JOURNAL OF BACTERIOLOGY, Aug. 1990, p. 4315-4321

Vol. 172, No. 8

0021-9193/90/084315-07$02.00/0 Copyright C 1990, American Society for Microbiology

Cloning of aldB, Which Encodes a-Acetolactate Decarboxylase, an Exoenzyme from Bacillus brevis B0RGE DIDERICHSEN,* ULLA WEDSTED, LISBETH HEDEGAARD, BIRGER R. JENSEN, AND CARSTEN SJ0HOLM Novo Nordisk, DK-2880 Bagsvaerd, Denmark Received 18 December 1989/Accepted 18 May 1990 A gene for a-acetolactate decarboxylase (ALDC) was cloned from Bacillus brevis in Escherichia coli and in Bacillus subtilis. The 1.3-kilobase-pair nucleotide sequence of the gene, aldB, encoding ALDC and its flanking regions was determined. An open reading frame of 285 amino acids included a typical N-terminal signal peptide of 24 or 27 amino acids. A B. subtilis strain harboring the aidB gene on a recombinant plasmid processed and secreted ALDC. In contrast, a similar enzyme from Enterobacter aerogenes is intracellular.

The main fermentation of beer is followed by a maturation period of several weeks, during which a-acetolactate is converted to diacetyl by a slow, nonenzymatic oxidative decarboxylation. Subsequently, diacetyl is converted to acetoin catalyzed by diacetyl reductase of the yeast cells still present at this stage (Fig. 1; 11). If a-acetolactate is not properly removed during the maturation, diacetyl later appears. The quality of beer may as a consequence be reduced, since diacetyl at a level of above 0.1 mg/liter has a negative effect on aroma and taste. By adding a-acetolactate decarboxylase (ALDC) to the fermenting wort, a-acetolactate can be removed as it is formed, thereby avoiding the formation of diacetyl and eliminating the need for maturation (Fig. 1; 12). We have in our laboratories discovered that a Bacillus brevis strain produces an ALDC which is well suited for use in the wort. To study the properties of this enzyme in more detail, we have cloned and expressed aldB, the structural gene for B. brevis ALDC, in Escherichia coli and in Bacillus subtilis. Analyses of the gene and its product show that ALDC from B. brevis is an exoenzyme that can be secreted by way of a proper signal peptide.

yeast extract, 20 g of corn steep liquor, and 50 g of sucrose per 1,000 ml of water, pH 6.2. Transformation. Competent cells of E. coli and B. subtilis were prepared and transformed by established procedures (15, 20). E. coli transformants were selected for resistance to ampicillin (100 ,ug/ml). B. subtilis transformants were selected for resistance to chloramphenicol (6 ,ug/ml). Manipulations of DNA. Chromosomal DNA was prepared by phenol extraction (20). Plasmid DNA was prepared by alkaline extraction (1). Restriction, ligation, and exonuclease treatment were with enzymes from New England BioLabs, Inc. Exonuclease III was used for generation of deletions (14). DNA for construction of gene banks and recombinant plasmids was isolated from agarose gels, using DEAEcellulose paper (7). Oligonucleotides. Probes, primers, and linkers were obtained from New England BioLabs or synthesized on an Applied Biosystems DNA synthesizer and purified before use. On the basis of a partial amino acid sequence of ALDC from B. brevis (B. R. Jensen, I. Svendsen, and M. Ottesman, Abstr. Eur. Biotechol. Congr. 1987, p. 393-400), mixture A of 12 17-mers and mixture B of 32 17-mers were designed as follows:

MATERIALS AND METHODS Bacterial strains and plasmids. The B. brevis donor strain was a derivative of ATCC 11031. The E. coli strains were: SJ2 lacIqZAM]5 hsdR, a derivative of E. coli K-12 C600, and SJ6 leuB hsdR, a derivative of E. coli K-12 MC1000 (2). The B. subtilis strains were DN1885 amyE, a derivative of B. subtilis 168 RUB200 (21), and DN969 and ToC46, proteasedeficient derivatives of B. subtilis 168 RUB200 (21) and 1A289 of the Bacillus Genetic Stock Center, Columbus, Ohio, respectively. E. coli plasmids are listed in Table 1. All E. coli strains are derivatives of SJ2 except UW25, which is derived from SJ6. B. subtilis plasmids are listed in Table 2. All B. subtilis strains are derived from DN1885 except UW123 and UW214, which are derived from DN969 and ToC46, respectively. Media. LB (16) and 2% agar was used for solid media, and TY medium was used for liquid media. TY contains, per 1,000 ml of distilled water: 20 g of Trypticase, 5 g of yeast extract, 6 mg of FeCl2 4H20, 1 mg of MnCl2 4H20, and 15 mg of MgSO4- 7H20, pH 7.3. ALDC was purified from a fermentation of B. brevis on the following medium: 10 g of

target A: A: 3'target B: B: 5'-

Met Ile Gln Met Gly CTT/C TAC TAA/G/T GTT/C TAC CC-5' Phe Glu Phe Asn Val Lys TTT/C GAA/G TTT/C AAA/G AAT/C GT-3

Probes A and B correspond to base pairs (bp) 487 to 471 and 777 to 803, respectively, in the nucleotide sequence shown in Fig. 4. Southern blotting analyses. Transfer of DNA was performed by electroblotting as described in the instruction manual for GeneScreen Plus hybridization transfer membranes (Dupont, NEN Research Products). Hybridizations were performed at 37°C with 32P-labeled oligonucleotides (16). DNA sequencing. Sequencing was performed directly on double-stranded plasmid templates, using the Sequenase kit from United States Biochemical Corp. and [35S]dATP from Dupont. Primers were pUC19 sequencing primers from Dupont or synthesized on an Applied Biosystems oligonucleotide synthesizer. The protocol was as described in the sequenase booklet except that 2 to 5 ,ug of plasmid DNA in 8 ,ul of H20 was denatured by addition of 2 RI of 2 M NaOH,

-

*

Glu

Corresponding author. 4315

DIDERICHSEN ET AL.

4316

0

J. BACTERIOL.

0

TABLE 2. B. subtilis plasmidsa

0

OH 0

OH

a-Acetolactic

ontiA

Diacetvl

Plasmid

Size

pPL1385 pDN2801 pUW100

Allele

Origin

2,674 bp 2,767 bp 4.0 kb

aldB91

pDN1050 + polylinkerb pDN1380 + polylinkerc pDN2801 + 1.3 kb from

pUW102

3,943 bp

aldB92

pUW104

3,927 bp

aldB94

pDN2801 + 1.2 kb from pUW92 ef pDN2801 + 1.1 kb from

pUW106

3,871 bp

aldB97

pDN2801 + 1.0 kb from

pUW9ld Dia(cetyl red' luctase

Acetolactate decarboxylase

\

pUW94d

HX

pUW97d

0

All plasmids are Cmr and are derivatives of pDN1050, a B. subtilis cloning vector composed of the replication region of pUB110 and the chloramphenicol resistance gene of pC194 (5). b The polylinker was constructed by first replacing the 183-bp BamHI-SphI fragment of pDN1050 (see above) with a 43-bp linker GV462 (5'-GATC CCGGGTACCGCGGCCGATCGGGCCCAGAGCTCTGGCATG-3') to obtain pDN2800. Then the 58-mer KFN602 (Table 1) was inserted in the EcoRI site of pDN2800 in the opposite orientation, as shown in Table 1. The order of the most important restriction sites in the linker area is as follows: EcoRI BglII XhoI Notl SphI NsiI Dral Hindlll BclI ClaI HindlIl PstI Sall BamHI SmaI KpnI SaclI XmaIII PvuI ApaI SacI SphI. c See Fig. 2. The polylinker is the Clal HindIl. Sacl SphI fragment of the polylinker of pPL1385 (see above), which replaces the 215-bp ClaT-ClaT fragment downstream of the amyM promoter on pDN1380 (6). d See text. e See Fig. 2. a

OH

Acetoin FIG. 1. Degradation of a-acetolactate. Efficient enzymatic conversion of acetolactate to acetoin prevents the slow, nonenzymatic formation of diacetyl (11).

neutralized by addition of 3 ,ul of 3 M sodium acetate (pH 4.6), and ethanol precipitated before resuspension in water and addition of primer and sequencing buffer. Colony hybridizations. Colonies were transferred to Whatman 540 paper filters, lysed, and immobilized (8). The filters were hybridized with 32P-labeled heptadecamer mixtures. Hybridization and washing of the filters were done at 37°C, followed by autoradiography for 4 h. ALDC antiserum. ALDC antiserum was raised in rabbits against ALDC purified from B. brevis ATCC 11031 (I. Svendsen, B. R. Jensen, and M. Ottesen, Carlsberg Res. Commun., in press). Colony immunoblotting. Nitrocellulose filters were placed on plates with recombinant colonies at 37°C for at least 30 min. The filters were blocked with 2% (wt/vol) Tween 20 in washing buffer (0.05 M Tris hydrochloride [pH 10], 0.15 M NaCl). They were incubated for 2 h in washing buffer containing 0.05% (wt/vol) Tween 20 and ALDC antiserum. The filters were washed three times for 10 min in washing buffer and incubated for 2 h in washing buffer containing 0.05% (wt/vol) Tween 20 and anti-rabbit peroxidase-conjugated antibody (Dakopats). For visualization of antigenantibody complexes, 3-amino-9-ethylcarbazole was used as substrate. ALDC assay. Enzymatic activity

was

assayed by

measur-

TABLE 1. E. coli plasmidsa Plasmid

Size

pDN3000 pUWl1

2,732 bp

pUW25

Allele

5.2 kb

aldB+

4.2 kb

aldB25

Origin

pUC19 + polylinker' pUC19 + 2.6 kb from B. brevisc pDN3000 + 1.5 kb from pUWllC

ing acetoin production in a fixed-time spectrophotometric assay. One unit is the amount of enzyme that produces 1 ,umol of acetoin per min under the following conditions. The incubation mixture (400 ,ul) was 50 mM MES [2-(N-morpholino) ethanesulfonic acid], 0.5 M NaCl, 0.2% Triton X-100, 5.3 mM R,S-cx-acetolactate (pH 6.0), and enzyme protein. The reaction was performed at 30°C for 20 min, and the acetoin was quantified at 522 nm after addition of 4.6 ml of color reagent (1% 1-naphthol-0.1% creatine in 1 N NaOH) and 40 min of color development time. The acetoin concentration was calculated by means of a linear acetoin standard curve from 0 to 80 mg/liter. The amount of acetoin produced by the enzyme was calculated after corrections for spontaneous decarboxylation and sample color. R,S-a-acetolactate was prepared from ethyl-2-acetoxy-2-methylacetate by controlled saponification at pH 11.5 in the pH stat in order to avoid 1-keto ester cleavage. ALDC purification. Cells were centrifuged (6000 x g, 4°C, 30 min), and the supernatant was dialyzed overnight at 5°C against 5 liters of 0.025 M MES (pH 6.1) with two changes of buffer. The retentate was centrifuged (13,000 x g, 40C, 30 min), and the supernatant was filtered on 1.2- and 0.45,utm-pore-size membrane filters. Then 40 ml of filtrate (506 U/ml) was passed through Polybuffer Exchanger 94 (16-mm diameter; 18 cm 36 ml; Pharmacia) equilibrated with 0.025 M MES (pH 6.1) at a flow rate of 1 ml/min. Enzymatically active fractions were pooled (78 ml; 247 U/ml; step yield, 95%) and concentrated by ultrafiltration on an Amicon PM-10 membrane to 10 ml (1,380 U/ml; step yield, 72%). Buffer was exchanged on Sephadex G-25 SF (16-mm diameter; 36 cm 72 ml; flow rate, 1 m/min Pharmacia) to 0.025 M Tris (pH 8.3). Active fractions were pooled (18 ml; 193 U/ml; step yield, 25%) and subjected to chromatofocusing on Mono-P HR 5/20 (Pharmacia) at a flow rate of 0.5 ml/min. The column was washed with 0.025 M Tris (pH 8.3) and then eluted with Polybuffer 96 (pH 6.2; 0.0075 mmol/pH unit per ml; Pharmacia) with acetic acid. The two most active fractions were pooled (2 ml; 1,035 U/ml; step yield, 60%). Polybuffer was removed by gel filtration on Superose 12 HR =

-

aPlasmids pUW88-92 and pUW94-97 were derived from pUW25 by exonuclease degradation (see text, Table 3, and Fig. 2). All plasmids are Apr and are derivatives of pUC19. b The polylinker Qf pDN3000 is the 58-mer KFN602 (5'-AATTGATCAA GCTTTAAATGCATGCTAGCAACGCGGCCGCCAACCTCGAGATCTC ATG-3') which in the above orientation was inserted in the EcoRI site of pUC19. The order of the most important new restriction sites is as follows: BclI HindlIl Dral NsiI SphI NotI Xhol BgllI EcoRI, followed by Sacl KpnI,

etc., of the original pUC19 polylinker. c See text and Fig. 2.

VOL. 172, 1990

CLONING OF THE aldB GENE OF B. BREVIS B

EA

4317

HmW3 Dral Nail Sphl Nhel Notl Xhol eQIBWv*n Xbal

FIG. 2. Maps of plasmids pUW11, pUW25, pDN2801, and pUW102. pUW11: Apr; bla is the beta-lactamase gene of pUC19; P,ac is the lac promoter of pUC19; A and B are the positions of the oligonucleotide probes (see Materials and Methods); L is the polylinker of pUC19 with the following important sites: Sacl KpnI SmaI BamHI XbaI Sall PstI SphI. pUW25: Apr Ald+. pDN2801: Cmr; cat is the chloramphenicol acetylase gene of plasmid pC194 of Staphylococcus aureus; the replication origin is from plasmid pUB110 of Staphylococcus aureus; the sequence of the polylinker is given in Table 2. pUW102: Cmr Ald+.

10/30 (flow rate, 0.5 ml/min; 0.2 M ammonium acetate at pH 6.0; Pharmacia). A 0.3-ml sample was applied in each run, and fractions of 0.5 ml were collected. The peak fractions from all runs were pooled (251 U/ml; step yield, 53%). Total yield was 5%. N-terminal determination. Automatic Edman degradation in a Beckman sequencer was used for determination of N-terminal amino acids (19). RESULTS Cloning of aldB in E. coli. On the basis of reverse translation of a partial amino acid sequence of ALDC from B. brevis (Jensen et al., Abstr. Eur. Biotechnol. Congr. 1987; Svendsen et al., in press), two oligonucleotide probes, A and B, were synthesized (see Materials and Methods). Chromosomal DNA from the B. brevis strain was analyzed by Southern blotting with radiolabeled probes A and B. A positive signal from a HindIII-HindIII band of approximately 2.6 kilobase pairs (kb) was observed with both probes, and the corresponding DNA fraction was isolated from an agarose gel and cloned on plasmid pUC19 in E. coli. Approximately 0.6% of the ampicillin-resistant recombinant transformants were positive in a colony hybridization with probes A and B. These colonies also reacted in a colony immunoblotting assay with B. brevis ALDC antiserum, harbored a 2.6-kb Hindlll-HindIll insert, and produced significant amounts of acetoin from acetolactate in the in

vitro ALDC assay (data not shown). Finally, a partial DNA sequence which conformed to the known amino acid sequence of the ALDC enzyme (Jensen et al., Abstr. Eur. Biotechnol. Congr. 1987) was obtained by the dideoxy method, using oligonucleotide mixtures A and B as primers. One of the ALDC-positive transformants, strain UWll harboring plasmid pUWll with an insert of 2.6 kb, was kept for further study. Analyses of recombinant plasmids. pUWll was mapped by restriction enzyme analyses, and locations of the regions homologous with each of the two probes were determined by Southern blotting to be on either side of the KpnI site at 1.3 kb (Fig. 2). Thus, the orientation of the insert was determined. To subclone aldB and to construct a plasmid suitable for exonuclease degradation of the cloned region, the BamHISmaI fragment of pUWll was cloned on pDN3000, a derivative of pUC19 with a new polylinker. The resulting plasmid, pUW25 of 4.2 kb (Fig. 2), expressed strong ALDC activity in E. coli. Plasmid pUW25 was cut in the unique NsiI and NotI sites and subjected to exonuclease degradation, removal of overhang by Si nuclease, and ligation in the presence of BglII linker. A number of plasmids from Ald+ and Ald- transformants (as judged by colony immunoblotting with ALDC antiserum) were analyzed, and the extent of the degradation was compared with the phenotype (Table 3). The four

4318

DIDERICHSEN ET AL.

J. BACTERIOL.

TABLE 3. ALDC yields aldB allele"

ALDC yield (U/mi)

Upstream bpb

E. coli

88

410C

44

89

360C

43

90 91 92 94 95 96 97

237d

60

230d 130d

74 2 1