Extremophiles DOI 10.1007/s00792-016-0808-z

ORIGINAL PAPER

Cloning, expression, and characterization of a thermostable glucose‑6‑phosphate dehydrogenase from Thermoanaerobacter tengcongensis Zilong Li1,2 · Ning Jiang3 · Keqian Yang2 · Jianting Zheng1 

Received: 18 July 2015 / Accepted: 5 January 2016 © Springer Japan 2016

Abstract  Glucose-6-phosphate dehydrogenases (G6PDs) are important enzymes widely used in bioassay and biocatalysis. In this study, we reported the cloning, expression, and enzymatic characterization of G6PDs from the thermophilic bacterium Thermoanaerobacter tengcongensis MB4 (TtG6PD). SDS-PAGE showed that purified recombinant enzyme had an apparent subunit molecular weight of 60 kDa. Kinetics assay indicated that TtG6PD preferred NADP+ (kcat/Km  = 2618 mM−1 s−1, kcat  = 249 s−1, Km  = 0.10 ± 0.01 mM) as cofactor, although NAD+ (kcat/Km = 138 mM−1 s−1, kcat = 604 s−1, Km  = 4.37 ± 0.56 mM) could also be accepted. The Km values of glucose-6-phosphate were 0.27 ± 0.07 mM and 5.08  ± 0.68 mM with NADP+ and NAD+ as cofactors, respectively. The enzyme displayed its optimum activity at pH 6.8–9.0 for NADP+ and at pH 7.0–8.6 for NAD+ while the optimal temperature was 80 °C for NADP+ and 70 °C Communicated by F. Robb. * Keqian Yang [email protected] * Jianting Zheng [email protected] Zilong Li [email protected] 1

National Key Laboratory of Biochemical Engineering, Institute of Process Engineering, Chinese Academy of Sciences, Beijing 100190, People’s Republic of China

2

State Key Laboratory of Microbial Resources, Institute of Microbiology, Chinese Academy of Sciences, Beijing 100101, People’s Republic of China

3

Department of Industrial Microbiology and Biotechnology, Institute of Microbiology, Chinese Academy of Sciences, Beijing 100101, People’s Republic of China







for NAD+. This was the first observation that the NADP+linked optimal temperature of a dual coenzyme-specific G6PD was higher than the NAD+-linked and growth (75 °C) optimal temperature, which suggested G6PD might contribute to the thermal resistance of a bacterium. The potential of TtG6PD to measure the activity of another thermophilic enzyme was demonstrated by the coupled assays for a thermophilic glucokinase. Keywords  Glucose-6-phosphate dehydrogenase · Thermoanaerobacter tengcongensis · Kinetics · Thermostable · Dual-coenzyme specific · Coupling enzyme

Introduction Glucose-6-phosphate dehydrogenase (G6PD, EC 1.1.1.49) is the key enzyme of the pentose phosphate pathway and the bacterial Entner–Doudoroff pathway (Conway 1992; Lee et al. 2013). It catalyzes the oxidation of glucose-6-phosphate to gluconolactone-6-phosphate with the concomitant conversion of NADP+ to NADPH, which plays an important role in various cell functions. Most studies have focused on G6PD deficiency, one of the most common human enzymopathies that affects more than 400 million people worldwide (Stanton 2012). However, G6PDs are also important tool enzymes used in bioassay and biocatalysis with industrial and commercial purposes. G6PDs are used to determine the kinetics of hexokinase and creatine kinase, hexose and ATP concentrations, and sugar quantities in wines and fruit juices, as well as to regenerate NADPH cofactor (Kusumoto et al. 2010; McCarthy et al. 2003; Uppada et al. 2014). The core of G6PD-coupled assays is the convenient spectrophotometric measurement of the NADPH formation by 340 nm absorbance. Moreover, immobilized G6PDs have been

13

Extremophiles Table 1  Bacterial strains, plasmids, and primers used in this study cc

Relevant characteristic/sequence (restriction enzymes)

Source/reference/note

F− ϕ80 lacZ∆M15 ∆(lacZYA-argF)U169 recA1 endA1 hsdR17(r− k, − m+ k ) phoA supE44 thi-1 gyrA96 relA1 λ

TransGen (Cat. no. CD201)

Strain Escherichia coli DH5α

− R F− ompT hsdSB (r− B mB ) gal dcm (DE3) pRARE2 (Cam ) T Thermoanaerobacter tengcongensis MB4 CCCCM AS 1.2430  = DSM 15242, the source of G6PD gene Plasmid pET21a Expression vector with C-terminal hexahistidine affinity tag pET21a-TtG6PD pET21a derivative Expression vector of TtG6PD Primer (5′ → 3′)

Rosetta (DE3)

Novagen (Cat. no. 70987-3) Xue et al. (2001) Novagen This study

TtG6PDForward

CGCGAATTCATGAAAGATAAAGACCTTTCAAAC (EcoRI)

This study

TtG6PDReverse

GATCTCGAGTACATTCCACCACATTCTTCCA (XhoI)

This study

utilized to develop biosensors for various analytes (Cui et al. 2008; Srivastava and Singh 2013). Thermozymes are attracting increasing interest because of their stability and resistance to organic solvents and detergents (Bruins et al. 2001). Only a few G6PDs from thermophiles have been cloned and functionally expressed in Escherichia coli including the G6PDs from Thermotoga maritima (TmG6PD) and from Aquifex aeolicus (AeG6PD). TmG6PD was used to develop a continuous coupled assay to monitor glucose from cellobiose hydrolysis by 1,4-d-glucanglucohydrolase at 85 °C and AeG6PD was also used to develop an amperometric enzyme sensor demonstrating stability up to 83 °C (Hansen et al. 2002; Iyer et al. 2003, 2002; McCarthy et al. 2003). Thermoanaerobacter tengcongensis is an anaerobic bacterium isolated from a hot spring in Yunnan, China (Bao et al. 2002). This bacterium propagates at the optimum temperature of 75 °C, making it a potential source of thermostable enzymes. In the completely sequenced genome of T. tengcongensis, the open reading frame (ORF) zwf is annotated as a tentative G6PD. In this study, we report the cloning and expression of the ORF zwf and the characterization of the purified recombinant enzyme. We further demonstrated the application of this enzyme by measuring the activity of a thermophilic glucokinase from Geobacillus thermoglucosidasius (GtGlK) at the optimum temperature of 65 °C.

Materials and methods Strains, plasmids, and chemicals Bacterial strains, plasmids, and primers used in this study are listed in Table 1. Escherichia coli strains were grown

13

aerobically in a rotary shaker (220 rpm) at 37 °C in Luria– Bertani (LB) broth or on LB agar [1.5 % (w/v)] plates. T. tengcongensis MB4 strain grew anaerobically at 75 °C in modified MB medium (Xue et al. 2001). Ampicillin was added to LB at 100 μg/mL concentration if necessary. Oligonucleotides, plasmid DNA extraction kit (SP012), and DNA fragment recovery kit (SA012) were provided by Sunbiotech (Beijing, China). T4 DNA ligase, Pfu DNA polymerase, and all restriction enzymes were obtained from TaKaRa (Dalian, China). All chemicals were of analytical grade. The Ni2+ affinity column (HisTrapTM FF Crude HP) was purchased from GE Healthcare (Beijing, China). Sequence and structure analyses The TtG6PD sequence was retrieved from GenBank (GI: 20807485). Sequence alignments were performed using default parameters of program ClustalX2 (Larkin et al. 2007). The tertiary structures of TtG6PD was built automatically on the protein-modeling server, Phyre webserver (Kelley and Sternberg 2009). Cloning and sequencing of the zwf gene and constructing the expression vectors The genomic DNA of T. tengcongensis MB4 was isolated based on a previously reported procedure (Cheng and Jiang 2006). Plasmid isolation, DNA restriction enzyme digestion, and recovery were conducted according to the manufacturer’s instructions. PCR was performed using Pfu DNA polymerase. The TtG6PD coding region was amplified from T. tengcongensis MB4 genomic DNA using the primers TtG6PDforward and TtG6PDreverse (Table 1). PCR products were purified

Extremophiles

using a DNA fragment recovery kit. After digestion with the restriction enzymes, EcoRI and XhoI, the amplified fragment and pET21a were ligated. The resultant expression vector, pET21a-TtG6PD, was transformed into E. coli DH5α and verified through sequencing conducted by Sunbiotech (Beijing, China). The verified pET21a-TtG6PD was transformed into E. coli Rosetta (DE3) competent cells for gene expression. Functional overexpression of zwf in E. coli and purification of recombinant TtG6PD An overnight culture of E. coli Rosetta (DE3) cells harboring pET21a-TtG6PD was diluted 1:100 in 100 mL of LB supplemented with 100 μg/mL ampicillin. Recombinant protein synthesis was initiated by adding 0.5 mM isopropyl β-d-1-thiogalactopyranoside when the cell density reached A600 of 0.6. The mixtures were cultured at 30 °C for 8 h. The cells were harvested by centrifugation at 8000×g and subsequently washed once with and resuspended in buffer A [20 mM Tris–HCl, (pH 7.9), 500 mM NaCl, 10 % glycerol (w/v)]. The harvested cells were ruptured by sonication in an ice-water bath. The cellular lysate was centrifuged at 12,000×g for 30 min at 4 °C, and the supernatant was loaded on a 1 mL Ni2+ affinity column (HisTrapTM FF Crude HP; GE Healthcare) and washed with 6 mL of buffer A. After further washing with 20 mL of buffer B [20 mM Tris–HCl, (pH 7.9), 500 mM NaCl, 20 mM imidazole, 10 % glycerol (w/v)], the bound proteins were then eluted with buffer C [20 mM Tris–HCl, (pH 7.9), 500 mM NaCl, 500 mM imidazole, 10 % glycerol (w/v)]. The recombinant proteins were concentrated using Amicon Ultra-15 Centrifugal Filter Units (30 K MWCO, Millipore) and stored in buffer A at 4 °C. Gel electrophoresis, activity stain, and protein concentration determination SDS-PAGE was performed using 12 % separating gel to assess the purity and molecular weight of the recombinant TtG6PD. The protein bands were visualized by Coomassie Brilliant Blue R-250. Protein concentrations were determined using Bradford assay (Thermo Scientific, Beijing China) (Bradford 1976). Activity detection and measurement TtG6PD activity was measured by following the increase in absorbance at 340 nm on a DU 800 spectrophotometer (Beckman), equipped with a thermostated cuvette holder. The reaction mixture was allowed to reach the desired temperature, and the reaction was initiated by injecting the substrate. A standard assay (total volume, 300 μL) contained

100 mM Na2HPO4–citric acid buffer (pH 7.8), 2 mM G6P, 1 mM NAD(P)+, and an appropriate amount of enzyme. The enzyme activity was determined from the initial velocity of the reaction in the first 2 min, in which NAD(P)H is relatively stable. The dual coenzyme-specific G6PD displays different kinetic mechanisms, but a same kinetic equation, in NAD+and NADP+-linked reactions. When NADP+ is the coenzyme, the mechanism is ordered sequential, with coenzyme binding first; the NAD+-linked reaction proceeds via a random-order mechanism (Olive et al. 1971; Levy 1989). To determine the Michaelis–Menten constants, initial rate measurements were performed by varying the concentration of both G6P and NAD(P)+ in a data matrix at pH 7.8 and 70 °C. The kinetic parameters were calculated by curve-fitting to the following rate equation 1:

v=

Vm [A][B] KiA KB + KB [A] + KA [B] + [A][B]

(1)

where A and B represent NAD(P)+ and G6P, respectively; Vm is the maximum velocity; KiA is the dissociation constant of substrate A from the EA complex; and KA and KB are the Michaelis constant Km for substrates A and B, respectively (Purich 2010). Km and Vmax were drawn from a two-round double reciprocal plot using Origin Pro 8.0 software (OriginLab Corporation). Biochemical characterization Optimal NAD+- and NADP+-linked reaction conditions were detected. The optimal pH of the enzyme was determined at 70 °C by performing the assay using 100 mM Na2HPO4–citric acid buffer (pH 3.6–8.0) and 100 mM NaH2PO4–HCl (pH 8.0–11.5) buffer (all pH are room temperature values). Standard assays were performed at temperatures from 30 to 85 °C in 100 mM Na2HPO4–citric acid buffer to determine the optimal temperature. To analyze the effects of various metal ions on the activity of TtG6PD, we added 1 mM (final concentrations) of Ca2+, Mn2+, Zn2+, Ni2+, Co2+, Mg2+, Cu2+, K+, and Na+ individually during the enzymatic activity assessment. Thermostability detection Half-lives of TtG6PD were determined at 70, 80, and 85 °C in 100 mM Na2HPO4–citric acid buffer (pH 7.8) buffer. For a given temperature, samples were obtained at different time intervals and then cooled in an ice bath. The residual activity was determined by the standard assay at 70 °C using NAD+ as cofactor. The enzyme was incubated at 70 °C in 100 mM Na2HPO4–citric acid buffer (pH 3.6–8.0) or 100 mM NaH2PO4–HCl (pH 8.0–11.5) buffer for 1 h to investigate

13

Extremophiles

Fig. 1  Alignment of the highly conserved regions of TtG6PD and its homologs from all three domains [Bacteria: Thermoanaerobacter sp. X514 (TeG6PD, GI 167040057), Escherichia coli (EcG6PD, GI 16129805), Thermotoga maritima (TmG6PD, GI 15643912), Pseudomonas aeruginosa (PaG6PD, GI 15598379), and Leuconostoc mesenteroides (LmG6PD, GI 14278141); Archaea: Aquifex aeolicus (AaG6PD, GI: 28974707); and Eukarya: human (HsG6PD, GI 7546523), Saccharomyces cerevisiae (SsG6PD, GI 151944306), and

Aspergillus niger (AnG6PD, GI 1523782)]. Strictly conserved residues (white letters on red background) and conservatively substituted residues (red letters in box) are indicated. The residues equivalent to the putative acid/base catalysts are marked by stars. The secondary structure elements [α helices, β strands, and (η) helices of modeled TtG6PD produced by Phyre 2 server based on the X-ray structure of LmG6PD (Protein Data Bank code 1H93)] are shown above the alignment. The figure was produced using ESPript3.0

the pH-dependent thermostability. Thereafter, the residual activity was measured under standard assay conditions (pH 7.8, 70 °C) using NAD+ as cofactor.

other bacteria: Thermoanaerobacter sp. X514 (81.5 %, GI 167040057), T. maritima (37.3 %, GI 15643912), E. coli (36.5 %, GI 16129805), Pseudomonas aeruginosa (37.3 %, GI 15598379), and Leuconostoc mesenteroides (30.3 %, GI 14278141). TtG6PD also showed low sequence identity to archaeal G6PD from A. aeolicus (26.0 %, GI 28974707) and eukaryotic G6PDs from human (29.2 %, GI 7546523), Saccharomyces cerevisiae (29.3 %, GI 151944306), and Aspergillus niger (29.5 %, GI 1523782). A conserved motif (RXXXEKPXG) in the coenzyme-binding site and three conserved motifs (RIDHYLGK, EXXGXEXRXXY, and DXXQNH) in the substrate-binding site were observed in TtG6PD (Fig. 1). The catalytic triad composed of Asp183, His184, and His246 was completely conserved, suggesting that TtG6PD may utilize the same catalytic mechanism as observed in previously reported G6PD of L. mesenteroides (LmG6PD) (Cosgrove et al. 1998). The coding sequence for TtG6PD was amplified from the genomic DNA of T. tengcongensis and heterologously expressed in E. coli Rosetta (DE3) to confirm the biochemical function. The recombinant protein with a C-terminal His-tag was purified to homogeneity by affinity chromatography. The protein was estimated to be ~60 kDa and at least 95 % pure by SDS-PAGE analysis (Fig.  2). Approximately 54 mg of TtG6PD was purified per liter of culture.

Coupled assay for GtGlK The ability of the recombinant G6PD to serve as a coupling enzyme was investigated. A reaction system containing 100 mM Na2HPO4–citric acid (pH 7.8), 20 mM glucose, 5 mM ATP, 5 mM MgCl2, 2 mM NAD+, 5 μg/mL TtG6PD, and varying GtGlK concentrations was used to continuously determine GtGlK activity at 65 °C. The GtGlK (ERGO: RTMO00042, sequence information obtained from TMO Renewables Limited) was a purified recombinant glucokinase from G. thermoglucosidasius NCIMB 11955.

Results Computational analysis and expression of TtG6PD The 1458 bp coding sequence of TtG6PD encoded a polypeptide of 485 amino acids with a calculated molecular mass of 57.1 kDa. Multiple alignments revealed significant sequence identity between TtG6PD and G6PDs from

13

Extremophiles

Fig. 2  SDS-PAGE analysis of the TtG6PD purification process. Lane 1: lysate of induced E. coli Rosetta pET21a-TtG6PD cells; lane 2: flow-through sample; lane 3: wash sample; lane 4: eluted sample; lane M: molecular weight markers

Cofactor specificity G6PDs from most organisms, including mammals, are NADP+ dependent. However, the thermophilic G6PDs (TmG6PD and AeG6PD) utilize both NADP+ and NAD+ as cofactors (Hansen et al. 2002; Iyer et al. 2002). Though the reduced coenzymes NADH and NADPH only differ by one phosphate, cellular NADH provides the reducing power for catabolism, while NADPH is utilized in biosynthetic pathways and cellular antioxidation (Ying 2008). The TtG6PD also exhibited dual cofactor specificity. The kinetic constants of TtG6PD were obtained at 70 °C in 100 mM Na2HPO4–citric acid buffer at pH 7.8 (Fig. 3). The Km for NAD+ (4.37 ± 0.56 mM) was ~40 times bigger than that for NADP+(0.10  ± 0.01 mM) whereas the kcat for NAD-linked (604 s−1) reaction was more than twice the kcat for the reaction with NADP+ (249 s−1). Consequently, the catalytic efficiency (kcat/Km) for NADP+ (2618 mM−1s−1) was 19-fold higher compared with that for NAD+ (138 mM−1s−1). This result suggests that TtG6PD is an enzyme with a significant NADP+ preference. The Km value for glucose-6-phosphate in the NADP+-linked reaction was 0.27 ± 0.07 mM and that in the NAD+-linked reaction was 5.08 ± 0.68 mM. The Kia for NAD+ and NADP+ were 2.29 ± 0.26 and 0.31 ± 0.09, respectively. Optimal conditions and stability The effects of temperature and pH on the TtG6PD enzymatic activity and stability were assayed with G6P as

substrate and NAD+ (or NADP+) as cofactor. TtG6PD showed maximum activity at 80 °C for NADP+ and 70 °C for NAD+ (Fig. 4a); these temperatures are close to the physiological optimum growth temperature of 75 °C of the organism. Surprisingly, the half-life of activity at 80 °C was only 6 min. However, the enzyme was stable at 70 °C, and ~50 % of activity was retained after 15 h incubation (Fig. 4c). The enzyme showed optimal activity at pH between 7.0 and 8.6 in the NAD-linked reaction and a slightly wider optimal pH range of 6.8–9.0 in the NADPlinked reaction (Fig. 4b). To analyze the TtG6PD resistance to pH changes, it was incubated at 70 °C in 100 mM Na2HPO4–citric acid buffer (pH 3.6–8.0) and 100 mM NaH2PO4–HCl (pH 8.0–11.5) buffer for 1 h. Subsequently, the activity was monitored at 70 °C. The enzyme displayed stability at pH 4.6–9.5, but lost its activity abruptly at pH below 4.5 and above 10.0 (Fig. 4d). The effects of different metal ions on TtG6PD activity were also examined. The divalent metal ions Mg2+, Mn2+, Ca2+, and Co2+ slightly increased its activity (113, 112, 120, and 105 %, respectively), whereas Ni2+ exhibited a slight inhibitory effect (76 %). Coupled assay for thermophilic glucokinase using TtG6PD G6PDs are used in various coupled reactions in which the product of the first reaction is accepted as the substrate of the second reaction that is more amenable to assaying. The optimum conditions, such as pH or temperature behavior, should be similar for coupled enzymes. The activity of the glucokinase from G. thermoglucosidasius with an optimum temperature of 65 °C was assayed to demonstrate the application of TtG6PD in kinetic assays of thermophilic enzymes. As expected, the rate of NADH generation was proportional to the GtGlK added to the reaction system when TtG6PD was maintained in an appropriate concentration (Fig. 5).

Discussion G6PD is widely distributed in many species from bacteria to humans and responsible for producing various fundamental molecules, including nucleotide precursors and NADPH (Stover et al. 2011). In this study, we described the cloning and heterologous expression of the zwf gene from T. tengcongensis MB4 and confirmed its function as a thermostable G6PD by biochemical characterization. The TtG6PD showed higher similarity to G6PDs from bacterial subfamilies than to those from archaeal and eukaryotic subfamilies. The LmG6PD is the best characterized G6PD in terms of the catalytic mechanism, structure, and kinetics,

13

Extremophiles

Fig. 3  TtG6PD double reciprocal plots for the reaction with NAD(P)+ and G6P as substrates. a Primary plots of 1/v against 1/ [NAD+] at various G6P concentrations. b Primary plots of 1/v against 1/[G6P] at various NADP+ concentrations. c Secondary plots

of intercepts and slopes of primary plots against 1/[G6P] in NAD+linked reaction. d Secondary plots of intercepts and slopes of primary plots against 1/[NADP+]. Values represent the mean of three repeats (a, b)

as evidenced by His178 participating in binding the phosphate moiety of glucose-6-phosphate and Asp177 stabilizing the positive charge of His240 in the transition state which functions as the general base in the reaction (Cosgrove et al. 1998; Levy 1979, 1989; Naylor et al. 2001; Olive and Levy 1971; Olive et al. 1971; Rowland et al. 1994). This catalytic triad was conserved in all G6PDs from archaea, bacteria, and eukaryote domains (Fig. 1). Similar to its counterparts from thermophiles, TtG6PD prefers NADP+ as the cofactor, although NAD+ can be accepted in some extent. The Km value of TtG6PD (0.10 ± 0.01 mM for NADP+; 4.37 ± 0.56 mM for NAD+) is comparable to that of TmG6PD (0.04 mM for NADP+; 12 mM for NAD+) and AeG6PD (0.16 ± 0.04 mM for NADP+; 2.1 ± 0.4 mM for NAD+). Considering the + + K+ mNAD/KmNADP value of 10–40, NADP is more likely the physiological electron acceptor used by these G6PDs. The TtG6PD showed an optimal NADP+-linked reaction temperature of 80 °C, which was 5 °C higher than the optimal growth temperature of T. tengcongensis MB4. Similar results were observed in the characterization of thermostable G6PDs from A. aeolicus and T. maritima (Hansen et al.

2002; Iyer et al. 2002). A. aeolicus and T. maritima grow optimally at 85 and 80 °C, and their G6PDs displayed the optimal activity (NADP+-linked) at 90 and 92 °C, respectively. The phenomenon that the G6PD optimal reaction temperature is higher than corresponding optimal growth temperature is also observed in eukaryotes (Hu et al. 2013; Verma et al. 2013). This characteristic may confer on G6PDs the ability to produce more NADPH, a key component in cellular antioxidation systems, to counteract the oxidative stress resulting from the elevated temperature (Ying 2008). The dual coenzyme-specific G6PDs were found in the bacteria that have an incomplete glycolytic or gluconeogenetic pathway, for example, L. mesenteroides (Rowland et al. 1994) or A. aeolicus (Hansen et al. 2002). The genome of T. tengcongensis did not show the presence of genes encoding fructose-1,6-bisphosphatase, an essential enzyme of the gluconeogenetic pathway (Bao et al. 2002; Wang et al. 2004). Therefore, the dual coenzyme specificity of the G6PD may also play a role in balancing the coenzyme demands and making up the disadvantage from the incomplete gluconeogenetic pathway in T. tengcongensis.

13

Extremophiles

Fig. 4  Effects of temperature and pH on TtG6PD activity and stability. a Activity was measured in 100 mM Na2HPO4–citric acid buffer (pH 7.8) at various temperatures (30–85 °C) in both NAD+and NADP+-linked reaction. b Activity was measured at 70 °C in 100 mM Na2HPO4–citric acid (pH 3.6–8.0) or Na2HPO4–HCl buffer (pH 8.2–11.1) in both NAD+- and NADP+-linked reaction. c The recombinant TtG6PD was incubated at 70 °C (triangles), 80 °C

Fig. 5  TtG6PD worked as a coupling enzyme for GtGlK activity detection. A reaction system containing 100 mM Na2HPO4-citric acid (pH 7.8), 20 mM glucose, 5 mM ATP, 5 mM MgCl2, 2 mM NAD, and 5 μg/mL TtG6PD was used to detect the GtGlK activity

(circles), and 85 °C (squares) at different time intervals in 100 mM Na2HPO4–citric acid (pH 7.8) buffer. d The enzyme was incubated in 100 mM Na2HPO4–citric acid (pH 3.6–8.0) or Na2HPO4–HCl buffer (pH 8.2–11.1) at 70 °C for 1 h. The residual activity (c, d) was measured at 70 °C in 100 mM Na2HPO4–citric acid (pH 7.8) with NAD+ as coenzyme

The NaH2PO4–HCl (pH 8.0–11.5) buffer was used to screen the optimal pH range mainly because it kept a good continuity with Na2HPO4–citric acid buffer (pH 3.6– 8.0) in pH higher than 8.0, though it had weaker buffering ability. The fact that the TtG6PD was barely affected by most metal ions facilitated its utilization in different buffer conditions used in the biochemical assays. TtG6PD was chose to determine the GtGlK kinetics because it was more thermostable than GtGlk and could use NAD+ as cofactor. The TtG6PD optimal temperature in NAD+linked reaction was 70, 5 °C higher than that of GtGlk. The good thermostability and similar optimal temperature made TtG6PD maintain stability and relatively high activity in the coupling assay of GtGlK. The price of NAD+ is 10 times cheaper than NADP +. Therefore, TtG6PD will be a good candidate for measuring ATP or glucose in high temperature when coupled with a moderately thermostable glucokinase like GtGlK.

13

Extremophiles

In conclusion, the G6PD from T. tengcongensis MB4 was successfully cloned, expressed, purified, and characterized. The recombinant TtG6PD purified by His-tag affinity chromatography displayed a subunit molecular weight of 60 kDa. The enzyme exhibited dual coenzyme specificity and moderate thermostability, making it a good coupling enzyme for glucokinase or hexokinase kinetics determination. The optimal temperature and pH were determined in both NAD+- and NADP+-linked reactions. TtG6PD shared similar optimal pH range in NAD+ and NADP+-linked reactions, whereas its optimal reaction temperature in the NADP+-linked reaction was higher than that in the NAD+linked reaction and its optimal growth temperature. Acknowledgments  This work was supported by TMO Renewables Limited and Ministry of Science and Technology of China (Grant 2013CB734001).

References Bao QY, Tian YQ, Li W, Xu ZY, Xuan ZY, Hu SN, Dong W, Yang J, Chen YJ, Xue YF, Xu Y, Lai XQ, Huang L, Dong XZ, Ma YH, Ling LJ, Tan HR, Chen RS, Wang J, Yu J, Yang HM (2002) A complete sequence of the T. tengcongensis genome. Genome Res 12(5):689–700 Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248–254 Bruins ME, Janssen AEM, Boom RM (2001) Thermozymes and their applications—a review of recent literature and patents. Appl Biochem Biotech 90(2):155–186 Cheng HR, Jiang N (2006) Extremely rapid extraction of DNA from bacteria and yeasts. Biotechnol Lett 28(1):55–59 Conway T (1992) The Entner-Doudoroff pathway: history, physiology and molecular biology. FEMS Microbiol Rev 9(1):1–27 Cosgrove MS, Naylor C, Paludan S, Adams MJ, Levy HR (1998) On the mechanism of the reaction catalyzed by glucose 6-phosphate dehydrogenase. Biochemistry-US 37(9):2759–2767 Cui Y, Barford JP, Renneberg R (2008) Amperometric trienzyme ATP biosensors based on the coimmobilization of salicylate hydroxylase, glucose-6-phosphate dehydrogenase, and hexokinase. Sensor Actuat B-Chem 132(1):1–4 Hansen T, Schlichting B, Schonheit P (2002) Glucose-6-phosphate dehydrogenase from the hyperthermophilic bacterium Thermotoga maritima: expression of the g6pd gene and characterization of an extremely thermophilic enzyme. FEMS Microbiol Lett 216(2):249–253 Hu W, Zhi L, Zhuo MQ, Zhu QL, Zheng JL, Chen QL, Gong Y, Liu CX (2013) Purification and characterization of glucose 6-phosphate dehydrogenase (G6PD) from grass carp (Ctenopharyngodon idella) and inhibition effects of several metal ions on G6PD activity in vitro. Fish Physiol Biochem 39(3):637–647 Iyer RB, Wang JQ, Bachas LG (2002) Cloning, expression, and characterization of the gsdA gene encoding thermophilic glucose6-phosphate dehydrogenase from Aquifex aeolicus. Extremophiles 6(4):283–289 Iyer R, Pavlov V, Katakis I, Bachas LG (2003) Amperometric sensing at high temperature with a “wired” thermostable glucose6-phosphate dehydrogenase from Aquifex aeolicus. Anal Chem 75(15):3898–3901

13

Kelley LA, Sternberg MJ (2009) Protein structure prediction on the Web: a case study using the Phyre server. Nat Protoc 4(3):363–371 Kusumoto M, Kishimoto T, Nishiya Y (2010) Improvement of thermal stability of Leuconostoc pseudomesenteroides glucose6-phosphate dehydrogenase. J Anal Bio-Sci 33(4):397–400 Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG (2007) Clustal W and Clustal X version 2.0. Bioinformatics 23(21):2947–2948 Lee WH, Kim MD, Jin YS, Seo JH (2013) Engineering of NADPH regenerators in Escherichia coli for enhanced biotransformation. Appl Microbiol Biotechnol 97(7):2761–2772 Levy HR (1979) Glucose-6-phosphate dehydrogenases. Adv Enzymol Relat Areas Mol Biol 48:97–192 Levy HR (1989) Glucose-6-phosphate-dehydrogenase from Leuconostoc mesenteroides. Biochem Soc T 17(2):313–315 McCarthy JK, O’Brien CE, Eveleigh DE (2003) Thermostable continuous coupled assay for measuring glucose using glucokinase and glucose-6-phosphate dehydrogenase from the marine hyperthermophile Thermotoga maritima. Anal Biochem 318(2):196–203 Naylor CE, Gover S, Basak AK, Cosgrove MS, Levy HR, Adams MJ (2001) NADP(+) and NAD(+) binding to the dual coenzyme specific enzyme Leuconostoc mesenteroides glucose 6-phosphate dehydrogenase: different interdomain hinge angles are seen in different binary and ternary complexes. Acta Crystallogr D 57:635–648 Olive C, Levy HR (1971) Glucose 6-phosphate dehydrogenase from Leuconostoc mesenteroides—physical studies. J Biol Chem 246(7):2043–2046 Olive C, Geroch ME, Levy HR (1971) Glucose 6-phosphate dehydrogenase from Leuconostoc mesenteroides—kinetic studies. J Biol Chem 246(7):2047–2057 Purich DL (2010) Enzyme kinetics: catalysis and control: a reference of theory and best-practice methods. Elsevier, Amsterdam Rowland P, Basak AK, Gover S, Levy HR, Adams MJ (1994) The three-dimensional structure of glucose 6-phosphate dehydrogenase from Leuconostoc mesenteroides refined at 2.0 A resolution. Structure 2(11):1073–1087 Srivastava PK, Singh S (2013) Immobilization and applications of glucose-6-phosphate dehydrogenase: a review. Prep Biochem Biotechnol 43(4):376–384 Stanton RC (2012) Glucose-6-phosphate dehydrogenase, NADPH, and cell survival. IUBMB Life 64(5):362–369 Stover NA, Dixon TA, Cavalcanti AR (2011) Multiple independent fusions of glucose-6-phosphate dehydrogenase with enzymes in the pentose phosphate pathway. PLoS One 6(8):e22269 Uppada V, Bhaduri S, Noronha SB (2014) Cofactor regeneration—an important aspect of biocatalysis. Curr Sci India 106(7):946–957 Verma A, Suthar MK, Doharey PK, Gupta S, Yadav S, Chauhan PMS, Saxena JK (2013) Molecular cloning and characterization of glucose-6-phosphate dehydrogenase from Brugia malayi. Parasitology 140(7):897–906 Wang J, Xue Y, Feng X, Li X, Wang H, Li W, Zhao C, Cheng X, Ma Y, Zhou P, Yin J, Bhatnagar A, Wang R, Liu S (2004) An analysis of the proteomic profile for Thermoanaerobacter tengcongensis under optimal culture conditions. Proteomics 4(1):136–150 Xue YF, Xu Y, Liu Y, Ma YH, Zhou PJ (2001) Thermoanaerobacter tengcongensis sp nov., a novel anaerobic, saccharolytic, thermophilic bacterium isolated from a hot spring in Tengcong, China. Int J Syst Evol Microbiol 51:1335–1341 Ying W (2008) NAD+/NADH and NADP+/NADPH in cellular functions and cell death: regulation and biological consequences. Antioxid Redox Signal 10(2):179–206