Cell, Vol. 65, 551-568,

May

17, 1991, Copyright

0 1991 by Cell Press

Cloning, Expression, and Transcriptional Properties of the Human Enhancer Factor TEF-1 Jia Hao Xiao,’ Irwin Davidson, Hans Matthes, Jean-Marie Garnier, and Pierre Chambon Laboratoire de Genetique Moleculaire des Eucaryotes du CNRS Unite 184 de Genie Genetique et de Biologic Moleculaire de I’INSERM lnstitut de Chimie Biologique Faculte de Medecine 11, rue Humann 67085 Strasbourg Cedex France

Summary We describe the cDNA encoding the SV40 transcrip tional enhancer factor 1 (TEF-1) and show that its translation initiates exclusively at an AUU codon in vivo. Cloned TEF-1, which is unrelated to other known transcription factors, specifically binds the SV40 GT-IIC and Sph enhansons. Cloned TEF-1 does not activate these enhansons in lymphoid MPCll cells where they are known to be inactive, but represses the endogenous HeLa TEF-1 activity in vivo and in vitro. Repression is also observed with chimeras where the DNA-binding domain of the GAL4 activator replaces that of TEF-1, showing that repression results from interference/squelching. Such chimeras stimulate transcription in HeLa, but not in MPCll, cells in vivo and in HeLa cell extracts in vitro. However, high concentrations result in self-interference/squelching. These results strongly suggest that the trans-activation function of TEF-1 is mediated by a highly limiting, possible cell-specific, titratable transcriptional intermediary factor(s).

the above SV40 enhansons (Wildernan et al., 1986; Davidson et al., 1986; Landolfi et al., 1987; Staudt et al., 1986; Xiao et al., 1987a, 1987b; Scheidereit et al., 1987; Resales et al., 1987; Sturm et al., 1987; Davidson et al., 1988; Macchi et a!., 1989, and references therein; see Figure 1A). One of these proteins, transcriptional enhancer factor 1 or TEF-1 (protein GT-IIC), which was identified as binding specifically to the GT-IIC enhanson in HeLa but not in MPCl 1 cell extracts, has been purified (Xiao et al., 1987a; Davidson et al., 1988). This 53 kd HeLa cell protein displays the unusual property of recognizing not only the GT-IIC enhanson, but also the Sph-I and Sph-II enhansons, which are of an unrelated sequence. Moreover, the TEF-1 protein binds cooperatively to tandem repeats of its cognate enhansons, but noncooperatively to spaced or inverted repeats. This observation correlates with, and may at least partially explain, the much higher activity in vivo of oligomers containing tandem repeats as opposed to spaced repeats of the GT-IIC enhanson (Fromental et al., 1988). In vitro binding Studies using the TEF-1 protein and the TEF-2 protein (factor GT-IC; Xiao et al., 1987b), which binds to the GT-I enhanson, did not reveal any cooperative DNA binding (Davidson et al., 1988). Thus, the strong functional synergy of these two enhansons in vivo (Fromental et al., 1988) is most likely the result of the cooperative activation of an as yet unidentified component(s) of the transcriptional machinery. As the first step to understanding the molecular basis of these phenomena, we have now cloned a cDNA encoding the TEF-1 factor. The protein encoded by this cDNA, which appears unrelated to other known transcription factors, binds specifically and cooperatively to the Sph and GT-IIC enhansons and activates transcription in vivo in a cell-specific manner. Interestingly, the activation function appears to be mediated by a limiting cell-specific transcriptional intermediary factor (TIF).

Introduction Results The enhancer of simian virus 40 (SV40) is a c&acting regulatory element that stimulates transcription from RNA polymerase B (II) promoters (Benoist and Chambon, 1981; Moreau et al., 1981; Banerji et al., 1981; for reviews see Chambon et al., 1984; Wasylyk, 1988; La Thangue and Rigby, 1988; Hatzopoulos, 1988, and references therein). Genetic studies have revealed that this enhancer consists of multiple enhansons GT-IIC, GT-I, TC-II, Sph-II, Sph-I, octamer, and P, which function synergistically in a cellspecific manner (Zenke et al., 1986; Davidson et al., 1986; Herr and Clarke, 1986; Ondek et al., 1987, 1988; Gerster et al., 1987; Schirm et al., 1987; Nomiyama et al., 1987; Tanaka et al., 1988; Fromental et al., 1988; Kanno et al., 1989; see also Petterson and Schaffner, 1987; Figure 1A). In vitro binding studies have identified several proteins, some of which exhibit cell-specific activity, interacting with * Present address: gan, 6558 Kresge

Department of Dermatology, University of MichiI Building, Ann Arbor, Michigan 48109-8314.

TEF-1 cDNA and Deduced Amino Acid Sequences The unusual ability of the TEF-1 protein to bind the GT-IIC and Sph enhansons (see Figures 1A and lB), which are of distinct sequences, was exploited to identify a corresponding cDNA clone. A HeLa cell ligtl 1 cDNA expression library was screened with a =P-labeled oligonucleotide containing a tandem repeat of the high affinity GT-IIC enhanson (OGT2-56; Figure 1B; see Experimental Procedures) or the Sph-I and Sph-II enhansons (OSph-0; Figure 1 B). One clone, J-l (see Figure 2A), in which the f3-galactosidase-cDNA fusion protein bound the wild-type but not the mutated GT-IIC and Sph enhansons, was obtained (data not shown). The cDNA insert of J-l was sequenced, and the predicted amino acid sequence was found to contain the sequence of a peptide obtained by microsequencing the purified HeLa TEF-1 protein (data not shown; see PSl in Figure 3). This 0.64 kb J-l clone cDNA was used to screen two

Cdl

552

(101)

8

(270) PVUII I I

BarnHI ‘*”

(015243) , LEES . ..__ ......~~~.~ OCTAMER

(5171) Hindlll 1

Figure moter

1. Organization

of the SV40 Early Pro-

(A) The upper line shows schematically the structure of the SV40 early promoter con17‘9\ (::I& taining only one copy of the 72 bp repeat. The ~lo7~‘~--~~-.--.-..--.-~---.--., 235 I 245 positions of the essential promoter elements, the TATA box, the 21 bp repeat (21, 21, 22) and the 72 bp enhancer element are indicated along with the coordinates (EBB numbering system; Tooze, 1982)of several natural orengiHELA neered restriction enzyme sites (see Zenke et al., 1986). EES and LES show the positions of the early-early and late-early mRNA start sites. MPCll The second line shows the sequence of the 72 bp element (indicated by the broken vertical line) and the 5’ flanking sequence. The identified enhansons are boxed and the coordinates of the 5’ and 3’ boundaries of each enhanson are indicated. Below the sequence are shown ~~~~...C..~.~~~~~~.....~~... schematically the DNA-binding activities identiOGT2~52 L OSph., L CCT.------- . . .._.. ~~~~~~.. ---....C..T-CT. .T.mmmmmm... OGT2-53 L fied for each enhanson in both HeLa and ~~~~~~........TT..~~~~.......~~~~~ OSph-2 L ~~~~~~......~....~~~...~*c..~~~~~~ MPCll lymphoid B cells. OTFs are octamerGT~IIC GT-IIC OSph-4 L ~~~~~~CCT...-..~~~~~.~~C.....~~. binding transcription factors (see text for references). MPCI 1 and HeLa indicate the proteins identified as binding to the enhansons above each symbol in MPCll or HeLa cell nuclear extracts. (8) Sequence of oligonucleotides containing the GT-IIC and Sph enhansons. OGT2-50 contains the sequence of the wild-type GT-IIC enhanson. Land E are the late and early coding strands. The coordinates are as in Figure 1A. The nucleotides changed on the L strand in the mutant templates OGT2-52, -53, are indicated immediately below. OGT2-56 contains a tandem repetition of the GT-IIC enhanson and the mutations in OGT2-57. -58 are indicated below. All templates are flanked by asymmetric Aval sites. OSph-0 contains the wild-type Sph-I and -II enhansons (solid boxes) and the overlapping octamer enhanson (broken box). The locations of the mutations selectively affecting either the Sph-II (OSph-1), the octamer (OSph-2). the Sph-I (OSph-4). or both Sph-I and -II (OSph-5) enhansons are indicated below OSph-0. OGC3-0 contains the wild-type Spl-binding GC box Ill from the 21 bp repeat region (see also Xiao et al., 1987a. 1987b; Davidson et al., 1988). 72bp

IbTTqr

r

kLES

IZAP- HeLa cDNA libraries prepared by either random or oligo(dT) priming. cDNA clones larger than 1.2 kb (clones Z-l to Z-7 from the random-primed cDNA library, and clones Zt-1 and Zt-2 from the oligo(dT)-primed cDNA library; see Figure 2A) were sequenced on both strands. The cDNA sequence (Figure 3) revealed the existence of a potential AUG(586) initiator codon in the context of a sequence sharing good homology (1 O/l 3 nucleotides; see Figure 6C) with the Kozak consensus sequence (Kozak, 1989a, and references therein) followed by an open reading frame (ORF) of 411 amino acids. However, an in-frame AUU(541) codon was used exclusively as an in vivo initiator (see below), which results in an ORF of 426 amino acids. The calculated molecular size of the product of this ORF is 47.9 kd, which correlates with the apparent 53 kd molecular size of affinity-purified TEF-1 on SDS-PAGE (Davidson et al., 1988; see also below). In addition, the ORF contains the sequences of four peptides (PSl-PS4, boxed in Figure 3) obtained by microsequencing of the affinity-purified HeLa TEF-1. Sequence comparison indicated that the J-l cDNA insert contained the first 110 amino acids of the predicted ORF preceded by a short 5 untranslated region (5’-UTR) (Figure 3; data not shown). Comparison of the nucleotide sequences in the 5’UTR shows that the cDNAs fall into two classes, which differ by the presence or absence of a 153 nucleotide segment (positions 334 to 486, underlined in Figure 3). This difference, which was found in several independent clones, probably results from an alternative splicing event. The

cDNAs lacking the in-frame stop codon present within this 153 bp segment contain a potential extended ORF. To exclude the possibility that the extended ORF could be initiated by an AUG located upstream of the 5’end of clone Z-4, a genomic clone containing this region was isolated and sequenced, and the position of the cap site of TEF-1 mRNA was determined by Sl nuclease mapping (unpublished data). No AUG, AUU, or CUG codons (see below) were found in the (60 bp) region between the mRNA cap site and the 5’ end of the Z-4 cDNA. The sequence of the 426 amino acid TEF-1 ORF contains a serine-rich acidic domain at the N-terminus from Ile-1 to Glu-45 with a net negative charge, followed by a basic domain from Arg-55 to His-121 and a highly hydrophobic proline-rich domain from Pro-143 to Pro-204 (see Figure 28). The C-terminal portion contains a short region rich in hydroxylated amino acids (serine, threonine, tyrosine) from Tyr-306 to Ser-328 (Figure 28) and interestingly, a putative metal binding finger motif CXXC (X),,HXXXHH from Cys402 to His-419. No obvious sequence homology could be found between the TEF-1 ORF and the other proteins present in the SwissProt (No. 15) and NBRF (No. 25) data banks or to other recently reported transcription factors. However, domains rich in acidic amino acids, prolines, and hydroxylated amino acids have been described as activation domains in many other transcriptional transactivators (Ma and Ptashne, 1987a, 1987b; Giniger and Ptashne, 1987; Gill and Ptashne, 1988; Hope and Struhl, 1986; Hope et al., 1988; Kim and Guarente, 1989; Fors-

$ing

of Transcriptional

Enhancer

Factor

1

“GA AUU

5’ 1

AUG

0

4

I

1000

I

2000

/A

3000

5000n1

IIOAA J-l

lh==

2-4 I z-5

I I

I

2-6 Z-7 21-l zt-2

I +

I I I

I I

t

ANTIGENIC 1 ,6?5 171-

PEPTIDES I $37,

AUU !lIG

1

4666

Hydrophlllc

+DNA+

11,

143

a4

Hymc

-Activation

q

D,E I 26% IH,K,FI=~~% P=25% s=26% 102 Zinc Finger-like Motif ~MA~VFEVSNSE~GAQ~,

Figure

2. Structure

of TEF-1

S,T,Y = 46% 4,s

cDNAs

(A) The structures of the overlapping HeLa cell clones from the random-primed 1g.stl 1 expression library (J-l), the oligo(dT)-primed XZAP-II library (Zt-1 and Z&2), and the random-primed IZAPlibrary (Z-l to Z-7) are represented schematically. The filled box refers lo the ORF of TEF-1, and the AUU, AUG. and UGA codons are indicated. The solid lines represent the length of each cDNA clone, and the names of each clone are indicated on the lefi side of the diagram. The first 110 amino acids of the ORF found in the clone J-l are indicated by a filled box. The clone Z-7 contains a nonsense frameshift deletion due to an artifact of the cDNA synthesis. The absence of the 153 nuclB(F tide segment in the first three clones is represented by a folded solid line. The numbers below the first line show the number of nucleotides from the 5’ end of the 24 clone, which is that extending furthest 5’. (B) Some primary structure featuresof the human TEF-1 protein. Some features of the TEF-1 amino acid sequence are schematically represented. Each differently filled box refers to the region containing a preponderance of one or several types of amino acids, which are indicated at the bottom using the single-letter code. “Antigenic peptides” show the locations of the peptides against which antibodies were raised, and the numbers indicate the amino acids at the N- and C-termini of each peptide, where 1 is taken as being the ILE (AUU). ‘DNA’ and “activation” show the positions of the DNA-binding and transcrip tional activation domains.

burg and Guarente, 1989; Sadowski et al., 1988; Treizenberg et al., 1988; Williams et al., 1988; Mermod et al., 1989; Theill et al., 1989; Nicosia et al., 1990). TEF-1 Transcripts Are Absent in Lymphoid Cells Northern blot analysis of total or poly(A)+ RNA from different cell lines revealed the presence of a major TEF-1 transcript of -12 kb, and minor transcripts of 2.4-3.5 kb in HeLa cells (Figure 4). Analysis of the 3’-UTR revealed the existence of several putative polyadenylation signals (broken underlining in Figure 3) that would generate tran-

scripts of the shorter (2.5-3.5 kb) size class. Indeed, clones Zt-1 and Zt-2 (Figure 2A), which may belong to this class of shorter transcripts, appear to be polyadenylated immediately downstream of one such site (see Figure 3). Several other cDNAs (Figure 2A), however, extend 3’ to these sites, consistent with the existence of a much longer class of mRNAs. The 12 kb TEF-1 transcript was also detected in mouse F9 embryonal carcinoma cell RNA, while no TEF-1 transcripts could be found in the mouse MPCll or human BJA-B lymphoid B cell RNAs (see the a-actin control in Figure 4, bottom). The lower intensity of the mouse F9 embryonal carcinoma cell 12 kb transcript may be due to sequence divergence between the two species, as washing at higher stringency completely removed the F9 cell signal (data not shown). Thus, the previously defined cell specificity of TEF-1 activity (Xiao et al., 1987a; Fromental et al., 1988) appears to result from cell-specific expression of its mRNA. Whether the TEF-1 gene is not transcribed in lymphoid cells or whether it is transcribed but is unstable in these cells is unknown. Note, in this respect, the presence of several potential mRNA destabilization signals in the 3’-UTR (5’-AUUUA-3’, solid underlining in Figure 3; see reviews by Cosman, 1987; Malter, 1989, and references therein). Identical DNA-Binding Properties of the Cloned and Endogenous HeLa Cell TEF-1 Proteins To investigate the DNA-binding properties of the cloned TEF-1 protein, the full-length ORF was expressed in HeLa cells and in Escherichia coli (see Experimental Procedures). HeLa cells were transfected with pSG5-TEF-l(wt) (+cDNA in Figure 5A; see also Figure 78) or expression vector pSG5 alone (-cDNA in Figure 5A), and nuclear extracts were prepared and used in a PAGE retardation assay. In extracts from cells transfected with pSG5-TEFl(wt), the amount of specific TEF-1 complexes A and B formed with the GT-IIC or Sph enhansons was significantly increased compared with control extracts, while Splspecific complexes remained constant (see OGC-3 in Figure 5A). Note, for instance, that complexes A and B could readily be detected in the pSG5-TEF-l(wt)transfected cells using the Sph template OSph-0, while such complexes were very faint in untransfected or pSG5transfected HeLacell extracts (Figure 5A; data not shown). In the presence of a large excess of labeled template more dimeric complex A than monomeric complex B was formed, indicating that DNA binding wascooperative. This conclusion was also suggested by the fact that mutation of the high affinity Sph-II enhanson (OSph-1) abolished formation of both complexes A and B, even though the weaker Sph-I enhanson was still intact (see Davidson et al., 1988). In addition, the use of mutated templates indicated that the overexpressed TEF-1 protein had the same sequence specificity as the endogenous HeLa TEF-1 protein (see OGT2-53, 58, 57, and 58 and OSph-1, 2, and 5 in Figures lB, 5A and 58). Extracts frbm E. coli in which the TEF-1 ORF was overexpressed under the control of the T7 promoter generated complexes A and B of the same electrophoretic mobility

Cell 554

10 20 30 40 50 60 70 80 I I I I I I I I CGCCGCCCGCCGCGGGCGCCCACCAAGCACTTTGCAGACTCGCTTCCACCCTGCGGGCCATTCCGCGCGGCGGGGCCCGGGCCCGGGGCG GCCGCGTCCAGGCACAGGCCATGCAGTGACGCCCCCCCACCCCTCCACCTTTGCCCGGACGGCGGGCAGCAGCCCAGCGCGCCAGCCGGC CCCGGGGCAGGAGCGGTGCTAGGCAGGGGTGGGGTGGCCGGGCCCAGGGACCGGGAGCCGGGGAGGGAGCCGGGCACCGAGCAGAGGGCG GGGGAAGCGGCGCCGAAGTTTGCCTCGGACTCGCCGGGCGCTGCGGTGGCTCCCTGGGCCGAGGACTGTTGCTGCCGCTGCCGCCGCCGC TTCATTGCACATTCAAGTGGAAAATTTTCAGGAGTCAGCAGAAACATTGTGTCCAAAAAAGACTGAGTCGCAGTTACCACCAAACCCAGG S'(Zt-l)GAATTCC+ AGGAGACTCTCCCTGGAAAACTTCCCTTCCCCTTTCGGTTTATTTTCTTG~AAGGCTCCAGGCTTCGGCTTGGAAAATCCCACCGCCAAA AGCCCAGCAGCTGGAGCGGCAGTGAGAGCCCTGCCGAAAAAAAGGATGAGTGACTCTGCAGATAAGCCAATTGACAATGAT 4c--, 4I

E

P

S

S

W S G S ESPAENME R M s u s A D K P I P2 Pl GCAGAAGGGGTCTGGAGCCCCGACATCGAGCAAAGCTTTCAGGAGGCCCTGGCTATCTATCCACCATGTGGGAGGAGG~AATCATCTTA FQEALAIYPPCGRRKIIL A E GVWSPDIEQS TCAGACGAAGGCAAAATGTATGGTAGGAATGAATTGATAGCCAGATACATCAAACTCAGGACAGGCAAGACGAGGACCAGAAACRGGTG S DEGKMYGRNELI AR Y I K L K T G K T R T II PS1 TCTAGTCACATTCAGGTTCTTGCCAGAAGGAAATCTCGTGATTTTCATTCCAAGCTA~GGATCAGACTGCAAAGGAT~GGCCCTGCAG S S H I QVLARRKSRDFH SKLKDQTAK DKP3 CACATGGCGGCCATGTCCTCAGCCCAGATCGTCTCGGCCACTGCCATTCATAACAAGCTGGGGCTGCCTGGGATTCCACGCCCGACCTTC S S A Q I V S AT A I H N K I, G L P GIP R H M A AM PS2 CCAGGGGCGCCGGGGTTCTGGCCGGGAATGATTCAAACAGGGCAGCCAGGATCCTCACAAGACGTC~GCCTTTTGTGCAGCAGGCCTAC P G A P GFWPGMI Q T G Q P GSSQDVKPFV Q CCCATCCAGCCAGCGGTCACAGCCCCCATTCCAGGGTTTGAGCCTGCATCGGCCCCAGCTCCCTCAGTCCCTGCCTGGCAAGGTCGCTCC P I QPAVTAPIPGFEPASAPAP SVPAWQ ATTGGCACAACCAAGCTTCGCCTGGTGGAATTTTCAGCTTTTCTCGAGCAGCAGCGAGACCCAGACTCGTACAACAAACACCTCTTCGTG I GTTKLRLVEF S A F L E Q Q R D P D S Y N K[H PS3 CACATTGGGCATGCCAACCATTCTTACAGTGACCCATTGCTTGAATCAGTGGACATTCGTCAGATTTATGACAAATTTCCTG~AAGAAA H I G H AN H S Y S D P L L E S V D I R Q I Y D K F P PS4 GGTGGCTTAAAGGAACTGTTTGGAAAGGGCCCTCAAAATGCCTTCTTCCTCGTAAAATTCTGGGCTGATTTAAACTGCAATATTCAAGAT G GLKELFG KGPQNAFF L V K F W A D LNCNIQD GATGCTGGGGCTTTTTATGGTGTAACCAGTCAGTACGAGAGTTCTGAAAATATGACAGTCACCTGTTCCACCAAAGTTTGCTCCTTTGGG DAGAFYGVT SQYESSE NMTVTCSTKVC AAGCAAGTAGTAGAAAAAGTAGAGACGGAGTATGCAAGGTTTGAG~TGGCCGATTTGTATACCGAATAAACCGCTCCCCAATGTGTGAA KQVVEKVE TEYARFENGRFVYRINRSPMCE TATATGATCAACTTCATCCACAAGCTCAAACACTCAAACACTTACCAGAGAAATATATGATGAACAGTGTTTTGGAAAACTTCACAATTTTATTGGTG Y M I N F IHKLKHLPEKYMMNS VLENFTI GTAACAAACAGGGATACACAAGAAACTCTACTCTGCATGGCCTGTGTGTTTGAAGTTTCAAATAGTGAACACGGAGCACAACATCATATT V T N R D T Q E TLLCMACVFEVSNSEH G A Q TACAGGCTTGTAAAGGA~CATGGTTATTTATATATATAGATATCTGTATATACACACACACATATGTGCACACACACACTCTCTCT YRLVKD CCATTATCGAACGACTGACTGTAAACCTCACCACACAGGGTGGTGCCCTGGCCCCGAGGTCACCCCGACTTTTCTAAATCTTGTTTGAGT GAAGTCATTTTTTCATGTGTTCATACTATCATTGTAGCTGTGAAGTTCTGGTACAGTTGTAAAAAGAGAGAAATTGAGTTGTTTCTCTATGT TCTTCAGATGTGCAGCCCACAATTCCTCGGGAAAGGTGAACCTGAACAACCCAAGTCTCTCTCTGCAGAGCCCTGTTTCTAATTGTGGTA GAAAATATTGAGACAGAGCATTTGCCATGGGAC~CAGCCTTTATACAAATGTATTTAGTTCTCTTTTTTCCAACATAA~TTCTTG TTTTAAGATACAAGTAAAATTAATCTTTTATAAATGTTT .-m_mm-AGGGTGGAAGTTATGAAAGAATGTAATTCACTAAATTATTTTTTA~TG~ACCTTTTTTTTTCTTTTTGAAACCAAATGTT~ACTATA GCCTTAAGAAATGCTTGGTAGAAGTGTGTCCTAATGAGACAAATTTGTACTTTTATCCTCAAGGTTAACACT~TCTCCTAATCCATTAAAC TCTTGAACAGGTATTACAAAGGAAGAAAACTTCACTTCACCCCTTATCCTTAACATATATAGTATATTTAA~AATATA~ATTGTATTGTACTA _-_____. ATGTGATGATGGATT~ATGAAAAAGAAAAAATGGCTCTTTTTGCAATAAGTAGATA~TGAAA~ATCTAAACTTACAATGTT -c AAAAAAAAAAAAAAAAGGAATTC(Zt-1)3' TATAGTCTTGTGTGTGCAGTTATATTTTATATGGACGACCA~TTTTTTATTAAGATGAGTA~TATTTGAACCACTGAATTTTAATAAC ---_a_s. AAAATTTTAAAATTGGCATGAATACGGAATACTGCACTGTGAGATGCAAAGTATACAGAATCTGTGGCTGGGAGAAAATTTCATCA~TA GACAAGTAARAGGCTCATCAGTTTTAGCATCTCTGCTCCCCAGAAAATTGTAAGCATCCTCACCAGCCTGTGGATACATTCTTTATTTCT .ams.mae AGTGACCCAATATGCATATTAACCTGCTATAACTAGGGCTATATGTGTAGGTATGTGTATACATATACACAAATGCACATATAGAGTTAA CACATTTAGTGAACACTTGTTTAGTGTCACTCAGTTTGCTAGGTGCTGATATGTACGTATATCTCAATGTGTCTGTAGACTTAGATACAT CCTCTTGAAGCACATCCATTTCTTTAGCGTCTCTCAGTAAGTTACAGTACTTGTTTGACTTAGGTTTAAGAGGCCCAGCTACCTATCTCT GACCTTTTCAAATAGGCTCATTTGGGAGATTCTTTTGCCAGGAGAGATTCAACTTTCCAATCTAAGTATTCCAGAGCATTGCCCAGGCAG AGTTGGTTTGATGTGGCCAGATGTTTTGAGTTATTTCCCTTAAGTGTTTCACTGGGGAGAGAACAGGGAGTGCTCCTCCAGCTTCCCAAA GAAATATGTTTTTGTAAGTGGTAGGAACATGTGCACACAAGTTTTTTAACTTGTAAAACATGTCAAGATTTTTCC ACCAAGCTAGAAAATAAAAAACTTAGTTCTACCACATCCAATTAACTTACACACCCCCTTCCCTGTCTCAACACCTGCTTTGACCCTGCT __-___-. TTTCTATTATTACATCAGTCAGCATCTTGTGGTCCCTAACATGAGGATGTGGCTGGCTCGTGGGAAACAGCAAAACACTAAGCCTGACCT CTCCCAAATTGGGRAGACCAGAGGAGAAAGTGCAAAACTGTCCCCATTTGGAATGCCCATTCCTTCTAGAAACCAGTTGGACAGTGCTCC TCTGCCCTTCATARACAGACTACTGTTGGGTCCCTGATTCCAGGCTGGCCTGTGAAGGATTGCCCCAGGTGTCCCCTTTCACGGTTGTCA CATTTACAGTGACTTCTGTTGAACACCCCCTCTTAGGGATGTTTCTTTTGCTCTTATTTCC

90

I 90 180 270 360 450 540 630 D

K

N

Q

D

30

V

720 60 a10 90 900 120

P

T

F

Q

A

Y

G

R

S

E

K

K

S

F

G

L

L

v

H

H

I

masaa.a.

990 150 1080 180 1170 210 1260 240 1350 270 1440 300 1530 330 1620 360 1710 390 1800 420 1890 426 1980 2070 2160 2250 2340 2430 2520 2610 2700 2790 2880 2970 3060 3150 3240 3330 3420 3510 3600 3690 3780 3870 3930

Cloning 555

of Transcriptional

Enhancer

Factor

1

plex C, while the corresponding preimmune sera (Cl -C3) had no effect (Figures 5C and 5D). Similar results were obtained with an antiserum directed against the C-terminal portion of the protein (187-428) expressed in E. coli (data not shown). Thus, antisera directed against the cloned TEF-1 also recognize the protein responsible for the endogenous TEF-1 activity. Taken together with the DNAbinding properties of the cloned TEF-1 protein and the presence, in the TEF-1 ORF, of peptide sequences found in the affinity-purified HeLa TEF-1, these results indicate that the protein responsible for the endogenous HeLa cell TEF-1 activity is identical to that encoded by the ORF present in pSG5-TEF-l(wt).

Figure Lines

4. Northern

Analysis

of TEF-1

Transcripts

in Different

Cell

Fifteen micrograms of either total RNA from HeLa cells, or poly(A) RNA from mouse F9 embryonal carcinoma cells, MPCI 1 lymphoid S and human RIA-8 lymphoid cells, or HeLa cells was loaded on the gel as indicated above each lane. The positions of both the 2% and 19s ribosomal RNAs. which were used as size markers, are indicated on the left of the figure. The sizes (in kilobases) of the TEF-1 transcripts are shown on the right side of the figure. The control hybridization of the same filter using the human a-actin cDNA as a probe is shown at the bottom (ACT).

as their HeLa counterparts (Figure 58; data not shown). The binding was cooperative as indicated by the efficient formation of the dimeric complex A in the presence of excess template. Thus the cooperative TEF-1 binding does not require posttranslational modification, or interaction of TEF-1 with another protein(s), as is the case, for example, with the JunlFos family or NF-YICPI (reviewed by Johnson and McKnight, 1989; van Huijsduijnen et al., 1990). To demonstrate further that the cloned and endogenous TEF-1 proteins have identical properties, antisera to synthetic peptides Pl-P3 (see Figure 28) were raised in rabbits. Fractionated HeLa ceil nuclear extracts were preincubated with these antisera and analyzed for DNA-binding activity in a gel retardation assay. Using templates containing either the GT-IIC or Sph enhansons, the anti-Pl, -P2, or -P3 antiserum dramatically reduced complexes A and B and resulted in an additional, slower migrating com-

Figure

3. cDNA

and Deduced

Amino Acid Sequences

Translation of TEF-1 Is Initiated at an AUU Codon In Vitro and In Vivo The first AUG(586) of the TEF-1 ORF is located within a 1 O/ 13 homology to the Kozak consensus (Figure 6C). Thus, according to the “first-AUG rule” (Kozak, 1987), this AUG is an excellent initiator codon candidate. To express TEF-1 efficiently, a perfect Kozakconsensus sequence was introduced into the TEF-1 cDNA in the pSG5 expression vector at AUG(586) (mutation ml in Figure 6B), yielding pSG5TEF-1B (see Experimental Procedures and Figure 78). Following transcription/translation in vitro, the synthesized protein migrated as a 51 kd polypeptide (see pSG5-TEF1B in Figure 6D) rather than the expected 53 kd. However, in vitro transcription/translation of the unmodified Zt-1 cDNA in pSG5-TEF-l(wt) (see Figure 78) gave lower amounts of the 51 kd polypeptide and a novel major polypeptide of 53 kd (Figure 6D). The same in vitro translation products were also obtained with unmodified Z-2 and Z-6 cDNAs (Figure 6D), despite the presence of an in-frame stop codon (UGA424; see Figure 3) in the 5’UTR of Z-6. Therefore, an unidentified initiation codon was located between positions 486 and 586. Analysis of this region revealed an in-frame AUU(541) in a 9/13 homology to the Kozak consensus sequence (Figure 8C). To determine whether the 53 kd product was initiated at this position, several point mutations were created (see ml-m4 in Figure 8B). The synthesis of the 53 kd polypeptide was completely abolished by mutation of AUU(541) (m2 in Figures 6B and 6D), while, in accordance with the scanning model (Kozak, 1979), that of the 51 kd polypeptide was enhanced. A mutation (m3) generating a fully consensus Kozak sequence at AUU(541) resulted in more efficient production of only the 53 kd polypeptide, suggesting that the 51 kd protein resulted from “leaky scanning” (Kozak, 1986), which could be significantly reduced by creating a stronger upstream initiator. In contrast, creating a perfect Kozak consensus around

of TEF-1

The nucleotide and deduced amino acid sequences of TEF-1 cDNA are shown. The nucleotide sequence in any given region was determined from at least two independent clones. The 153 bp insertion in the 5”UTR is underlined, and the Sand 3’termini of the Zt-1 clone are indicated. The AUU and AUG initiators and the UGA stop codon are boxed. PSl-PS4 show the peptide sequences obtained from the endogenous affinity-purified HeLa cell protein, and Pl-P3 show the synthetic peptides used to generate polyclonal antisera. The positions of the potential polyadenylation and mRNA destabilization signals in the B’UTR are indicated by the broken or solid underlining respectively. The facing arrows downstream of the AUU initiator show the positions of two palindromic/stem-loop structures.

Cell 556

Template

Figure 5. Comparison of the DNA-Binding Properties and Endogenous TEF-1 Proteins in a Gel Retardation

Osph-2

of the Cloned Assay

(A) Analysis of the DNA-binding properties of the cloned TEF-1 overexpressed in HeLa cells. The gel retardation assays were performed with nuclear extracts (12 ug of protein) prepared from HeLa cells transfected with the expression vector pSG5 either containing the TEF-1 cDNA (+cDNA on the left) or without the cDNA insert (-cDNA on the right). The synthetic oligonucleotide templates used (see Figure 1 B) are indicated at the top of each lane. A, B, F, NS, and Spl indicate the positionsof thedimericTEF-1 DNA complex(A), themonomericTEF-1 DNA complex (B), the free template (F), a nonspecific complex (NS), and the Spl-DNA complex (Spl). (B) Analysis of the DNA-binding properties of the cloned TEF-1 protein overexpressed in E. coli. The nomenclature is the same as in (A). (C) Gel retardation analysis of the binding of the endogenous HeLa TEF-1 to the GT-IIC enhanson in the presence of antisera Pl-P3. A fraction containing partially purified TEF-1 (8 ul of the 0.3 M fraction from a nonspecific DNA-cellulose column; see Davidson et al., 1988) was preincubated with either 2 pl or 4 ~1 of antisera (anti-Pl, anti-P2, or anti-P3) or corresponding preimmune sera (Cl-C3), as indicated above each lane. The 32P-labeled oligonucleotide templates indicated at the bottom of the figure were subsequently added to the reaction mixture. On the left side of the gel is indicated the position of the antibody-associated TEF-l-DNA complex, and A, B, F, and NS are as in (A). (D) Gel retardation analysis of the effect of the peptide-specific antisera on the binding of the endogenous HeLa cell TEF-1 in the Sph enhansons. The nomenclature is as in (A) and (C).

AUG(586) (ml) did not affect the translation pattern, indicating that, even in the presence of a strong downstream initiator, the AUU in its original context remained functionally dominant. Note that the 51 kd band is in fact a doublet most likely generated by initiation at AUG(588) and AUG(595) (see Figures 3 and 6B), as mutation of AUG(586) (m4 in Figure 6D) dramatically reduced only the major upper species. To exclude the possibility that these results were artifacts of cell-free translation (Kozak, 1989a, 1989b, 1990a), the affinity-purified HeLa cell TEF-1 protein was analyzed on Western blots using the Pl and P2 antisera (Figure 3). Both antisera reacted specifically with asingle polypeptide of 53 kd, while the corresponding preimmune sera(C1 and C2) gave no signal (Figure 6E). The endogenous HeLa TEF-1 had the same electrophoretic mobility as the 53 kd protein synthesized in vitro (compare Figure 6E, Zt-l(wt) in lane 2 with lanes 4 and 6) indicating that only codon AUU(541) was used efficiently as a translation initiator in vivo. This result was further confirmed in Western analysis of nuclear extracts from HeLa cells transfected with the pSG5-TEF-l(wt) expression plasmid (Figure 6F). Again, a single 53 kd polypeptide was detected by both antisera, and the specificity was demonstrated by competition with an excess of the corresponding peptide. TocomparetheefficiencyoftheTEF-1 AUU initiatorwith that of a perfect Kozak consensus in the same context, Western blot analysis was carried out using extracts from cells transfected with the HCMV expression vectors pXJ40-TEF-1 (wt) and pXJ40-TEF-1 A (containing the natural AUU or the AUG-containing Kozak consensus, respectively; see Figures 78 and 6G). Equivalent amounts of TEF-1 protein were detected by the Pl antiserum in both extracts (Figure 6G), indicating that the AUU in its natural context functions as efficiently as a Kozak consensus. The fact that the anti-P1 antiserum, directed against the first 11 amino acids between AUU(541) and AUG(586), recognizes the in vivo 53 kd polypeptide excludes the possibility that translation initiated in vivo at AUG(586) could generate a 51 kd product that would be subsequently modified to migrate as a 53 kd species. We conclude that translation of both the endogenous and cloned TEF-1 ORFs is initiated in vivo at an AUU rather than at an AUG codon.

Expression of TEF-1 in Lymphoid B Cells Does Not Activate the GT-IIC or Sph Enhansons, but Represses the Activity of the Overlapping SV40 Octamer Enhanson We and others have previously shown that oligomers of the GT-IIC or Sph enhansons activated transcription from the rabbit @globin gene promoter in nonlymphoid cells, such as HeLa and both nondifferentiated and differentiated F9 cells, but not in MPCll lymphoid B cells (Ondek et al., 1987, 1988; Schirm et al, 1987; Fromental et al., 1988). Therefore, the MPCll cell line was used to assay the transcription activation properties of the TEF-1 protein in a transient transfection assay. MPCll cells were transfected with 2 pg of reporters PGTIIC and Sph(ll+l)+OctM (see Fromental et al., 1988; Figure 7A), along with

Cloning 557

of Transcriptional

T3iT7

8

@

wt

A”” EcoRl 1

%A

AAT

Enhancer

Factor

AUG

1

UGA BarnHI I

Ndel

CCC ACC GCC AAA

m

GA?

m2

GAA AAT CCC ACC GCC AAA GAG CTC GAG

m3

GAG>

CCC ACC GCC ACCI

m

ml

m4

‘p? NN

568 GAG AGC CCT GCC GAA AAC

(kD)

M

pSG5 ’ TEF-1

zt-1 -II sEFzrE!nr

-2oo-

GAG

Kozak

wt

Temptate

ECORI ! PBlYesErlPtSK-

j,

-97.4-e

..

600 GAA AGG ATG AGT

@J GAG GAA TTC GCC GCC ACC m GAA AGG ATG AGT Kozak GAG AGC CCT GCC GAA AAC GAG CTC G&A AGG ATG AGT

‘:I*. *i*. ”

0

532

544 GCC AAA

IAUO] G_

s

gA

p&

Figure

Con.eensuS

_G (10/13)

m

G

6. Transcription/Translation

1c,

(9/13)

569

577

Kozak

-2g-

ACC ---

.I. ..

*c

GCC GCCPuCC

of the TEF-1

ORF In Vitro

(A) The structure of the CDNA-containing plasmid pElluescript used for in vitro transcription by T7 or T3 polymerase is shown schematically. The solid line flanked by two vertical bars (indicating the EcoRl sites) represents the cDNA insert. The TEF-1 ORF is represented by the filled box. The positions of the T7 and T3 promoters, the potential initiator AUU and AUG codons, the stop codon UGA, and the restriction sites that were used to linearize the templates are indicated. (B) Mutagenesis of the potential translation initiator codons. “wt” are the nucleotide sequences of the wild-type TEF-I cDNA on the coding 53kD strand, and the numbers above the sequences their coordinates as in 4 Figure 3. The mutations (ml-m4) introduced into the wild-type cDNA 51kcwI Zt-1 (Zt-l(wt)) by site-directed mutagenesis are underlined. The potential initiator codons AUU and AUG are boxed. The created Kozak p, --+ m-m- + consensus sequences are also underlined. 1 2 34567 p-2-m-+-e+(C) Comparison of the TEF-1 AUU and AUG initiators with the Kozak Competitors consensus sequence. The sequences of TEF-1 cDNA segments from nucleotides 532 to 544 and from 577 to 569 are shown above the Kozak consensus sequence. The potential translation initiator codons are boxed. The nucleotides fitting with the Kozak consensus sequence are underlined and the degree of homology for each sequence is indicated on the right. .m--53kD (D) In vitro transcription/translation of TEF-1 ORF. TEF-1 RNA synthe43-41 sized using T7 or T3 polymerase was translated in vitro with rabbit reticulocyte lysate and 4 ul of the translation products was analyzed on a denaturing SDS-polyacrylamide gel. The templates used are shown above each lane. The positions of the major 51 and 53 kd products are indicated on the left. M refers to the size markers whose molecular sizes (in kd) are indicated. The mutant templates derived from Zt-i(wt) are as described in (B), while the pSG5 derivatives are described in Figure 76. (E) Western blot analysis of the cloned or endogenous TEF-1 proteins using peptide antisera. The endogenous HeLa TEF-1 corresponds to the 53 kd species initiated at the AUU codon. Lanes 1 and 7 contain molecular size markers. Lane 2 contains 4 ul of the %-labeled in vitro translation products derived from Zt-l(wt). Lanes 3-6 contain 40 ul fractions from the first passage on the specific DNA-Sepharose affinity column containing the endogenous HeLa cell TEF-1 (Davidson et al., 1966). The proteins in lanes 3-6 were transferred to nitrocellulose and incubated with the preimmune (Cl, C2) or P-l or P-2 antisera as indicated above each lane. The locations of the 51 and 53 kd species are indicated on the left, and those of the molecular size markers on the right. (F) Translation of the TEF-1 protein encoded by the cDNA Zt-l(wt) is initiated at the AUUcodon in vivo. The nomenclature is as in (A). Each lane contains 60 pg of a nuclear extract prepared from HeLa cells transfected with pSGC-TEF-l(wt). The antisera used are shown above each lane. The presence (+) and absence (-) of 1 ug of the competitor peptides (PI and P2) during preincubation with the diluted antisera are indicated below each lane. The size of the revealed TEF-1 protein is indicated on the right-hand side. (G) Comparison of the efficiency of the TEF-1 AUU and Kozak consensus AUG initiators. Each lane contains 60 ug of total extract from cells transfected with 10 Kg of the parental vector pXJ40, or expression vectors containing the natural AUU (TEF-l(wt)), or a perfect Kozak consensus sequence at the same position (TEF-IA). The translation products were revealed using the PI antiserum. M, molecular size markers.

1

10 ng-1 pg of pXJ40-TEF-1A expression vector. Sl nuclease mapping of cytoplasmic RNA from these cells indicated that the GT-IIC and Sph enhanson reporters were inactive (GLOB+1 signal), irrespective of the presence of TEF-1A expression vector (compare lane 2 with lanes 3-6 or compare lane 7 with lanes 8-11 in Figure 8A). No effect was observed by adding up to 8 pg of TEF-1A

vector (data not shown). However, the signal from the reporter plasmid pGlB containing the total SV40 enhancer could be readily detected (Figure 8A, lane 19). The same result was obtained using the reporter Sph+TATA-GLOB in which tetramerized Sph enhansons were placed directly upstream of the P-globin gene TATA box at position -41 (Figure 8A, lanes 13-18).

Cell 558

Figure 7. Structure of Reporter and Activator Plasmids Used for Quantitative Sl Nuclease Analysis and CAT Assays Following Calcium Phosphate-Mediated Transfection (A) Structure of the rabbit b-globin, tk-CAT. and AdMLP reporter plasmids. The P-globin promoter region to -109 in pG1 (see Fromental et al., 1988) is shown by the open box. To the left of this box are shown the tetramerized oligonucleotides (arrows), and the name of each recombinant is shown on the right. +l is the cap site of the P-globin mRNA. TATA is the B-globin TATA region up to -47. SV40 ENH is the SV40 enhancer fragment in pG1B. The sequences of the oligonucleotides used in each case are identical to those described in Fromental et al. (1988). In the tk-CATseriesCATisthechloramphenicol acetyltransferase coding sequence, and tk the herpes simplex virus thymidine kinase promoter from -105 to +51. +I is the tk mRNA start site. For UASG, see Webster et al. (1990). In the AdMLP series the tetramers or pentamers (17-mer) were introduced at -65 upstreamofthe AdMLPfrom positions -33 to+33 fused to the 8-globin gene (pAL10 in Ponglikitmongkol et al., 1990). Cl is the natural AdMLP mRNA start site. (B) Activator plasmids expressing TEF-1 derivatives. The TEF-1 ORF is indicated by the hatched box, and the GAL4(1-148) ORF by the filled box. In all cases numbers below each box show the amino acids at the N- and C-termini of each ORF. pSG5-TEF-l(wt) encodes the total TEF-1 ORF initiated at the natural AUU, while in pSG5-TEF-IB translation begins at a Kozak consensus sequence introduced at AUG(586). In pSG5, PSV40 is the SV40 early promoter region and SV40(A)n the SV40-derived polyadenylation signal (Green et al., 1988). PHCMV in pXJ40 is the human cytomegalovirus immediate early promoter from -522 to +97 (Boshart et al., 1985). In each case the arrows indicate the positions of the mRNA start sites. In PXJ40-TEF-l A, the natural AUU initiator has been replaced by a perfect Kozak consensus sequence.

To verify that the TEF-1 protein was synthesized in MPCl 1 cells and was capable of binding its cognate enhansons in vivo, MPCll cells were transfected with the Sph(ll+l)+Oct reporter in which the globin gene promoter is activated by the lymphoid-specific SV40 octamer enhanson, overlapping the Sph-I and Sph-II enhansons (see Figures 1 A, 1 B, and 78; Fromental et al., 1988). The activity of the octamer enhanson in the Sph(ll+l)+Oct construct was reduced progressively by contransfection of increasing amounts of the TEF-1A expression vector (see lanes 2-6 in Figure 8B), while the activity of the octamer enhanson in the Sph(ll+l)M+Oct reporter, in which the Sph enhansons are selectively mutated and which does not bind TEF-1 in vitro (see above and Davidson et al., 1988), was not significantly affected (see lanes 9-13 in Figure 88). These results indicate that TEF-1 synthesized in MPCll cells binds specifically to its cognate Sph enhansons, displacing the octamer transcription factors, but cannot activate transcription. Transcriptional Interference/Squelching by Expression of TEF-1 in HeLa Cells The above results suggest that transcriptional activation by TEF-1 might require an additional factor, which would be absent from lymphoid B cells. To test this possibility, we performed the transfection experiments in HeLa cells in which the GT-IIC and Sph enhansons are active. The activity of the 2GTIIC reporter was strongly repressed (Figure 8C, lanes 8-12), even when as little as 25 ng (lane

10) of the TEF-1A expression vector was cotransfected, whereas the parental vector pXJ40 had no effect (lanes 3-7; see also Figure 8D). A similar result was obtained with the Sph enhanson reporters (lanes 18-21 in Figure 8C). When 100 ng of TEF-1A was cotransfected, less than 5% of the initial activity was observed for both enhansons (see Figure 8D). However, 5-10 times more TEF-1A was necessary to repress, to the same extent, either the total SV40 enhancer (pG1 B; Figure 7A) or the tetramerized protoenhancer GTIIC+GTI (Figure 8D), whose activity depends on the functional synergy of the GT-IIC and GT-I enhansons (see Fromental et al., 1988; Figure 8D). In contrast to the above enhancers, with TEF-1 binding sites, the activity of the tetramerized TC-II enhanson from SV40 (see Kanno et al., 1989; Figures 1A and 7A) was not significantly affected by cotransfection of TEF-1A in MPCl 1 cells (Figure 8B, lanes 19-21). Similarly, no reduction in the activity of the SV40 octamer enhanson was observed in MPCll cells when the Sph enhansons of the reporter were mutated (see above; Figure 88). A small (2-fold) reduction of the TC-II enhanson activity was reproducibly observed in HeLa cells with 50 ng of TEF-1 A; however, no further reduction in activity was observed with 250 ng of TEF-1A (Figure 8D). Note also that no repression of the pA56 enhancerless SV40 internal control promoter was observed. These observations indicated that the represssion by TEF-1 was not due to a general transcriptional “interference” (Meyer et al., 1989) or “squelching” (Gill and

@

WC11 CELLS TEF-IA

I

ACTIVATOR

I

lng)

I I

o”oao”p$8g ‘“08

O-“a$o, NP

GLoB+l-

r*e 1 2

-REPORTER pG1

3 4

5

6

7 6 B 10 11 12 13 14 15 16 17 16 19 -u-m SphOl+l)+CctM ,6;A&Sph-PTATA-GLCS pGlS

0

WC11 CELLS 1

I ACTtVATOR (ng)

TEF-IA Io-gg’X=

pXJ40 1

TEF-1A

-p-o

‘Z

pXJ40 TEF-1A -II 0000000 - “UJ -k-Jg

GLOS+l1 2 3 4 5 6 7 6 B 10 11 12 13, ,14,)6 16 17 16 IS 2021, u-1 TCllWt SphlH+ll+Cct Sphtll*I)M+Oct Pal REFORTER pG1

0

, 1 2 3 4 5,,6 REPORTER PSLCAT6+

0

IieLa CELLS

7 6 B 10 11 12 13 14 15 16 17 16 10 2021 22, 2GTKXRMkCAT

Helll CEUS

I

ACTIVATOR ’ hlg)

ACTIVATCR

EES --ee,....~~~--m--(~A561 C

..--IIIL--

*-

GLCS*t1 2 I REPORTER p%

3

4

5

6

7

6

ZGTIIC

?V

B IO 1112 ~1415161716192021 pG1 ?,phW+ll+OtiM

,I REPORTER

Figure GT-IIC

1

8. Overexpression and Sph Enhansons

of TEF-1

Represses

the

Activity

of the

2

34

5 6 7 6 910111213141516, UASG-tk-CAT

WC11 CEUS 1 Mouse MPC11 lymphoid B cells (A and B) or HeLa cell6 (C) were contransfected with 2 ug of the reporter plasmids shown below each ACTIVATCR lane and the indicated amount of activator plasmid shown above each lane, together with the enhancerless SV40 early promoter pA58 as an internal control. GLOB+1 shows the 8globin mRNA start site in each reporter and EES and early-early start sites of the internal control (see Zenke et al., 1986; Fromental et al., 1988). pA56 was transfected in HeLa (10 pg) and MPCI 1 cells (2 ug). The amount of mRNA initiated at the EES and GLOB+1 start site6 was determined by Sl nuclease mapping as previously described (Zenke et al., 1988; Fromental et al., L1 2 3 4 6 6 7 6 B 10 11 12 13 14 I5 16 17 1988). UASG-tk-CAT REPORTER (A) The effect of TEF-1 on the activity of the GT-IIC and Sph enhansons in MPCll cells. (B) Lanes 1-14 show the binding site-dependent repression of the octamer enhanson in MPCI 1 cells. After correction for the internal control signal (Fromental et al., 1988) the average values (from three experiment6 f 10%) were as follows: lanes 3-8 (relative to Sph(ll+l)+Dct taken as 109% in lane 2) 127%. 102%, 48%, 14%, lOl%, and 95%; lanes 10-13 (relative to Sph(ll+l)m+Cct) taken as 100% in lane 9) lOO%, 114%. 98%, 109%, and 73%. Lanes 15-21 show the effect of TEF-1 expression on the activity of the TC-II enhanson. After correction the average values were as follows (relative to TC-ll(wt) taken as 100% in lane 15): lanes 18-21, 93%, 99%, 83%. 102%, and 100%. (C) The repression of GT-IIC and Sph enhanson activity in HeLa cells. The repression in each case is shown graphically in (D) where the values (an average of three independent experiments, f 10%) were determined as described above following a further correction relative to the values obtained by transfecting an equivalent amount of the parental vector pXJ40. (D) Graph showing the repression of the various enhancers in HeLa cells by cotransfection of the TEF-IA activator construct. The numerical values on the upper right-hand side show the relative activity for each enhanson in the absence of TEF-IA, where the SV40 enhancer in pG1 B is taken a6 100% (see also Fromental et al., 1988; Kanno et al., 1989). In the graph the values given are relative to those of each enhanson in the absence of TEF-1 (taken as 100% in each case) compared with those determined after cotransfection of the amount of TEF-IA (in nanograms) shown on the x-axis. (E) Activation and repression of UASG activity in HeLa cells by GAL4-TEF-1 chimeras. HeLa cells were cotransfected with 1 pg of the reporter plasmid indicated below the lanes and the indicated amount of the activator plasmid indicated above each lane, together with 1 pg of the internal control plasmid pXJ40-IacZ. After correction for the 5galactosidase activity, a quantitation of ‘*C-labeled acetylated chloramphenicol (an average from three independent experiments, f 10%) resulted in the following relative CAT activities from lanes l-22, 1, 0.9,0.8,0.8, 0.3, 38, 37.38. 33, 31, 32, 22, 3.5, 0.2, 37, 41, 44, 5, 28, 18, 3, 0.2. (F) Activation of UASG in HeLa cells. HeLa cells were cotransfected with 2 ug in of the GAL4responsive reporter plasmid UA&tk-CAT, and the indicated amount of the activator plasmids shown above each lane, together with 1 pg of the internal control plasmid pXJ40-IacZ. The relative CAT activity (an average of three independent experiments) is as follows: lanes I-16, I, 0.9, 0.8, 0.9, 0.5, 3, 13, 20, 0.9. 1.6, 3. 2, 0.1, 3, 9, 67. (G) An analogous experiment performed in MPCl 1 cells. As no significant stimulation was observed using the GAL4-TEF-1 chimeras, the numerical values were not determined.

Cell 560

Ptashne, 1988) effect (at least at these concentrations of activator plasmid), since it was restricted to enhancers requiring TEF-1. The repression brought about by overexpression of TEF-1 could thus reflect a specific interference/squelching effect involving a competition between the pool of freeTEF-1 derived from both the overexpressed and endogenous TEF-1 and the TEF-1 -DNA transcription complex, for a very limiting cofactor(s) that is absolutely required for the TEF-1 transcription activation function. To test this possibility, the C-terminal portion of TEF-1 from residues 167-426, lacking the DNA-binding domain, was fused to the DNA-binding domain of the yeast transcription activator GAL4 (Johnston and Dover, 1987) (GAL4(1-148)-TEF-1(167-426) in Figure 7B), and the resulting GAL4 derivative was expressed under the control of the HCMV enhancer and promoter. A reporter was constructed (2GTIIC(R)-tk-CAT) in which CAT gene expression was under the control of the tetramerized GT-IIC protoenhancer upstream of the HSV tk gene promoter at position -105 (Figure 7A). This GT-IIC protoenhancer stimulated CAT activity 36-fold following transfection in HeLa cells (Figure 8E, lane 6) compared with the enhancerless construct pBLCAT8+ (lane 1). When HeLa cells were cotransfected with this reporter and increasing amounts of either the TEF-1 (wt) or TEF-1A activators (Figure 78) a strong represssion analogous to that seen with the 6-globin promoter constructs was observed (Figure 8E, lanes 13 and 21). This observation indicated that repression was independent of the promoter present in the reporter. Interestingly, cotransfection of 250 ng of GAL4(1-148)-TEF-1(167-426) reduced the activity of the 2GTIIC(R)-tk-CAT reporter by 7-fold (lane 18) whereas GAL4(1-148) had no effect (lane lo), indicating that the C-terminal portion of TEF-1 was involved to some extent in the represssion. All of these data strongly suggest that the transcription repression effect of overexpressed TEF-1 corresponds to a selective interference/squelching phenomenon that does not require the sequence-specific DNA binding of TEF-1. The C-Terminal Portion of TEF-1 Contains a Cell-Specific Activation Domain(s) The above results indicate that the C-terminal portion of TEF-1 contains a domain(s) capable of “squelching” the activity of the GT-IIC or Sph enhansons. As interference/ squelching effects are normally intrinsic properties of activation domains themselves, the activation function of TEF-1 was investigated under conditions in which no signal could be given by the endogenous TEF-1. HeLa cells were transfected with 1 wg of the reporter UASG-tk-CAT containing the GAL4-responsive UASG (Figure 7A; see Webster et al., 1988) and l-250 ng of GAL4-TEF-1 chimeras. A maximum stimulation (20-fold) of CAT activity was observed using 25’ ng of GAL4(1-148)-TEF-1(167-426) activator (Figure 8F, compare lane 8 with lane l), while the DNA-binding domain of GAL4 alone had no effect (lanes 2-5). Furthermore, repression wasobserved by increasing the amount of activator to 250 ng. In contrast, no repression was observed using the wild-type GAL4 protein (Figures 78 and 8F, lanes 14-l 6). A weaker stimulation was

also observed when the complete TEF-1 ORF was fused to the GAL4 DNA-binding domain (GAL4(1-148)-TEF-1(2426); Figure 76) (maximum stimulation of 3-fold with 5 ng, lane 11) while self-repression was observed with as little as 25 ng. In contrast, no activation could be observed in MPCl 1 cells, using the GAL4-TEF-1 expression vectors, while the wild-type GAL4 activator efficiently stimulated transcription in these cells (Figure 8G). These results indicate that the C-terminal portion of the cloned TEF-1 protein does indeed contain an activation domain, which functions in a cell type-specific manner, possibly due to the presence or absence of a cofactor that appears to be severely limiting even in HeLa cells where TEF-1 is normally active. Trans-Activation and interference/Squelching in HeLa Cell Extracts In Vitro To study the ability of TEF-1 to modulate transcription in vitro from reporters containing the adenovirus-2 major late promoter (AdMLP) under the control of the GT-IIC enhanson (Figure 7A), the TEF-1 ORF was overexpressed in recombinant vacciniavirus and thevTEF-1 protein purified by DNA affinity chromatography (data not shown). The presence of a tetramer of a single GT-IIC enhanson (GTIIC-MLP) or of a tandemly repeated GT-IIC enhanson (PGTIIC-MLP) stimulated transcription in a HeLa wholecell extract from the AdMLP 2.5- and 4.5-fold, respectively, compared with a reporter containing a mutated GT-IIC oligomer (GTIICm-MLP) (compare lanes 1,2,6, and 7 with lanes 11 and 12 in Figure 9A). The addition of the purified vTEF-1 resulted in a repression of the 2GTIICMLP template to a level comparable to the GTIICm-MLP template, while vTEF-1 had no significant effect on the basal transcription from the GTIICm-MLP template or the pA56 internal control (see corresponding lanes in Figure 9A). Addition of vTEF-1 resulted in a small (2-fold) stimulation of the GTIIC-MLP template followed by a repression to basal level. Moreover, the transcription from the 2GTIICMLP template was also repressed (9fold) by addition of GAL4(1-148)-TEF-1(167-426) purified from E. coli by affinity chromatography, while no significant effect was observed on the pA56 internal control (see Figure 9C). Thus, as observed in vivo, the presence of the GT-IIC enhansons leads to a stimulation of transcription that can be repressed by either the intact TEF-1 or its C-terminal (167426) domain, showing that repression does not require the site-specific binding of TEF-1. These in vitro results thus strongly support the hypothesis that both total TEF-1 and the GAL4-TEF-1 chimera titrate a protein(s) necessary for the stimulatory activity of the GT-IIC enhansons. Addition of 50 ng of the GAL4-TEF-1 chimera to a template containing an oligomer of the 17 bp GALCbinding site upstream of the AdMLP (17M(5)-MLP; see Figure 7A) resulted in a strong (lo-fold) stimulation of transcription, while higher concentrations resulted in a repression of transcription (see Figures 9B and 9D). No stimulation of the pA56 internal control was observed, nor was transcription stimulated from a reporter containing a single GAL4binding site (data not shown). Thus the activation domain in TEF-1(167-426) is active both in vivo and in vitro. Inter-

C&ning

of Transcriptional

Enhancer

@

Factor

1

@

Template I

vTEF-1 (w)

0

Template

I

Template

C

1 Figure

@

Template

GTIIC-MLP PGTIIC-MLP GTIICm-MLP -IIn 51 8 8 0 0 % 8 8 o o 0 0 -cU 704 $ 8N

2

9. TEF-1

3

4

5 6 7 8 91011

Modulates

Transcription

121314

1234

5

[-

123458

. ..e-

1234

567

In Vitro

(A) TEF-1 represses the activity of the GT-IIC enhanson in vitro. Each lane contains 50 ng of the DNA template indicated above each lane and 25 ng of the pA56 internal control (enhancerless SV40 early promoter; see Zenke et al., 1986). The quantity of purified exogenous vaccinia virus expressed, vTEF-1, is indicated above each lane. The position of the correctly initiated transcripts from the AdMLP (AdMLP+l) is indicated along with that of the transcripts from pA58 (internal control). Densitometric scanning of appropriately exposed autoradiograms from two independent experiments showed that the tetramer of the GT-IIC enhanson dimer (LGTIIC-MLP) stimulated transcription ~4.5 times, and the tetramer of the GTIIC enhanson monomer (GTIIC-MLP) ~2.5 times compared with the mutated GTIICm-MLP template. Note that in lane 5 correction of the AdMLP signal relative to the internal control gives a value similar to that of the basal level in lanes 11 and 12. (6) Activation and squelching of transcription by the GAL4-TEF-1 chimeric protein. The nomenclature is the same as in (A). Each lane contains 25 ng of both the 17M(5>MLP and pA56 templates. Densitometric scanning indicates that the addition of 50 ng of GAL4(1-148)-TEF-l(167-426) (bGAL4-TEF-1) gives a greater than lo-fold stimulation of transcription. (C) The GT-IIC enhanson activity can be squelched by bGAL4-TEF-1. The nomenclature is the same as in (A). Each lane contains 50 ng of the PGTIIC-MLP reporter along with the exogenous bGAL4-TEF-1 indicated above each lane. The addition of 400 ng of bGAL4-TEF-1 results in a &fold repression of transcription from the PGTIIC-MLP template. (0) TEF-1 can interfere with tram+activation by bGAL4-TEF-1. The nomenclature is the same as above. Each lane contains 50 ng of the 17M(5)-MLP template and 25 ng of the internal control. At this template concentration, 50 ng of bGAL4-TEF-1 results in a lO-fold stimulation of transcription. The quantity of exogenous bGAL4-TEF-1 and vTEF-1 added is indicated above each lane.

the activation of 17M(5)-MLP by the GAL4-TEF-1 chimera can be inhibited by addition of vTEF-1 (Figure 9D, lanes 5-7) indicating that intact TEF-1 can titrate a factor(s) necessary for the function of the TEF-1(167-426) C-terminal activation domain and also that repression of 17M(5)-MLP does not require site-specific binding to the GAL4 sites.

estingly,

Discussion Features of the TEF-1 Protein and RNA We have isolated and characterized human cDNA clones encoding a protein that specifically and cooperatively binds the SV40 Sph and GT-IIC enhansons. Several lines of evidence indicate that the protein encoded by these cDNAs corresponds to TEF-1 (protein activity GT-IIC in Xiao et al., 1967a), which we have previously identified and purified from HeLa cells (Davidson et al., 1968). The predicted amino acid sequence of the cloned ORF contains four independent peptide sequences present in the affinity-purified HeLa cell TEF-1. In addition, antisera against peptides derived from the cDNA sequence recognize the affinity-purified HeLa cell protein in Western blots and can “shift” the DNA-protein complexes formed between the endogenous TEF-1 and the GT-IIC or Sph enhansons in a gel retardation assay. Moreover, the apparent molecular size of the protein product of the ORF contained in the cDNA, synthesized either in vitro or in

vivo, is identical to that of the affinity-purified TEF-1 protein. Taken together, these results indicate that the cloned cDNA encodes the bonafide human TEF-1 protein. Several observations indicate that the TEF-1 DNAbinding domain is located in the basic N-terminal region between Pro-26 and Ala-98. First, the cDNA insert in clone J-l contained only the first 110 amino acids, but nevertheless bound specifically the Sph and GT-IIC enhansons. Second, DNA binding is not inhibited by the antisera Pl, P2, and P3, which are directed against amino acids l-l 1, 16-25, and 99-l 11, respectively. Analysis of the amino acid sequence of this putative DNA-binding domain reveals no similarity with other well-defined DNA-binding or dimerization motifs such as homeoboxes/POU domains, leucine zippers, helix-loop-helix motifs, and HMG-related motifs (Jantzen et al., 1990; for review see Mitchell and Tjian, 1989; Johnson and McKnight, 1989; Jones, 1990; and references therein; see also Murre et al., 1989). Moreover, secondary structure predictions for this domain failed to reveal the existence of any readily identifiable structure (data not shown). The elucidation of the structure of this domain and how it interacts specifically with two different DNA sequences require further studies. The C-terminus of the TEF-1 ORF contains a 2 cysteines-2 histidines (C2H2) zinc finger-like motif (reviewed by Klug and Rhodes, 1987; Evans and Hollenberg, 1988; Payre and Vincent, 1988; and references therein) with the potential to form an a-helical structure. The in vitro studies,

Cdl 562

however, show that this putative metal-binding motif is not involved in DNA binding. It is noteworthy that a truncated protein consisting of amino acids 1-167 (lacking this C2H2 motif) synthesized in E. coli appears to bind noncooperatively to tandem repeats of the GT-IIC enhansons (data not shown). Thus, this zinc finger-like structure may be involved in the cooperative formation of dimers as in the TAT protein of HIV (Frankel et al., 1988). Alternatively, such a structure may be involved in the interaction of TEF-1 with other cellular proteins involved in transcription activation, as has been proposed in the case of the adenovirus ElA protein (Culp et al., 1988; Pusztai et al., 1989; Martin et al., 1990, and references therein) and the papilloma virus E6 oncoprotein (Lamberti et al., 1990). The predominantTEF-1 mRNA is 12 kb long, but 2.4-3.5 kb species are also present in HeLa cells. These shorter species may be generated by the inefficient use of weak polyadenylation signals such as 5’-AUUAAA-3’ (position 2514) and 5’-AGUAAA-3’ (positions 2263,2757, and 2885; see also Wickens, 1990; Mattaj, 1990). The initiator codon is preceded by a long (600 bases) 5’~UTR, and the ORF is followed by an exceptionally long B’UTR containing several putative mRNA destabilization signals (5’-AUUUA-3’) (Cosman, 1987; Malter, 1989, and references therein), suggesting that regulation of TEF-1 activity may be controlled posttranscriptionally. The alternatively spliced 5’-UTR is GC rich but does not appear to contain multiple short ORFs that are known to control translation efficiency (Clemens, 1989; Kozak, 1989a, 1989c; Horiuchi et al., 1990; Hinnebusch, 1990). Nevertheless, computer-aided predictions of the TEF-1 5’UTR secondary structure show that this region has the potential to form a complex, stable secondary structure. AUU, a New Initiator Codon A striking feature of the TEF-1 ORF is that initiation of translation takes place at an AUU codon rather than at an AUG codon. Several observations support this conclusion. The endogenous affinity-purified 53 kd HeLa cell TEF-1 protein and the 53 kd protein synthesized in vivo from an expression vector, containing the AUU and AUG codons in their natural context, are both recognized by the Pl antiserum. Invivo, translation appearsto begin exclusively at the AUU codon, since the shorter 51 kd protein initiated at the downstream AUG could not be detected using the P2 antiserum. That translation begins at the AUU codon is also indicated by the observation that the endogenous HeLa cell TEF-1 protein has an electrophoretic mobility identical to that of the 53 kd species whose synthesis in vitro is prevented by mutation of the AUU codon. It has been previously shown that translation can be initiated in vivo at CUG codons in the case of c-myc (Hann et al., 1988) lnt-2 (Acland et al., 1990) and human basic fibroblast growth factor (Florkiewicz and Sommer, 1989; Prats et al., 1989) while use of the ACG codon was observed in the case of the Sendai virus P/C mRNA (Curran and Kolakofsky, 1988; Gupta and Patwardhan, 1988) phosphoribosylpyrophosphate synthetase (Taira et al., 1990) and Krox-24 (Lemaire et al., 1990; reviewed in Herman, 1989; Mehdi et al., 1990). However, in all cases, the

species initiated at a non-AUG codon was minor compared with that initiated at the downstream AUG. In contrast, translation of the Itk receptor tyrosine kinase mRNA appears to begin exclusively at a CUG codon (Bernards and M. de la Monte, 1990). TEF-1 is the first example of the efficient and exclusive use of an AUU codon in vivo. Efficient use of an AUU codon (67% of the native AUG) has been observed in vitro (Peabody, 1989) but in this case AUU was almost inactive as a translation initiator in vivo, even within the context of an otherwise perfect Kozak consensus sequence (Kozak, 1989b). In TEF-1 the AUU is not present within a perfect Kozak consensus sequence. Two short palindromes (see Figure 3) with the potential to form a stem-loop structure exist immediately downstream of the AUU, and such structures have been shown to enhance strongly the use of AUG or non-AUG (GUG) initiators (Kozak, 1990b). However, in the case of TEF-1 these structures do not appear to play an important role in the efficient use of the AUU, since initiation at the AUU is unaffected by mutation ml, which mutates the larger of those palindromes (see Figures 3 and 6C). It is likely that other as yet unknown structural features of the TEF-1 mRNA promote the use of the AUU. Evidence That a Limiting Transcriptional Intermediary Factor Is Required for TEF-1 Activity The GT-IIC and Sph enhansons are inactive in MPCll lymphoid cells, and no TEF-1 DNA-binding activity could be detected in those cells (Ondek et al., 1987, 1988; Xiao et al., 1987a; Fromental et al., 1988). We show here that this lack of TEF-1 activity correlates with the absence of TEF-1 mRNA in MPCl 1 cells. Thus, transfection of reporters containing either the GT-IIC or Sph enhansons, along with vectors expressing the TEF-1 ORF, should have allowed us to detect trans-activation by TEF-1 in MPCll cells. No rrans-activation was observed, even though TEF-1 was synthesized and could repress, in a binding site-dependent manner, the activity of the octamer motif overlapping the Sph motifs. However, the C-terminal portion of TEF-1 contains an activation domain that is functional in HeLa cells and in HeLa whole-cell extract, but not in MPCl 1 cells, while the intact GAL4 “acidic” activator functions in both HeLa and MPCll cells. These results suggest that trans-activation by TEF-1 may require a cellspecific TIF lacking in MPCl 1 cells. This possibility is supported by transcriptional interference/squelching observations both in vivo and in vitro, which indicate that this TIF may be present in limiting amounts in HeLa cells. Expression of the cloned TEF-1 in HeLa cells resulted in a dramatic reduction in expression from the GT-IIC or Sph enhanson reporters. This effect did not correspond to a general repression of transcription, as the activity of the TC-II enhanson driven by the TC-IIA (NF-KB-like) or TC-IIB (KBFl, H2TFl-like) factor (Baldwin and Sharp, 1987, 1988; Yano et al., 1987; Macchi et al., 1989; Kanno et al., 1989) was not inhibited, nor was the activity of the enhancerless SV40 early promoter (pA56 internal control) (Figure 8). Similarly, addition of intact TEF-1 to whole-cell

&3ning

of Transcriptional

Enhancer

Factor

1

extracts in vitro repressed the 4- to 5-fold stimulation of transcription brought about by the GT-IIC enhanson oligomers (Figure 9). That this represssion may result from a “self-interference” effect (Bocquel et al., 1989; Meyer et al., 1989), caused by competition between the endogenous and overexpressed TEF-1 for a limiting factor required for mediating TEF-1 activity, is strongly suggested by the observation that the activity of the GT-IIC and Sph enhansons can be inhibited by expression of the C-terminal activation domain of TEF-1 fused to the GAL4 DNA-binding domain both in vivo and in vitro. Clearly, represssion does not require the site-specific DNA-binding domain of TEF-1. Self-interference was also observed when the GAL4TEF-1 chimeras activated expression in vivo and in vitro from reporter plasmids containing GAL4-binding sites (Figures 8 and 9). Moreover, the in vitro activation function of the TEF-1 C-terminal domain can be repressed by the intact TEF-1 molecule, showing that fusion to the GAL4 DNA-binding domain has not revealed a cryptic activation domain, but that the intact TEF-1 can interact with a factor(s) responsible for transcriptional activation. Repression by the total TEF-1 molecule in vivo was more efficient than by the C-terminal activation domain, suggesting that there may be another activation domain(s) located between amino acids 1 and 188. This suggestion is supported by the observation that self-interference is more efficient with GAL4(1-148)-TEF-1(2-428) than with GAL4(1-148)-TEF-1(187-426), while comparable amounts of protein were synthesized in each case (data not shown). Transcriptional interference/squelching has been previously observed (Gill and Ptashne, 1988; Ptashne, 1988; Treizenberg et al., 1988; Meyer et al., 1989; Martin et al., 1990; Tasset et al., 1990; Ptashne and Gann, 1990, and references therein) and ascribed to the requirement for limiting TIFs. Recent in vitro biochemical experiments provide evidence supporting the existence of such TlFs (or adaptors) (Pugh and Tjian, 1990; Berger et al., 1990; Kelleher et al., 1990; this study). Reconstitution of all of these phenomena in vitro will be required to understand the molecular interactions that are operating. Experimental

Procedures

Screening of the HeLa lgtll cDNA Expression Library The HeLa lgtll cDNA expression library (a gift from Dr. S. Green; see also Zheng et al., 1990) was screened with the PP-labeled oiigonucleotide duplexes OGTZ-56 and OSph-0 according to Singh et al. (1966) with the modifications of Vinson et al. (1988). The cDNA insert in the kgtll cDNA clone J-l was subcloned into the Ml3 vector mpl8, prior to DNA sequencing. Preparetlon of the P-Galactosldase cDNA Fualon Proteins from Lysogens Lysogens were prepared by infection of the E. coii strain Y1089 with the J-l phage (Huynh et al., 1985) and induced with IPTG to express high levels of the 8-galactosidase TEF-1 fusion protein. Ceil extracts were then made using the freeze-thaw method as described in Singh et al. (1986). Gel Retardatlon Assay Gel retardation/shift assays were essentially as described al. (1987a, 1967b). In the retardation assays, fractions

by Xiao et containing

TEF-1 were preincubated with antisera at room temperature before addition of labeled DNA templates and nonspecific DNA (poiy(dAdT), Pharmacia).

for 30 min competitor

Conetructlon and Screening of the HeLa IZAPcDNA Libmry The HeLa cDNA library (a generous gift of J. M. Garnier) was constructed in the IZAPvector according to the manufacturer’s instructions (Stratagene) by standard procedures (Sambrook et al., 1989). The [a-92P]dCTP-iabeied J-l cDNA probe was prepared using the random-priming method, purified on a Sephadex 650 column, and used to screen the library by standard procedures. Bluescript SK(-) phagemids containing cDNA inserts were excised from the plaque-purified &ZAP-ii clones and rescued using the helper phage R408. Single-strand DNA was prepared by superinfection with Ml3 07K and sequenced with Sequenase (US Biochemical Corp.) using the dideoxy chain termination method (Sanger et al., 1977). TEF-1 Protein Pmparation and Peptide Mlcroaequencing The endogenous HeLa ceil TEF-1 protein was purified byaffinitychromatography as previously described (Davidson et al., 1988). Purified (15 sg) TEF-1 was eiectrophoresed on a 10% SDS-PAGE gel, the TEF-l-containing gel slice was excised and crushed, and TEF-1 eiuted in a buffer containing 50 mM Tris (pH 9.3) 0.01% SDS. TEF-1 was then digested overnight at room temperature with endoproteinase Lys C (Boehringer Mannheim), and the resulting peptides were separated by reverse-phase HPLC. Automated peptide sequencing by Edmann degradation was performed on an Applied Biosystems sequencer. Preparation and Northern Analysis of mRNA Total RNA was extracted from ceils using the GnSCN-CsCi procedure (Chirgwin et al., 1979). Poiy(A)+ RNA was isolated on oiigo(dT)cellulose, electrophoresed on 1% agarose-1 .l M formaldehyde gels, and transferred to nitroceiiuiose filters, as described in Sambrook et al. (1989). Prehybridization and hybridization were performed at 42OC for about 24 hr in a solution containing 50% formamide. 5 x SSPE (0.75 M NaCI, 50 mM N&PO,, 5 mM EDTA [pH 7.41) 0.5% (w/v) SDS, 5 x Denhardt’s mixture, and 100 pg/ml sheared and denatured salmon sperm DNA. The filters were washed twice in 2 x SSPE plus 0.1% SDS at room temperature for 15 min each, followed by washing twice in 1 x SSPE plus 0.1% SDS at 65OC for 15 min each. The most stringent wash was carried out in 0.1 x SSPE containing 1% SDS at 65OC. Ail washing solutions contain 0.03% (w/v) sodium pyrophosphate. Mutagenesis of cDNA and Conetruction of DNA Recomblnants Point mutations were introduced into the wild-type cDNA Zt-1 by sitedirected mutagenesis (Zoller and Smith, 1983). to give the mutants ml to m4 (see Figure 6B). pSG5-TEF-1 (wt) (see Figure 78) was constructed by insertion of the EcoRi fragment of the cDNA Zt-1 into the EcoRi site of pSG5 (Green et al., 1986). pSGB-TEF-1 B was madeasfoiiows. TheZt-1 cDNAclone was first modified using site-directed mutagenesis to create an EcoRi site followed by a perfect Kozak consensus sequence at AUG(586) (see the Ml sequence shown in Figure 66) and a Bglll site immediately downstream of the stop codon of the predicted TEF-1 ORF where S-(1 S19)TGA ACA TGG TTA TlT ATA TAT (1829)3’ is changed to S-(1 819)TGA ACA TGG TTA CAT GTA TAT(1629)-3’(changed nucleotides are underlined). The EcoRi-Bglil fragment containing the modified ORF was then excised and inserted into pSG5 between the EcoRl and Bgill sites. The reporter piasmid BTATA-GLOB was kindly provided by Dr. J. White, and Sph-BTATA-GLOB was constructed as follows. The piasmid OVEC (Westin et al., 1987) was first cut at the Sal1 site located immediately upstream of the TATA box of the B-giobin promoter, repaired, and then cut at the Apai site located in the second exon of the 5-giobin gene. The resulting 5giobin gene fragment was then used to replace the fragment Bglll-Apal containing both the AdMLP TATA box and the downstream 5qiobin gene sequence in the construct TATA-GLOB (Tora et al., 1989) regenerating a Bglii site immediately upstream of the 5-giobin TATA box. The Bgiii fragment containing the tetramerized Sph(ii+l)+CktM motifs was isolated from the reporter plasmid Sph(i+il)+OctM (Figure 7A) and inserted into the 8TATAGLOB, resulting in Sph-pTATA-GLOB. The reporter plasmid 2GTIIC(R)-tk-CAT was obtained by inserting

Cell 564

the Bglll fragment of the plasmid PGTIIC (Fromental et al., 1988) which contains the tetramerized GT-IIC enhansons, into the Bamlil site in the -105 polylinker of the pBLCAT8+ construct (Klein-Hitpass et al., 1986). For the eukaryotic expression vector pXJ40 (see Figure 78) the plasmid pCMVcat (Foecking and Hofstetter, 1986) was digested by the restriction enzymes Xbal and Pstl, and the ends of the fragmentswere flushed using T4 DNA polymerase (Sambrook et al., 1989). Then, the fragment containing the CMV enhancer and promoter was ligated to the Pvull-Stul fragment derived from pSG5, which contains the Bluescribe Ml3+, the 8-globin gene intron, and the SV40 polyadenylation signal sequences (Green et al., 1988). The resulting plasmid was further modified by substituting the pSG5-derived multiple cloning sites with a new polylinker, 5’-EcoRI-BamHI-HindlIl-Xhol-Notl-Smal-PstlKpnl-Bgll-3’, resulting in pXJ40. The activator plasmid pXJ40-GAL4(1-148) (see Figure 78) was constructed by inserting the GAL4(1-148)containing EcoRI-Bglll fragment of pG4mpoly (Webster et al., 1989) into the compatible cloning sites of pXJ40. To obtain the activator plasmid pXJ40-GAL4(1148)-TEF-1(167-426) the unique BamHl site in theZt-1 cDNAformed by codons 167 and 188 was cleaved together with the EcoRl sites. The BamHI-EcoRI fragment containing the TEF-1 N-terminal region between codons 167and 426 was ligated with the EcoRI-BamHI frag ment of pG4mpoly containing GAL4(1-148). and the ligation product was then inserted into the cloning site EcoRl of pXJ40. The additional peptide sequence brought by the polylinker of pG4mpoly is DPRAGT at the junction between the GAL4 and TEF-1 sequences. Similarly, pXJ40-GAL4(1-148)-TEF-1(2-426) was made by ligating the SaclEcoRl fragment of Zt-lm2 containing TEF-1(2-426) with the EcoRISac1 fragment of pG4mpoly containing GAL4(1-148) followed by cloning into the EcoRl site of pXJ40. The junction sequence brought by the polylinker of pG4mpoly is DPRAGTGSEL. The modified cDNA Zt-1, which contains an EcoRl site immediately upstream of the Kozak consensus created at the codon AUU(541), was further modified in the same was as for construction of pSG5-TEF-lB, to give a Bglll site immediately downstream of theTEF-1 ORF. The resulting plasmid was cut at EcoRl and Bglll sites and the TEF-1 ORF-containing fragment was then inserted into the cloning sites EcoRl and Bglll of pXJ40, to give pXJ40-TEF-1A. To construct the internal control plasmid pXJ40-IacZ, the plasmid pCH110 (Pharmacia) was cut with Hindlll and BamHI. The HindlllBamHl fragment containing the entire /acZ gene was isolated and inserted into the cloning sites Hindlll and BamHl of the expression vector pXJ43, which was constructed from pXJ40 by replacing the multiple cloning sites of pXJ40 with a polylinker, 5’-Bglll-Kpnl-XholHindlll-Smal-BarnHI-Notl-EcoRI-3’. To express the TEF-1 ORF in E. coli under the control of the T7 promoter in plasmid PET-3A (Studier and Moffatt, 1986) the AUU(541) codon was changed to an Ndel site (S’CATATG-3’) by site-directed mutagenesis of the Zt-1 cDNA. The resulting plasmid was cleaved with Ndel, taking advantage of the natural Ndel site immediately downstream of the TEF-1 stop codon, and the ORF was inserted in the Ndel site of PET-Sa, to yield pTORF-1. The N-terminal region (amino acids l-167) was expressed by cutting the modified Zt-1 DNA with Ndel and BamHl (codons 167 and 168) and cloning into PET-3a between the unique Ndel and BamHl sites to yield pTNT. Expression of the C-terminal portion (amino acids 167-426) was performed by introducing a Bglll site downstream of the TEF-1 stop codon in Zt-1 and then digestion with BamHl (see above) and Bglll. The resulting fragment was cloned into the in-frame BamHl site in vector PET-3a to yield pTCT. pTCT was then cut with Ndel and BarnHI, and a modified GAL4(1-148) with engineered in-frame Ndel and BamHl sites was inserted to yield pGACT, which encodes the chimeric bGALCTEF-1 protein. The GT-IIC-AdMLP reporters were made by excising the tetramers from the appropriate pG1 reporters (Fromental et al., 1988) with Bglll and insertion into the Bglll siteof pALlO(Ponglikitmongkol etal., 1990). GTIIC-MLP contains a tetramer of a GT-IIC tandem repeat in which one of the repeats has been mutated, while PGTIIC-MLP contains a wild-type tandem repeat oligomer and GTIICm-MLP the GTIIB+C m3 mutant oligomer (see Fromental et al.. 1988). Preparatlon of Extracts Containing Overexpressed from Transfected HeLa Cells and E. toll Using the calcium phosphate precipitation method,

TEF-1 HeLa cells were

transfected with the TEF-1 expression plasmids pSG5-TEF-l(wt) and pSG5-TEF-1B at 60 pg of DNA per 105 mm Petri dish. Forty-eight hours after transfection, cells were harvested and nuclear extracts were prepared as described by Xiao et al. (1987a). E. coli strain BL.21 Lys S was transformed with the appropriate PET-3a plasmids (described above) and grown to an ODsm of -1. The cultures were then induced with IPTG for l-3 hr and cell extracts prepared by freeze-thaw and sonication in 10% glycerol, 300 mM KCI, 50 mM Tris-HCI (pH 7.9) 1 mM DTT, and 0.1% NP-40. Peptide-Specific Antibody Preparation All TEF-1 peptides Pl to P3 were designed with a cysteine at their N-terminus and synthesized on the Applied Biosystems peptide synthesizer. The peptides were purified by HPLC and then conjugated to ovalbumin. Rabbits (New Zealand) were first injected with 200 ug of ovalbumin-coupled peptides emulsified with Freund’s complete adjuvant after preimmune sera were taken. Booster injections with the conjugated peptides emulsified in incomplete Freund’s adjuvant were performed 2,4,6, and IO weeks later. Sera were collected lo-15 days after the third and subsequent injections. Antiserum against the C-terminal portion of TEF-1 overexpressed in E. coli was prepared as follows. Following induction of E. coli BL21 LysS by IPTG, the insoluble fraction (*99%)of TEF-l(167-426) representing ml5% total E. coli protein was isolated bycentrifugation following freeze-thaw and extensive sonication. The protein was then resolubilized in 6 M GuHCl and diluted in Freund’s adjuvant. Protein (50 ug) was injected followed by two injections of 10 and 5 ug (see above), and the presence of anti-TEF-1 antibodies was determined by Western blots. In Vitro Transcription and Translation Plasmids were first linearized at restriction sites, Bglll for pSG5-TEFlB, and Ndel at position 1866 for pSG5-TEF-l(wt) and Bluescriptbased cDNA clones, downstream of the TEF-1 stop codon. Linear plasmid DNA (1 ug) was transcribed in a final volume of 50 ul with 50 units of either T7 (Boehringer Mannheim) or T3 (Promega) RNA polymerases in the presence of 500 uM m7G(5’)ppp@)G (Pharmacia) in addition to the NTPs. One microgram of RNA products was translated with 35 ul of rabbit reticulocyte lysate (Promega) in the presence of [“Sjmethionine. The translation products were subjected to electrophoresis on an 11% SDS-PAGE gel (Laemmli, 1970). The gels were fixed, treated with DMSO and 20% (w/v) PPO in DMSO, dried, and autoradiographed overnight. Western Blotting Samples containing affinity-purified TEF-1 were electrophoresed on an 11% SDS-PAGE gel and electroblotted onto nitrocellulose for 1 hr at 25OC in a buffer containing 0.6% (w/v) glycine, 10% methanol, and 50 mM Tris-HCI (pH 7.4) (Towbin et al., 1979). The blots were blocked with 3% nonfat milk in PBS for 1 hr at 25OC, then incubated at 37OC for 1 hr with antisera diluted 500-fold in a PBS buffer containing 0.3% nonfat milk. After washing at 25OC with 0.05% Tween-20 in PBS, the blots were developed with ‘2SI-labeled protein A (Amersham) at 25°C for 1 hr, washed again, and exposed overnight. Cell Growth and Transfection, Sl Nuclease Mapping, and CAT Assays Cell growth, transfection using calcium phosphate, and Sl nuclease mapping assays were carried out as described in Fromental et al. (1988). The 8-galactosidase activity in the transfected cell extracts, generated by the internal control plasmid (pCH1 IO or pXJ40-la@, was measured according to Herbomel et al. (1984). CAT assays were performed as described in Webster et al. (1988). Purification of Recombinant TEF-1 and GAL4-TEF-I and In Vitro Transcription The TEF-1 ORF was cloned between the EcoRl and Bglll sites in tk gene replacement vector pTG186 (a gift from Transgene) and recombined into vaccinia virus in vivo (Kieny et al., 1984). Nuclear extracts were prepared from infected HeLa cells and fractionated on heparinagarose using a 200-800 mM KCI gradient. Active fractions weredetermined using a PAGE retardation assay as described above and pooled. The pooled fractions were further purified by site-specific DNA affinity chromatography using tandem repeats of the GT-IIC enhanson as

g25ning

of Transcriptional

Enhancer

Factor

1

described (Davidson et al., 1968) to yield pure vTEF-1. The GAL4(1148)-TEF-l(187-428) chimeric protein (bGAL4-TEF-1) was purified from E. coli BL21 Lys S transformed with plasmid pGACT by heparinagarose chromatography followed by DNA affinity chromatography using 17-mer GALebinding sites. Active fractions were determined by PAGE retardation assays using 17-mer oligonucleotides. In each case recombinant proteins were purified to greater than 99% homogeneity as determined by silver staining. In vitro transcription using HeLa whole-cell extract was as previously described (Cavallini et al., 1988, and references therein) with 50 ng of AdMLP reporters and 25 ng of pA58 internal control and 10 pl of HeLa whole-cell extract. Correctly initiated transcripts were detected by Sl nuclease protection using a single-strand probe homologous to the AdMLP+-globin gene fusion pALI as described in Ponglikitmongkol et al. (1990). Acknowledgments We thank C. Brou for the gift of the 17M(5)-MLP reporter gene, Dr. Stephen Green for the gift of the HeLa lgtli library, A. Staub and F. Ruffenach for the synthesis of oligonucleotides, D. Black for help in microsequencing, A Chevalier and D. Stephan for peptide synthesis, C. Werle and 8. Boulayfor illustrations, and Dr. J. White for stimulating discussions. We also thank the cell culture group for technical assistance and M. P. Kieny (Transgene) for help in construction of recombinant vaccinia virus. J. H. X. was supported by fellowships from the Universite Louis Pasteur. This work was supported by grants from the CNRS, the INSERM, the Association pour la Recherche sur le Cancer, and the Fondation pour la Recherche Medicale Francaise. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked ‘advertisement” in accordance with 18 USC Section 1734 solely to indicate this fact. Received

November

22, 1990; revised

February

5, 1991.

Chambon, P., Dierich, A., Gaub. M. P., Jakowlev, S., Jongstra, J., Krust, A., LePennec, J. P., Oudet, P., and Reudelhuber, T. (1984). Promoter elements of genes coding for proteins and modulation of transcription by oestrogens and progesterone. Rec. Prog. Hormone Res. 40, l-42. Chirgwin, J. M., Przybyla, A. E., MacDonald, R. J., and Rutter, W. J. (1979). Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 78, 5294-5299. Clemens, M. J. (1989). Regulatory mechanisms trol. Curr. Opin. Cell Biol. 1, 1160-1167. Cosman, D. (1987). Today 8, 16-17.

Control

of messenger

in translational

RNA stability.

con-

Immunol.

Culp, J. S., Webster, L. C., Friedman, D. J., Smith, C. L., Huang, W.J., Wu, F. Y.-H., Rosenberg, M., and Ricciardi, R. P. (1988). The 289-amino acid ElA protein of adenovirus binds zinc in a region that is important for trans-activation. Proc. Natl. Acad. Sci. USA 85, 64506454. Curran, J., and Kolakofsky, D. (1988). Ribosomal initiation from ACG codon in the Sendai virus P/C mRNA. EMBO J. 7, 245-251.

an

Davidson, I.. Fromental, C., Augereau, P., Wildeman, A., Zenke, M., and Chambon, P. (1986). Cell-type specific protein binding tothe SV40 enhancer in HeLa and lymphoid cell nuclear extracts. Nature 323, 644-548. Davidson, I., Xiao, J. H., Rosales, R., Staub, A., and Chambon, P. (1988). The HeLa cell protein TEF-1 binds specifically and cooperatively to two SV40 enhancer motifs of unrelated sequence. Cell 54, 931-942. Evans, R. M., and Hollenberg, ation. Cell 52, l-3.

S. M. (1988). Zinc fingers:

gilt byassoci-

Florkiewicz, R. Z., and Sommer, A. (1989). Human basic fibroblast growth factor gene encodes four polypeptides; three initiate translation from non-AUG codons. Proc. Natl. Acad. Sci. USA 86, 3978-3981. Foecking, M. K., and Hofstetter, H. (1966). Powerful and versatile enhancer-promoter unit for mammalian expression vectors. Gene 45, 101-105.

References Acland, P., Dixon, M., Peters, G., and Dickson, C. (1990). Subcellular fate of the lnt-2 oncoprotein is determined by choice of initiation codon. Nature 343, 662-865.

Forsburg, S. L., and Guarente, L. (1989). Identification ization of HAP4: a third component of the CCAAT-bound heteromer. Genes Dev. 3, 1186-l 178.

and characterHAP2/HAP3

Baldwin, A. S., and Sharp, P. A. (1967). Binding of a nuclear factor to a regulatory sequence in the promoter of the mouse H-2Kb class I major histocompatibility gene. Mol. Cell. Biol. 7, 305313.

Frankel, A. D., Chen, tion of the tat protein rich peptide mimics Natl. Acad. Sci. USA

Baldwin, A. S., and Sharp, P. A. (1986). Two transcription factors, NF-KB and H2TF1, interact with a single regulatory sequence in the class i major histocompatibility complex promoter. Proc. Natl. Acad. Sci. USA 85, 723-727.

Fromental, C., Kanno, M., Nomiyama, H., and Chambon, P. (1988). Cooperativity and hierarchical levels of functional organization in the SV40 enhancer. Cell 54, 943-953.

Banerji, J., Rusconi, S., and Schaffner, W. (1981). Expression of a 8-globin gene is enhanced by remote SV40 DNA sequences. Cell 27, 299-308. Benoist, C., and Chambon, P. (1981). The SV40 early promoter sequence requirements in viva. Nature 290, 304-310.

region:

Berger, S. L., Cress, W. D., Cress, A., Triezenberg, S. J., and Guarente, L. (1990). Selective inhibition of activated but not basal transcription by the acidic activation domain of VP16: evidence for transcriptional adaptors. Cell 61, 1199-1208. Bernards, A., and M. de la Monte, S. (1990). The Itk receptor tyrosine kinase is expressed in pre-B lymphocytes and cerebral neurons and uses a non-AUG translational initiator. EMBO J. 9, 2279-2287. Bocquel, M. T., Kumar, V., Stricker, C., Chambon, P., and Gronemeyer, H. (1989). The contribution of the N-and C-terminal regions of steroid receptors to activation of transcription is both receptor and cell-specific. Nucl. Acids Res. 77, 2581-2595.

L., Cotter, R. J., and Pabo, C. 0. (1988). Dimerizafrom human immunodeficiency virus: a cysteinethe normal metal-linked dimer interface. Proc. 85, 8297-6300.

Gerster, T., Matthias, P., Thali, M., Jiricny, J., and Schaffner, W. (1987). Cell type-specificity elements of the immunoglobulin heavy chain gene enhancer. EMBO J. 6, 1323-1330. Gill, G., and Ptashne, M. (1988). Negative activator GAL4. Nature 334, 721-724. Giniger, E., and Ptashne, by a putative amphipathic 330, 870-872.

effect

of the transcriptional

M. (1987). Transcription in yeast activated (I helix linked to a DNA binding unit. Nature

Green, S., Issemann, I., and Sheer, E. (1988). A versatile in vivo and in vitro eukaryotic expression vector for protein engineering. Nucl. Acids Res. 76, 389. Gupta, K. C., and Patwardhan, S. (1988). ACG, the initiator a Sendai virus protein. J. Biol. Chem. 263, 8553-8558.

codon

for

Boshart, M., Weber, F., Jahn, G., Dorsch-Hasler, K., Fleckenstein, B., and Schaffner, W. (1985). A very strong enhancer is located upstream of an immediate early gene of human cytomegalovirus. Cell 47, 521530.

Hann, S. R., King, M. W., Bentley, D. L., Anderson, C. W.. and Eisenman, R. N. (1988). A non-AUG translational initiation in c-myc exon 1 generates an N-terminally distinct protein whose synthesis is disrupted in Burkitt’s lymphomas. Cell 52, 185-195. Hatzopoulos, A. K., Schlokat, U.. and Gruss, P. (1988) Enhancersand other cis-acting regulatory sequences, In Transcription and Splicing, B. D. Hannes and D. M. Glover, eds. (Oxford: IRL Press), pp. 43-97.

Cavallini, B., Huet, J., Plassat, J. L., Sentenac, A., Egly, J. M., and Chambon, P. (1968). A yeast activity can substitute for the HeLa cell TATA box factor. Nature 334, 77-80.

Herbomel, P., Bourachot, B., and Yaniv, M. (1984). Two distinct enhancers with different cell specificities coexist in the regulatory region of polyoma. Cell 39, 853-682.

Cell 566

Herman, R. C. (1989). Alternatives Trends Biochem. Sci. 74, 219-222.

for the inttiation

of translation.

Herr, W.. and Clarke, J. (1986). The SV40 enhancer is composed of multiple functional elements that can compensate for one another. Cell 45, 461-470. Hinnebusch, A. G. (1990). Involvement of an initiation factor and protein phosphorylation in translational control of GCN4 mRNA. Trends Biochem. Sci. 75, 148-152. Hope, I. A., and Struhl, K. (1986). Functional dissection of a eukaryotic transcriptional activator protein, GCN4 of yeast. Cell 46, 885-894. Hope, I. A., Mahadevan, S., and Struhl, K. (1988). Structural and functional characterization of the short acidic transcriptional activation region of yeast GCN4 protein. Nature 333, 635-640. Horiuchi, T., Macon, K. J., Kidd, V. J., and Volanakis. J. E. (1990). Translational regulation of complement protein C2 expression by differential utilization of the S’untranslated region of mRNA. J. Biol. Chem. 265, 6521-6524. Huynh, T. V., Young, Ft. A., and Davis, Ft. W. (1985). Constructing and screening cDNA libraries in )LgtlO and lgtl 1. In DNA Cloning: A Practical Approach, Vol. I, D. M. Glover, ed. (Oxford: IRL Press), pp. 49-78. Jantzen, H. M., Admon, A., Bell, S. P., and Tjian, R. (1990). Nucleolar transcription factor hUBF contains a DNA-binding motif with homology to HMG proteins. Nature 344, 830-836. Johnson, regulatory

regulation by dimerization: Cell 61, 9-11.

Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680-685. Lamberti. C., Morrissey, L. C., Grossman, S. R., and Androphy, E. J. (1990). Transcriptional activation by the papillomavirus E6 zinc finger oncoprotein. EMBO J. 9, 1907-1913. Landolfi, N. F., Capra, J. D., and Tucker, P. M. (1987). Proteinnucleotide contacts in the immunoglobulin heavy-chain promoter region. Proc. Natl. Acad. Sci. USA 84, 3851-3855. La Thangue, N. B., and Rigby, P. W. J. (1988). Transacting protem factors and the regulation of eukaryotic transcription. In Transcription and Splicing, (B. D. Hannes, and D. M. Glover. eds. (Oxford: IRL Press), pp. l-42. Lamaire P., Vesque, C., Schmitt, J., Stunnenberg. Charnay, P. (1990). The serum-inducible mouse codes a sequence-specific transcriptional activator. 3456-3467.

H., Frank, R., and gene Krox-24 enMol. Cell. Biol. 70.

A new class of yeast transcriptional

Ma, J., and Ptashne, M. (1987b). Deletion analysis of GAL4 two transcriptional activating segments. Cell 48, 847-853.

Johnston, M., and Dover, J. (1987). Mutations that inactivate a yeast transcriptional regulatory protein cluster in an evolutionarily conserved DNA binding domain. Proc. Natl. Acad. Sci. USA 84, 2401-2405. Transcriptional relationship.

Kozak, M. (1990b). Downstream secondary structure facilitates recog nition of initiator codons by eukaryotic ribosomes. Proc. Natl. Acad. Sci. USA 87, 8301-8305.

Ma, J., and Ptashne, M. (1987a). activators. Cell 57, 113-119.

P. F., and McKnight, S. L. (1989). Eukaryotic transcriptional proteins. Annu. Rev. Biochem. 58, 799-839.

Jones, N. (1990). to an incestuous

Kozak. M. (1990a). Evaluation of the fidelity of initiation of translation in reticulocyte lysates from commercial sources. Nucl. Acids Res. 78, 2828.

two sides

Macchi, M., Bornert, J.-M., Davidson, I., Kanno, M.. Rosales, R., Vigneron, M., Xiao, J.-H., Fromental, C., and Chambon. P. (1989). The SV40 TC-II enhanson binds ubiquitous and cell type specifically inducible nuclear proteins from lymphoid and non-lymphoid cell lines. EMBO J. 8, 4215-4227.

Kanno, M., Fromental, C., Staub, A.. Ruffenach. F.. Davidson, I., and Chambon, P. (1989). TheSV40TCII (rcB)and therelated H-2KBenhansons exhibit different cell type specific and inducible proto-enhancer activities, but the SV40 core sequence and the AP-2 binding site have no enhanson properties. EMBO J. 8, 4205-4214.

Malter, J. S. (1989). Identification of an AUUUA-specific RNA binding protein. Science 246, 664-666.

Kelleher, R. J., Ill, Flanagan, P. M., and Kornberg, R. D. (1990). novel mediator between activator proteins and the RNA polymerase transcription apparatus. Cell 67, 1209-1215.

Mattaj. I. W. (1990). Splicing stories and poly(A) tales: RNA processing and transport. Cell Biol. 2. 528-538.

A II

Kieny, M. P.. Lathe, R., Driellien, R.. Spehner, D., Skory, S., Schmitt, D.. Wiktor, T., Koprowski, H., and Lecocq, J. P. (1984). Expression of rabies virus glycoprotein from a recombinant vaccinia virus. Nature 312, 183-166. Kim, K. S.. and Guarente, L. (1989). Mutations that alter transcriptional activation but not DNA binding in the zinc finger of yeast activator HAPI. Nature 342, 200-203. Klein-Hitpass, L., Schorpp, M., Wagner, U., and Ryffel, estrogen-responsive element derived from the 5’flanking Xenopus vitellogenin A2 gene functions in transfected Cell 46, 1053-l 061.

G. (1986). An region of the human cells.

Kozak, M. (1979). Migration of 40s ribosomal subunits on messenger RNA when initiation is perturbed by lowering magnesium or adding drugs. J. Biol. Chem. 254, 4731-4738.

Kozak, M. (1987). An analysis of 5’noncoding vertebrate messenger RNAs. Nucl. Acids Res. Kozak, M. (1989a). The scanning Cell. Biol. 708, 229-241.

in virus-infected

ani-

sequence from 699 75, 8125-8148.

model for translation:

an update.

messenger

Martin, K. J., Lillie, J. W., and Green, M. R. (1990). Evidence for interaction of different eukaryotic transcriptional activators with distinct cellular targets. Nature 346, 147-152. an update

on

Mehdi. H.. Ono, E.. and Gupta, K. C. (1990). Initiation of translation at CUG, GUG, and ACG codons in mammalian cells. Gene 97,173-l 78. Mermod, N., O’Neill, E. A., Kelly, T. J., and Tjian. R. (1989). The proline-rich transcriptional activator of CTFINF-I is distinct from the replication and DNA binding domain. Ceil 58, 741-753. Meyer, M.-E., Gronemeyer, H., Turcotte, 8.. Bocquel, M.-T., Tasset. D., and Chambon, P. (1989). Steroid hormone receptors compete for factors that mediate their enhancer function. Cell 57, 433-442.

Klug, A., and Rhodes, D. (1987). Zinc fingers: a novel protein motif for nucleic acid recognition. Trends Biochem. Sci. 72, 464-469.

Kozak, M. (1986). Regulation of protein synthesis mal cells. Adv. Virus Res. 37, 229-292.

defines

J.

Mitchell, P. J., andTjian, R. (1989). Transcriptional regulation in mammalian cells by sequence-specific DNA binding proteins. Science245. 371-378. Moreau. P., Hen, R., Wasylyk, B., Everett, R.. Gaub. M. P., and Chambon, P. (1981). The SV40 72 base pair repeat has a striking effect on gene expression both in SV40 and other chimeric recombinants. Nucl. Acids Res. 9.6047-6068. Murre, C., McCaw, P. S., and Baltimore, D. (1989). A new DNA binding and dimerization motif in immunoglobulin enhancer binding, daughterless, MyoD, and myc proteins. Cell 56, 777-783. Nicosia, A., Monaci, P., Tomei, L., De Francesco. R., Nuzzo, M., Stunnenberg, H., and Cortese, R. (1990). A myosin-like dimerization helix and an extra-large homeodomain are essential elements of the tripartite DNA binding structure of LFBl. Cell 67, 1225-1236.

Kozak, M. (1989b). Contexteffectsand inefficient initiationat non-AUG codons in eucaryotic cell-free translation systems. Mol. Cell Biol. 9, 5073-5080.

Nomiyama, H., Fromental, C., Xiao, J. H., and Chambon. P. (1987). Cell specific activity of the constituent elements of the simian virus 40 enhancer. Proc. Natl. Acad. Sci. USA 84, 7881-7885.

Kozak. M. (1989~). Circumstances translation by secondary structure Biol. 9, 5134-5142.

Ondek, B., Shephard,A., and Herr, W. (1987). Discreteelementswithin the SV40 enhancer region display different cell-specific enhancer tivities. EMBO J. 6, 1017-1025.

and mechanisms of inhibition of in eucaryotic mRNAs. Mol. Cell.

ac-

C&ning

of Transcriptional

Enhancer

Factor

1

Ondek. B., Gloss, L., and Herr, W. (1988).The SV4Oenhancercontains two distinct levels of organization. Nature 333, 40-45. Payre. V.. and Vincent, A. (1988). Finger proteins and DNA-specific recognition: distinct patterns of conserved amino acids suggest different evolutionary modes. FEBS Lett. 234, 245-250. Peabody, D. S. (1969). Translation initiation at non-AUG mammalian cells. J. Biol. Chem. 284, 5031-5035.

triplets

in

Pettersson, M., and Schaffner, W. (1987). A purine-rich DNAsequence motif present in SV40 and lymphotropic papovavirus binds lymphoid-specific factor and contributes to enhancer activity lymphoid cells. Genes Dev. I, 962-972.

a in

Ponglikitmongkol, M., White, J., and Chambon. P. (1990). Synergistic activation of transcription by the human estrogen receptor bound to tandem responsive elements. EMBO J. 9, 2221-2231. Prats, H., Kaghad, M., Prats, A., Klagsbrun, M., Lelias, J., Liauzun, P., Chalon, P., Tauber, J. P., Amalric, F.. Smith, J. A., and Caput, D. (1989). High molecular mass forms of basic fibroblast growth factor are initiated by alternative CUG codons. Proc. Natl. Acad. Sci. USA 88, 1836-l 640. Ptashne, M. (1966). How eukaryotic Nature 335, 663-689.

activators

work.

and targets.

Nature

Pugh, B. F., and Tjian, R. (1990). Mechanism of transcriptional tion by Spl: evidence for coactivators. Cell 87, 1187-l 197.

activa-

Ptashne, M.. and Gann, 348, 329-331.

A. A. F. (1990).

transcriptional Activators

Pusztai. R., Loewenstein, P. M.. and Green, M. (1989). Mutational analysis of autonomously functioning trans-activating peptides encoded by adenovirus El A: evidence for two subdomains. J. Virol. 83, 35163518. Resales, R., Vigneron. M., Macchi, M., Davidson, I., Xiao, J. H., and Chambon, P. (1987). h vitro binding of cell-specific and ubiquitous nuclear proteins to the octamer motif of the SV40 enhancer and related motifs present in other promoters and enhancers. EMBO J. 8, 30153025. Sadowski, I., Ma, J.. Triezenberg, S., and Ptashne, VP18 is an unusually potent transcriptional activator. 564. Sambrook, J., Fritsch, E. F., and Maniatis, ing: A Laboratory Manual, Second Edition York: Cold Spring Harbor Laboratory). Sanger, F., Nicklen, with chain-terminating 5467.

M. (1986). GAL4 Nature 335,583-

T. (1989). Molecular Clon(Cold Spring Harbor, New

S.. and Coulson, A. R. (1977). DNA sequencing inhibitors. Proc. Natl. Acad. Sci. USA 74,5463-

Scheidereit, C., Heguy, A., and Roeder, R. G. (1987). Identification and purification of a human lymphoid-specific octamer binding protein (OTF-2) that activates transcription of an immunoglobulin promoter in vitro. Cell 57, 783-793. Schirm, S., Jiricny, J., and Schaffner. W. (1987). The SV40 enhancer can be dissected into multiple segments, each with a different cell type specificity. Genes Dev. 1, 65-74. Singh, H., LeBowitz, J. H., Baldwin, A. S., and Sharp, P. A. (1988). Molecular cloning of an enhancer binding protein: isolation by screening of an expression library with a recognition site DNA. Cell 52,415423. Staudt, L. M.. Singh. H., Sen, R., Wirth, T., Sharp, P. A., and Baltimore, D. (1988). A lymphoid-specific protein binding to the octamer motif of immunoglobulin genes. Nature 323, 640-643. Studier, F. W., and Moffatt, 8. A. (1986). Useof bacteriophageT7 polymerase to direct selective high-level expression of cloned J. Mol. Biol. 789, 113-130.

RNA genes.

Sturm, R., Baumruker. T.. Franra, 8. R.. and Herr, W. (1967). A 1OOkD HeLa cell octamer binding protein (OBPIOO) interacts differently with two separate octamer-related sequences within the SV40 enhancer. Genes Dev. 1, 1147-l 180. Taira, M., lizasa, T.. Shimada, H., Kudoh, J., Shimizu, N., and Tatibana, M. (1990). A human testis-specific mRNA for phosphoribosytpy rophosphate synthetase that initiates from a non-AUG codon. J. Biol. Chem. 285, 16491-16497.

Tanaka, M., Grossniklaus, U., Herr, W., and Hernandez, N. (1988). Activation of the U2 snRNA promoter by the octamer motif defines a new class of RNA polymerase II enhancer elements. Genes Dev. 2, 1764-l 778. Tasset, D., Tora, L., Fromental, C., Scheer. E., and Chambon, P. (1990). Distinct classes of transcriptional activating domains function by different mechanisms. Cell 62, 1177-1187. Theill, L. E., Castrillo, J.-L., Wu, D., and Karin, M. (1989). Dissection of functional domains of the pituitary-specific transcription factor GHF-1. Nature 342, 945-948. Tooze, J. (1982). DNA tumor viruses. In Molecular Biology of Tumor Viruses, Second Edition, Part 2, J. Tooze, ed. (Cold Spring Harbor, New York: Cold Spring Harbor Laboratory), pp. 799847. Tora, L., White, J., Brou, C., Tasset, D., Webster, N., Scheer, E., and Chambon, P. (1989). The human estrogen receptor has two independent nonacidic transcriptional activation functions. Cell 59, 477-487. Towbin, H., Staehelin, T., and Gordon, J. (1979). Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl. Acad. Sci. USA 78, 43504354. Treizenberg, S. J.. Kingsbury, R. C., and f&Knight, S. L. (1988). Functional dissection of VP18, the trans-activator of herpes simplex virus immediate early gene expression. Genes Dev. 2, 718-729. van Huijsduijnen, R. H., Li, X. Y., Black, D., Matthes, H., Benoist, C., and Mathis, D. (1990). Cc-evolution from yeast to mouse: cDNAcloning of the two NF-Y (CP-l/CBF) subunits. EMBO J. 9, 3119-3127. Vinson, C. R., LaMarco, McKnight, S. L. (1988). binding activity specified 2, 801-806. Wasylyk, 8. (1986). merase B promoters 23, 77-120.

K. L., Johnson, P. F., Landschulz, W. H., and In situ detection of sequence-specific DNA by a recombinant bacteriophage. Genes Dev.

Transcription elements of higher eukaryotes.

and factors of RNA polyCRC Crit. Rev. B&hem.

Webster, N., Jin. J. R., Green, S., Hollis, M., and Chambon, P. (1986). The yeast UASG is a transcriptional enhancer in human HeLa cells in the presence of the GAL4 harm-activator. Cell 52, 189-178. Webster, N. J. G., Green, S.. Tasset. D., Ponglikitmongkol, M., and Chambon, P. (1989). The transcriptional activation function located in the hormone-binding domain of the human oestrogen receptor is not encoded in a single exon. EMBO J. 8, 1441-1448. Westin, G.. Gerster, T., Miiller, M. M., Schaffner, G., and Schaffner, W. (1987). OVEC. a versatile system to study transcription in mammalian cells and cell-free extracts. Nucl. Acids Res. 15, 87876788. Wickens, M. (1990). How the messenger got its tail: addition in the nucleus. Trends B&hem. Sci. 75, 277-281,

of poly(A)

Wildeman, A., Zenke, M., Schatz. C., Wintzerith, M., Grunstriim, T., Matthes, H., Takahashi, K., and Chambon, P. (1986). Specific protein binding to the simian virus 40 enhancer in vitro. Mol. Cell. Biol. 8, 2098-2105. Williams, T., Admon, A., Liischer, B., and Tjian, R. (1988). Cloning and expression of AP-2, a cell-type-specific transcription factor that activates inducible enhancer elements. Genes Dev. 2, 1557-1569. Xiao, J. H., Davidson, I., Ferrandon, D., Macchi, M., Ruffenach, F., and Chambon, and three ubiquitous nuclear proteins bind in the domain 81 of the SV40 enhancer.

Rosales, R., Vigneron, M., P. (1987a). Onecell-specific in vitro to overlapping motifs EMBO J. 8, 3005-3013.

Xiao, J. H.. Davidson, I., Macchi, M., Rosales, R., Vigneron. M., Staub, A., and Chambon, P. (1987b). In vitro binding of several cell-specific and ubiquitous nuclear proteins to the GT-I motif of the SV40 enhancer. Genes Dev. 7, 794607. Yano, O., Kanellopoulos, J., Kieran, M., Le Bail, 0.. Israel, A., and Kourilsky, P. (1987). Purification of KBFl, a common factor binding to both H-2 and j&-microglobulin enhancers. EMBO J. 8, 3317-3324. Zenke, M., Grundstrom, T., Matthes, H., Wintzerith, M., Schatz, Wildeman, A., and Chambon, P. (1986). Multiple sequence motifs involved in SV46 enhancer function. EMBO J. 5, 387-397. Zheng,

X. M., Black,

D., Chambon,

P., and Egly, J. M. (1990).

C., are

Sequenc-

Cdl 568

ing and expression of complementary DNA for the general tion factor BTF3. Nature 344, 556-559.

transcrip-

Zoller, M. J., and Smith, M. (1983). Oligonucleotide-directed mutagenesis of DNA fragments cloned into Ml3 vectors. Meth. Enzymol. 100, 468-500. GenBank

Accession

The accession M63896.

number

Number for the sequence

reported

in this

paper

is