition, the 5' flanking sequences of the human and rat 7a-hydroxylase genes contain the consensus Sequence for the putative liver-specific transcription activator HNF-5 (Grange et al., 1990). The consensus sequence recognized by HNF-5 is identical to an octamer (TGTTTGCT) in the hepatitis B virus E site, which is thought to play a role in liver-specific expression of the hepatitis B virus enhancer element (Shaul and Ben-Levy, 1987). In several genes, HNF-5 binding sites are located close to those of other liver-specific nu-

clear factors (Shaul and Ben-Levy, 1987), and this arrangement is also the case in the 7a-hydroxylase gene (Fig. 2). Direct evidence for the involvement of the liver-preferential transcription factor HNF-3 in the expression of the human 7a-hydroxylase gene has been provided by Molowa et al. (1992). These authors identified three consensus recognition sequences for HNF-3 in the 5' flanking region of the gene and showed that these sequences were protected in DNase I footprinting assays using nuclear extracts containing HNF-3. In addition, a DNA fragment containing the sites was capable of dramatically stimulating expression of a heterologous promoter in cells of hepatic origin (Molowa et al., 1992). These studies represent the first transcriptional analysis of the 7a-hydroxylase promoter and provide insight into the liver-specific expression of this gene. Together with the conservation of the HNF-1 sites, it would appear that multiple liver-preferential transcription factors play a role in expression and perhaps regulation of the human 7a-hydroxylase gene. We identified four polymorphisms at the human 7a-hydroxylase locus using the SSCP technique. In addition, a length polymorphism was found immediately 3' of exon 6 of the 7a-hydroxylase gene. The size variation responsible for this length polymorphism was due to an A l u sequence-related tetranucleotide repeat. The 3' ends of A l u sequences often contain length polymorphisms due to varying numbers of adenine residues in the poly(A) tail (Economou et al., 1990) or to variable numbers of trinucleotide and tetranucleotide tandem repeats (Zuliani and Hobbs, 1990). A total of 80% of individuals examined were heterozygous for at least one of the five polymorphisms in the 7a-hydroxylase gene. Therefore, these genetic markers can be successfully employed to follow the segregation of the 7a-hydroxylase gene in most families. At present, no genetic disorders t h a t map to the centromeric region of chromosome 8 (McKusick et al., 1990) can be causally linked to defects in 7a-hydroxylase. The identification of several DNA polymorphisms in the 7a-hydroxylase gene provides the molecular tools to test whether this locus plays a role in disorders of bile acid or lipoprotein metabolism. Cholesterol 7a-hydroxylase is a candidate gene for a number of common disorders such as familial hypertriglyceridemia (Angelin et al., 1978, TABLE 4 F r e q u e n c i e s o f F i v e P o l y m o r p h i s m s at 7~-Hydroxylase Locus among 50 Chromosomes

SSCP 1 SSCP 2 SSCP 3 SSCP 4 ASRP a

Location

Heterozygosity (%)

PIC value

5' Flanking Intron 2 Intron 4 Intron 4 3' Flanking

45 50 8 28 15

0.40 0.44 0.08 0.26 0.145

a Alu sequence-related polymorphism.

160

COHEN ET AL.

1987) and gallstone disease (Paumgartner and Sauerbruch, 1991). The central role of the enzyme in cholesterol homeostasis also renders the gene a candidate locus for determination of both primary hyper- and hypocholesterolemia (Vega et al., 1987). We are in the process of assessing genetic linkage of the 7a-hydroxylase gene in familial disorders of both bile acid and sterol metabolism.

ACKNOWLEDGMENTS We thank Kristine Cala, Anh Diep, Ivana Klisak, Ping-Zi Wen, and Yurong Xia for technical assistance. This research was supported by grants from the National Institutes of Health (HL-30568, HL-29252, and HL-20948), the Robert A. Welch Foundation (I-0971), the Perot Family Foundation, the Laubisch Fund, and the Cigarette and Tobacco Surtax Fund of the State of California through the Tobacco Related Disease Research Program at the University of California. Helen H. Hobbs is an Established Investigator of the American Heart Association.

REFERENCES Angelin, B., Einarsson, K., Hellstrhm, K., and Leijd, B. (1978). Bile acid kinetics in relation to endogenous triglyceride metabolism in various types of hyperlipoproteinemia. J. Lipid Res. 19: 1004-1016. Angelin, B., Hershon, K. S., and Brunzell, J. D. (1987). Bile acid metabolism in hereditary forms of hypertriglyceridemia: Evidence for an increased synthesis rate in monogenic familial hypertriglyceridemia. Proc. Natl. Acad. Sci. USA 84: 5434-5438. Baumhueter, S., Mendel, D. B., Conley, P. B., Kuo, C. J., Turk, C., Graves, M. K., Edwards, C. A., Courtois, G., and Crabtree, G. R. (1989). HNF-1 shares three sequence motifs with the POU domain proteins and is identical to LF-B1 and APF. Genes Dev. 4: 372-379. Cannizzaro, C. A., and Emanuel, B. S. (1984). An improved method for G-banding chromosomes after in situ hybridization. Cytogenet. Cell Genet. 38: 308-309. Cato, A. B. C., Geisse, S., Wenz, M., Westphal, H. M., and Beato, M. (1984). The nucleotide sequences recognized by the glucocorticoid receptor in the rabbit uteroglobin gene region are located far upstream from the initiation of transcription. E M B O J. 3: 2771-2778. Danielsson, H., Einarsson, K., and Johansson, G. (1967). Effect of biliary drainage on individual reactions in the conversion of cholesterol to taurocholic acid. Eur. J. Biochem. 2: 44-49. Davis, R. C., Xia, Y., Mohandes, T., Schotz, M. C., and Lusis, A. J. (1991). Assignment of the human pancreatic colipase gene to chromosome 6p21.1 to pter. Genomics 10: 262-265. De Simone, V., Ciliberto, G., Hardon, E., Paonessa, G., Palla, F., Lundberg, L., and Cortese, R. (1987). Cis- and trans-acting elements responsible for the cell-specific expression of the human a l antitrypsin gene. EMBO J. 6: 2759-2766. Economou, E. C., Bergen, A. W., Warren, A. C., and Antonarakis, S.E. (1990). The polydeoxyadenylate tract of Alu repetetive element~ is polymorphic in the human genome. Proc. Natl. Acad. Sci. USA 87: 2951-2954. Einarsson, K., Hellstr6m, K., and Kallner, M. (1973). Feedback regulation of bile acid formation in man. Metabolism 22: 1477-1483. Frain, M., Swart, G., Monaci, P., Nicosia, A., St~impfli, S., Frank, R., and Cortese, R. (1989). The liver-specific transcription factor LFB1 contains a highly diverged homeobox DNA binding domain. Cell 59: 145-157. Goldstein, J. L., and Brown, M. S. (1990). Regulation of the mevalonate pathway. Nature 343: 425-430. Grange, T., Roux, J., Rigaud, G., and Pictet, R. (1990). Cell-type spe-

cific activity of two glncocorticoid responsive units of rat tyrosine aminotransferase gene is associated with multiple binding sites for C/EBP and a novel liver-specific nuclear factor. Nucleic Acids Res. 19: 131-139. Hardon, E. M., Frain, M., Paonessa, G., and Cortese, R. (1988). Two distinct factors interact with the promoter regions of several liverspecific genes. E M B O J. 7-" 1711-1719. Harper, M. D., and Saunders, G. F. (1981). Localization of single copy DNA sequences on G-banded chromosomes by in situ hybridization. Chromosome 83" 431-439. Hobbs, H. H., Russell, D. W., Brown, M. S., and Goldstein, J. L. (1990). The LDL receptor locus and familial hypercholesterolemia: Mutational analysis of a membrane protein. Annu. Rev. Genet. 24" 133-170. Jelinek, D. F., Andersson, S., Slaughter, C. A., and Russell, D. W. (1990). Cloning and regulation of cholesterol 7a~hydroxylase, the rate-limiting enzyme in bile acid biosynthesis. J. Biol. Chem. 2 6 5 : 8190-8197. Jelinek, D. F., and Russell, D. W. (1990). Structure of the rat gene encoding cholesterol 7~-hydroxylase. Biochemistry 29" 7781-7785. Lee, J.-S. (1991). Alternative dideoxy sequencing of double-stranded DNA by cyclic reactions using Taq polymerase. D N A Cell Biol. 10" 67-73. Li, Y. C., Wang, D. P., and Chiang, J. Y. L. (1990). Regulation of cholesterol 7~-hydroxylase in the liver. J. Biol. Chem. 2 6 5 : 1201212019. McKusick, V. A., Francomano, C. A., and Antonarakis, S. E. (1990). "Mendelian Inheritance in Man," The John Hopkins Univ. Press, Baltimore. Mohandes, T., Heinzmann, C., Sparkes, R. S., Wasmuth, T., Edwards, P., and Lusis, A. J. (1986). Assignment of human 3-hydroxy-3methylglutaryl coenzyme A reductase gene to q13-q23 region of chromosome 5. Somat. Cell Mol. Genet. 12" 89-94. Molowa, D. T., Chen, W. S., Cimis, G. M., and Tan, C. P. (1992). Transcriptional regulation of the human cholesterol 7a-hydroxylase gene. Biochemistry 31: 2539-2544. Myant, N. B., and Mitropoulos, K. A. (1977). Cholesterol 7~-hydroxylase. J. Lipid Res. 18" 135-153. Nebert, D. W., Nelson, D. R., Coon, M. J., Estabrook, R. W., Feyereisen, R., Fujii-Kuriyama, Y., Gonzalez, F. J., Guengerick, F. P., Gunsalus, I. C., Johnson, E. F., Loper, J. C., Sato, R., Waterman, M. R., and Waxman, D. J. (1991). The P-450 superfamily: Update on new sequences, gene mapping, and recommended nomenclature. D N A Cell Biol. 10: 1--14. Noshiro, M., Nishimoto, M., Morohashi, K.-I., and Okuda, K. (1989). Molecular cloning of cDNA for cholesterol 7a-hydroxylase from rat liver microsomes. Nucleotide sequence and expression. F E B S Lett. 257: 97-100. Noshiro, M., and Okuda, K. (1990). Molecular cloning and sequence analysis of cDNA encoding human cholesterol 7a-hydroxylase. F E B S Lett. 268: 137-140. Orita, M., Suzuki, Y., Sekiya, T., and Hayashi, K. (1989). Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics 5: 874-879. Pandak, W. M., Li, Y. C., Chiang, J. Y. L., Studer, E. J., Gurley, E. C., Heuman, D. M., Vlahcevic, Z. R., and Hylemon, P. B. (1991). Regulation of cholesterol 7a-hydroxylase mRNA and transcriptional activity by taurocholate and cholesterol in the chronic biliary diverted rat. ft. Biol. Chem. 2 6 6 : 3416-3421. Paumgartner, G., and Sauerbruch, T. (1991). Gallstones: Pathogenesis. Lancet 338: 1117-1121. Ramji, D. P., Tadros, M. H., Hardon, E. M., and Cortese, R. (1991). The transcription factor LF-A1 interacts with a bipartite recognition sequence in the promoter regions of several liver-specific genes. Nucleic Acids Res. 19: 1139-1146.

HUMAN CHOLESTEROL 7a-HYDROXYLASE GENE Russell, D. W., and Setchell, K. D. R. (1992). Bile acid biosynthesis. Biochemistry 31: 4737-4749. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989). "Molecular Cloning: A Laboratory Manual," Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. Shaul, Y., and Ben-Levy, R. (1987). Multiple nuclear proteins in liver cells are bound to hepatitis B virus enhancer element and its upstream sequences. E M B O J. 6: 1913-1920. Shefer, S., Hauser, S., Bekersky, I., and Mosbach, E. H. (1970). Biochemical site of regulation of bile acid biosynthesis in the rat. J. Lipid Res. 11: 404-411. Shefer, S., Nguyen, L. B., Salen, G., Ness, G. C., Tint, S., Batta, A. K., Hauser, S., and Kani, I. (1991). Regulation of cholesterol 7~-hydroxylase by hepatic 7~-hydroxylase bile acid flux and newly synthesized cholesterol supply. J. Biol. Chem. 266: 2693-2696. Sundseth, S. S., and Waxman, D. J. (1990). Hepatic P-450 cholesterol

161

7a-hydroxylase. Regulation in vivo at the protein and mRNA level in response to mevalonate, diurnal rhythm, and bile acids feedback. J. Biol. Chem. 265: 15090-15095. Turley, S. D., and Dietschy, J. M. (1982). In "The Liver: Biology and Pathobiology" (I. Arias, H. Popper, D. Schachter, and D. A. Shafritz, Eds.), pp. 467-492, Raven Press, New York. Vaulont, S., Puzenat, N., Kahn, A., and Raymondjean, M. (1989). Analysis by cell-free transcription of the liver-specific pyruvate kinase gene promoter. Mol. Cell. Biol. 9: 4409-4415. Vega, G. L., von Bergmann, K., Grundy, S. M., Beltz, W., Jahn, C., and East, C. (1987). Increased catabolism of VLDL-apolipoprotein B and synthesis of bile acids in a case of hypobetalipoproteinemia. Metabolism 36: 262-269. Zuliani, G., and Hobbs, H. H. (1990). A high frequency of length polymorphisms in repeated sequenced adjacent to Alu sequences. Am. J. Hum. Genet. 46: 963-969.