Extremophiles (2014) 18:441–450 DOI 10.1007/s00792-014-0629-x

ORIGINAL PAPER

Cloning, expression and characterization of a novel cold-active and halophilic xylanase from Zunongwangia profunda Xiaoshuang Liu • Zongqing Huang • Xiangnan Zhang • Zongze Shao • Ziduo Liu

Received: 18 June 2013 / Accepted: 7 January 2014 / Published online: 25 January 2014 Ó Springer Japan 2014

Abstract A new xylanase gene (xynA) from the marine microorganism Zunongwangia profunda was identified to encode 374 amino acid residues. Its product (XynA) showed the highest identity (42.78 %) with a xylanase from Bacillus sp. SN5 among the characterized xylanases. XynA exhibited the highest activity at pH 6.5 and 30 °C, retaining 23 and 38 % of the optimal activity at 0 and 5 °C, respectively. XynA was not only cold active, but also halophilic, and both its activity and thermostability could be significantly increased by NaCl, showing the highest activity (180 % of the activity) at 3 M NaCl and retaining nearly 100 % activity at 5 M NaCl, compared to the absence of NaCl. In the presence of 3 M NaCl, the kcat/Km value of XynA exhibited a 3.41-fold increase for beechwood xylan compared to no added NaCl, and the residual activity of XynA increased from 23 % (no added NaCl) to 58 % after 1 h incubation at 45 °C. This may be the first report concerning a cold-adapted xylanase from a nonhalophilic species that displays the highest activity at a NaCl concentration range from 3 to 5 M. The features of

Communicated by F. Robb.

Electronic supplementary material The online version of this article (doi:10.1007/s00792-014-0629-x) contains supplementary material, which is available to authorized users. X. Liu  Z. Huang  X. Zhang  Z. Liu (&) State Key Laboratory of Agricultural Microbiology, College of Life Science and Technology, Huazhong Agricultural University, Wuhan 430070, China e-mail: [email protected] Z. Shao Key Laboratory of Marine Biogenetic Resources, The Third Institute of Oceanography, State of Oceanic Administration, Xiamen 361005, People’s Republic of China

cold activity and salt tolerance suggest the potential application of XynA in the food industry and bioethanol production from marine seaweeds. Keywords Xylanase  Cold activity  Salt tolerance  Zunongwangia profunda

Introduction Hemicellulose is the second most common component of biomass and thus represents a large source of renewable substrate (Ward et al. 1989). The major component of hemicellulose in most species is xylan (Ahmed et al. 2009; Bajpai 1997), and the complete hydrolysis of xylan requires a large variety of cooperatively acting enzymes due to its heterogeneity and complexity (Collins et al. 2005). Among them, endo-1,4-b-D-xylanase (EC 3.2.1.8) is a crucial component that randomly cleaves the xylan backbone to produce xylooligosaccharides. Based on the amino acid sequences of their catalytic domains, endo-b1,4-xylanases are normally reported to belong to glycoside hydrolase (GH) families 10 and 11 (Henrissat and Bairoch 1996; Juturu and Wu 2012). In recent years, there has been a sharp increase in research efforts for the biotechnological exploitation of cold-active enzymes (Wang et al. 2012). Cold-adapted xylanases are most active at low and intermediate temperatures and thus can facilitate biotechnological processes where heating is economically counterproductive or where low temperatures are required to avoid alteration of ingredient and/or product quality (e.g., flavor, color, etc.), to avoid microbial development and fermentation and/or to avoid product denaturation (Collins et al. 2005). Coldadapted xylanases are also usually used in the food

123

442

industry, such as in wheat flour for improving dough handling and quality of baked products (Butt et al. 2008). Besides, there is also a growing research interest in halophilic/halotolerant microorganisms in environments such as deep sea (Oren 2002). Marine microorganisms are not only attractive sources of natural products, but also the sources of valuable genes and useful industrial enzymes. Enzymes from marine strains were discovered to possess special characteristics of salt tolerance and cold adaptation due to their unique ecological habitats (Trincone 2011). Halophilic/halotolerant xylanases derived from bacteria living in marine or saline environments are considered to have potential industrial applications (Setati 2010). For example, xylanases with salt tolerance might be used in wastewater treatment and the degradation of marine products (Liu et al. 2012). Additionally, the production of bioethanol from seaweeds is considered a new idea which can be evaluated in terms of sustainability and environmental conservation (Khandeparker et al. 2011). However, to the best of our knowledge, only one report has been published on xylanase with both cold activity and salttolerance (Guo et al. 2009). Zunongwangia profunda (Z. profunda) (MCCC 1A01486) was isolated from the surface seawater in the coast of Fujian, China. 16S rRNA sequence analysis indicated that it showed a 99.97 % identity with Z. profunda SM-A87 which was reported in 2007. Z. profunda SM-A87 was isolated from deep-sea sediment samples taken from near the southern Okinawa Trough at a water depth of 1,245 m and formed a distinct lineage within the family Flavobacteriaceae. Growth occurs at 4–38 °C (25–30 °C optimum), at pH 5.0–8.5 (Qin et al. 2007). It is a moderate halophile and has many special properties to adapt to a cold and marine salty environment (Qin et al. 2010). Here, we report a xylanase gene that was directly cloned from the genomic DNA of Z. profunda and was expressed in Escherichia coli (E.coli). Further characterization analysis indicated that this xylanase was cold active and more halophilic than any other known cold-active xylanases.

Materials and methods Materials The substrate beechwood xylan was purchased from Sigma (X4252) (Germany). Restriction enzymes, T4 DNA ligase, Taq polymerase and fast pfu polymerase were purchased from Takara (Dalian, China). DNA purification kits were purchased from Axygen (USA). Bradford protein assay kits and GST bind purification kits were obtained from Shanghai Sangon Biotech Co. (Shanghai, China) and Novagen Co. (Germany), respectively. All other chemicals used were analytical grade reagents.

123

Extremophiles (2014) 18:441–450

Strains, vectors and culture conditions Z. profunda was supplied by the marine culture collection of China (MCCC 1A05249). The strain was grown in Luria–Bertani (LB) medium with 2 % (w/v) NaCl at 28 °C. The pGEX-6p-1 vector was used for gene cloning and expression. E.coli strains DH5a and BL21 were used to gene clone and expression of the xylanase gene, respectively. All the transformants were cultivated in LB medium or LB agar plate at 37 °C with ampicillin (100 lg/ml). Gene analysis The recombinant plasmid pGEX-6p-XynA was sequenced by GenScript (Nanjing, China). The DNA and protein sequence alignments were carried out using the BLASTN and BLASTP programs (http://blast.ncbi.nlm.nih.gov/ Blast), and the multiple sequence alignments were performed using the ClustalW program. Cloning of xylanase gene To amplify the xylanase gene by PCR, primers XynA-F and XynA-R with BamHI and XhoI (underlined), respectively, were designed as listed below based on the 50 end and 30 end of the xylanase gene (Gene ID: 9078911) of Z. profunda SM-A87 whose genomic sequence has been reported (Qin et al. 2010): XynA-F: CGCGGATCCATGAAACATAAAAAACAA CTGCACTATC XynA-R: CCGCTCGAGCTACTTTTTACTGAATTTG ATAACTGAA. The PCR was performed using the genomic DNA of Z. profunda as template. The amplified xylanase gene and the pGEX-6p-1 plasmid were digested with BamHI and XhoI restriction enzymes and gel purified. Subsequently, the purified products were ligated and transformed into E.coli DH5a. The positive transformant harboring pGEX-6pXynA was grown in LB solid medium containing 100 lg/ ml ampicillin at 37 °C. The plasmid was extracted, purified by agarose gel and sequenced. Finally, the pGEX-6p1expression vector was designed to express the xylanase enzyme fused to a GST tag at the C-terminus. Homology searches were performed against the sequences in the GenBank database using the BLASTP program. Expression and purification of XynA The recombinant plasmid pGEX-6p-XynA was transformed into E.coli BL21 (DE3) competent cells and grown at 37 °C in LB liquid culture containing 100 lg/ml ampicillin. When the culture reached an optical density of 0.8–1.0 at A600, isopropyl-b-D-thiogalactopyranoside

Extremophiles (2014) 18:441–450

(IPTG) was added to a final concentration of 0.1 mM to induce protein expression. After incubation at 22 °C for another 12 h, the culture was harvested by centrifugation at 8,0009g, 4 °C for 5 min. The precipitate was resuspended in 50 mM phosphate-buffered saline (pH 6.5) containing 140 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4 and 1.8 mM KH2PO4, and lysed by sonication. After 30 min centrifugation at 12,0009g and 4 °C, the supernatant of the lysate was collected and the glutathione-S-transferase (GST)-tagged xylanase was purified by following the manufacturer’s instructions (Amersham Biosciences). The GST–XynA fusion protein was bonded to glutathione affinity resins and washed with phosphate-buffered saline (pH 7.0) at 4 °C to remove other proteins until no other proteins were detected. Then 3C protease (10 U/ll, PreScission; Pharmacia) was used to release the target protein from the GST-tag attached to the column. Although the 3C protease remained in the purified xylanase solution, the quantity of protease used was very small and had no effect on the activity of the xylanase. Finally, the purity of the protein was determined by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE; 12 % running gel) and was quantified by densitometric analysis. Gels were visualized and photographed under white light, and optical densities of the bands were analyzed using the software of BandScan 5.0 (BandScan, version 5.0, Glyko Inc., Scan Leandro, USA). Enzyme assay and protein concentration determination Xylanase activity was examined by measuring the release of reducing sugar from xylan using the 3,5-dinitrosalicylic acid (DNS) method (Miller 1959). The standard reaction mixture consisted of 10 ll enzyme and 90 ll beechwood xylan resuspended in citrate phosphate buffer (0.1 M citric acid0.2 M Na2HPO4) (pH 6.5). After 10 min incubation at 30 °C, the reaction was stopped by adding 100 ll DNS, and then the mixture was boiled for 10 min. After cooling to room temperature, 150 ll of the 200 ll reaction mixture was measured in each well on a 96-well plate reader at the absorption of 540 nm. One unit (U) of enzyme activity was defined as the amount of enzyme capable of releasing 1 lM of xylose per minute under the standard procedure. The protein concentration was determined by the Bradford method (Bradford 1976), using bovine serum albumin as standard. Enzyme characterization The linearity of xylanase activity of XynA with time under standard reaction conditions was determined by incubating 10 ll of enzyme solution in 90 ll of citrate phosphate buffer (pH 6.5) containing 1 % (w/v) beechwood xylan at 30 °C for different periods of time (0–35 min).

443

The apparent optimal pH of XynA was evaluated over a pH range of 3.0–9.0, using citrate phosphate buffer (0.1 M citric acid–0.2 M Na2HPO4) of pH 3.0–8.0, and H2BO3–NaOH of pH 8.0–9.0. The xylanase activity was assayed by incubating 10 ll of enzyme solution in 90 ll of different pH buffers containing 1 % (w/v) beechwood xylan at 30 °C for 10 min. The enzyme stability at different pH values was determined by measuring the residual activity of XynA in citrate phosphate buffer (pH 6.5) at 30 °C for 10 min after 1 h incubation of the enzyme at 30 °C in buffers at pH 3.0–9.0. The apparent optimal temperature for xylanase activity of XynA was determined by incubating 10 ll of enzyme solution in 90 ll of citrate phosphate buffer (pH 6.5) containing 1 % (w/v) beechwood xylan at temperatures ranging from 0 to 45 °C. For the temperature stability study, the enzyme was incubated at different temperatures (30, 35, 40 and 45 °C) for different periods of time (0–60 min) and then immediately placed in ice water for cooling. The residual activity was assayed at 30 °C in citrate phosphate buffer (pH 6.5) for 10 min. The effect of NaCl on the purified xylanase activity was measured in citrate phosphate buffer (pH 6.5) containing various concentrations of NaCl (0-5 M). The enzyme stability at different NaCl concentrations was determined by diluting the purified enzyme tenfold into 100 ll citrate phosphate buffer (pH 6.5) containing a 0–5 M concentration of NaCl and then incubating the mixture at 30 °C for 2 h. The residual activity was measured under the standard assay conditions as described above. For each assay, a negative control without enzyme was assayed under the same NaCl concentration. The effect of NaCl on the xylanase thermostability was evaluated by diluting the purified enzyme with 3 M NaCl, and then incubating the mixture at 30, 35, 40 and 45 °C for different periods of time (0–60 min). The residual activity of XynA was measured under standard assay conditions as described above. The kinetic properties of xylanase were determined in the citrate phosphate buffer (pH 6.5) containing different concentrations of beechwood substrate at 30 °C for 10 min. The effect of NaCl on the kinetic properties was evaluated at 30 °C for 10 min in the citrate phosphate buffer (pH 6.5) containing different concentrations of beechwood substrate and 3 M NaCl. The Km and Vmax values were calculated with Graphpad Prism software (Graphpad, San Diego, CA), using standard settings for non-linear regression curve fitting in Michaelis–Menten modus. The kcat parameter was determined using the equation kcat = Vmax/[E]. Each experiment was conducted in triplicate. Structural modeling To uncover the surface electrostatic potential of XynA, we generated a three-dimensional (3D) structural model using

123

444

Molecular Operating Environment (MOE) (The Chemical Computing Group, Inc). Based on the model, the electrostatic potential surface of XynA was visualized using the MOLCAD module within the software SYBYL.

Extremophiles (2014) 18:441–450

Expression and purification of XynA

The fluorescence spectra were obtained with a model RF5301 spectrofluorophotometer (Shimadzu, Kyoto, Japan). Intrinsic fluorescence was measured using an excitation wavelength of 280 nm. Excitation and emission slit widths were both 5 nm. The emission spectra were recorded in the range between 295 and 450 nm. The samples were preincubated for 1 h at 45 °C in 0 and 3 M NaCl, respectively.

The xynA gene was cloned into the vector pGEX-6p-1 and expressed in E.coli BL21 (DE3). The xylanase was then harvested and purified from E.coli BL21 (DE3)/pGEX-6pXynA lysates. After induction with IPTG at 22 °C, the protein was purified by GST chromatography and a single band was observed by SDS-PAGE analysis (Fig. 1, lane 5), and the purified protein was estimated to about 44 kDa, which was close to the predicted size (43.7 kDa) (predicted by the Lasergene program EditSeq (Nystuen 2000)). SDSPAGE and BandScan analyses showed that the target proteins were highly purified (91 %), and Bradford protein assay found that the protein concentration was 0.27 mg/ml.

Molecular mass determination

Characterization of XynA

The molecular mass of the purified xylanase was estimated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) using standard protein markers (Laemmli 1970). Protein bands were visualized by Coomassie blue staining.

With the substrate concentration of 10 mg/ml, a linear relationship between the enzyme activity and the time over a range of 0–35 min was obtained. As shown in Fig. 2, a strong linear relationship between the enzyme activity and the time (0–13 min) could be observed from the plots of these initial rates, and the best reaction time was found to be 10 min. The purified xylanase was used for the characterization analysis. Under standard conditions, XynA showed optimal xylanase activity at pH 6.5 (Fig. 3a). After 1 h incubation in different buffers at 30 °C, xylanase was stable at pH 5.5–7.5, retaining around 83 % of the optimal activity (Fig. 3b).

Fluorescence spectroscopy

Results and discussion Gene cloning and sequence analysis The xylanase gene xynA (1,125 bp) was cloned from the genomic DNA of Z. profunda, encoding a protein of 374 amino acid residues and the molecular mass of the protein was predicted to be 43.7 kDa. No signal peptide was predicted for this protein by the SignalP 3.0 Server (http:// www.cbs.dtu.dk/services/SignalP/). DNA sequencing and BLAST analysis revealed that xynA had an identical nucleotide sequence with an endo-beta-1,4xylanase gene (Gene ID: 9078911) of Z. profunda SM-A87. The sequence alignment indicated that XynA showed the highest similarity to xylanase from GH10 family. The deduced amino acids of XynA showed the highest identity (42.78 %) with the xylanase (Xyn10A) from Bacillus sp. SN5 (AGA16736.1) and the endoxylanase (XynBE18) from Paenibacillus sp. E18 (ACY69972). It also exhibited a 42.25 % identity with the thermophilic xylanase (Xt6) from Geobacillus stearothermophilus (2Q8X_A) and the endo-b-1,4-xylanase (XynA) from Bacillus sp. (CAA84631.1), 41.76 % identity with KRICT PX1 from Paenibacillus sp. HPL-001 (ACJ06666.1) and 41.71 % identity with the endo-1,4-b-xylanase (XynAHJ2) from Bacillus sp. HJ2 (AFE82288.1), suggesting the novelty of XynA. Further alignment indicated that XynA contained two highly conserved catalytic residues (Glu169 and Glu276) that were crucial for the activity of GH 10 xylanase (additional data are given in Online Resource 1).

123

Fig. 1 SDS-PAGE analysis of purified XynA enzyme. Lane 1 molecular weight markers. Lane 2 the induced cell lysate of E. coli BL21 (DE3) harboring the pGEX-6p-1 plasmid. Lane 3 the uninduced cell lysate of E. coli BL21 (DE3) harboring the pGEX-6p-XynA; lane 4 the induced cell lysate of E. coli BL21 (DE3) harboring the pGEX6p-XynA; and lane 5 the purified xylanase

Extremophiles (2014) 18:441–450

445

Fig. 2 Catalytic activity of XynA over different reaction time periods. The assay was carried out in citrate phosphate buffer (pH 6.5) at 30 °C for different periods of time

Fig. 3 The optimal pH and stability of the recombinant XynA. a The effect of pH on XynA activity. The activity was assayed at 30 °C in buffers containing 1 % beechwood xylan within a pH range of 3.0–9.0. b The effect of pH on the stability of XynA. The activity was measured under the standard procedure after the enzyme was incubated in different pH buffers at 30 °C for 1 h. Each value represents the average of triplicate experiments. Error bars represent the standard deviation

The optimal temperature for enzyme activity at pH 6.5 was 30 °C (Fig. 4a). XynA retained 23 and 38 % activity at 0 and 5 °C, respectively. XynA retained about 50 %

Fig. 4 The optimal temperature and stability of xylanase of the recombinant XynA with and without NaCl. a The effect of temperature on the activity of XynA. The assay was performed at pH 6.5 in citrate phosphate buffer at 0–45 °C. b The effect of temperature on the stability of XynA. The enzyme was incubated at 30, 35, 40 and 45 °C for different periods of time, and then the residual activity was assayed under standard conditions. c The effect of NaCl on the thermostability of XynA. The purified enzyme was diluted in 3 M NaCl, and the residual activity of XynA was measured after 0–60 min incubation at 30, 35, 40 and 45 °C, respectively. Each value represents the average of triplicate experiments. Error bars represent the standard deviation

activity at 40 °C for 40 min and 23 % activity at 45 °C for 10 min, but retained nearly 100 and 88 % activity after 60 min incubation at 30 and 35 °C, respectively (Fig. 4b).

123

446

Extremophiles (2014) 18:441–450

Based on the few cold-active xylanases that have been characterized so far, the common features of such xylanases are a low optimal temperature, usually ranging from 20 to 30 °C, and high activity at low temperature, usually retaining 10–40 % activity at 0 or 4 °C (Guo et al. 2009; Lee et al. 2006a; Wang et al. 2011). In this respect, XynA shared the same optimal temperature with XynGR40 from the environmental DNA of goat rumen contents (Wang et al. 2011), XynA from Glaciecola mesophila (G. mesophila) KMM 241 (Guo et al. 2009), and Xyn10 from Flavobacterium sp. (Lee et al. 2006b). Another feature of the cold-active enzymes is thermolability, which might account for the highly flexible structures found in some of these enzymes (Collins et al. 2005). All the GH 10 coldactive xylanases known are thermolabile at a temperature over 45 °C. By contrast, XynA has a lower thermostability than XynGR40, which retains 86.8 % of activity after 1 h incubation at 45 °C, and Xyn10, which retains about 50 % activity at 45 °C for 40 min. But XynA is more thermostable than XynA from G. mesophila KMM 241, which can only retain 20 % of activity after 60 min incubation at 30 °C, and XB from Cryptococcus adeliae, which retains about 50 % activity at 30 °C for 60 min (Petrescu et al. 2000) (Table 1). There are some models to explain cold activity, but many researchers believe that the key to temperature adaptation is a change in the relative flexibility of the enzyme. As previously reported (Feller and Gerday 1997;

Russell 2000), when compared with mesophilic homologs, several cold-active enzymes usually had a lower Arg molar ratio or Arg/Lys ratio. The structural properties of arginine certainly accounted for the low Arg molar ratio or Arg/Lys ratio in cold-active enzymes (Sheridan et al. 2000). With the presence of more lysine than arginine in XynA (Table 2), the ratio (Arg/Lys) was significantly lower than that of xylanases from thermophiles, which might account for the flexibility of XynA. Additionally, proline could restrict backbone rotations, so there was usually a small amount of proline (3.74 % of the amino acids in XynA) in cold-active enzyme to destabilize the enzyme. Therefore, the lower ratio of Arg/Lys and lower content of proline might account for the flexibility and poor thermostability of XynA. The activity of XynA was significantly increased from 0.5 to 4.5 M NaCl, with the highest activity (135–180 %) observed at around 1.5-3 M NaCl, peaking at 3 M. Even at 5 M NaCl, the residual activity was still nearly 100 % (Fig. 5a). After 2 h incubation in NaCl solutions (0–5 M) at 30 °C, the enzyme activity increased to about 113 % at 0.5 M NaCl, peaked (128 %) at 1 M, and remained almost constant (around 100 % activity) with 3–5 M NaCl (Fig. 5b). To date, only a few halophilic xylanases isolated from microorganisms have been reported, such as XynAHJ3 from actinomycete Lechevalieria sp. HJ3 (Zhou et al. 2012), M11 from Streptomyces viridochromogenes strain

Table 1 The comparison of thermostability between different xylanases Parameter

XynA

XynA

XynA (with 3 M NaCl)

XynA

XB

XynGR40

Xyn10

Optimal temperature (°C)

30

30

30

30

_

30

30

Thermostability

100 % (1 h, 30 °C)

23 % (1 h, 45 °C)

58 % (1 h, 45 °C)

20 % (1 h, 30 °C)

50 % (1 h, 30 °C)

86.8 % (1 h, 45 °C)

50 % (40 min, 45 °C)

References

Present work

Present work

Present work

Bai et al. (2012)

Petrescu et al. (2000)

Wang et al. (2011)

Lee et al. (2006a, b)

Table 2 Differences between the amino acid compositions of XynA and other thermophilic xylanases Parameters

XynA

Xyn

XynA

XynB

Tmxb

XynAHJ3

Amino acid identity to XynA (%)

100

42.25

11.17

34.61

30.97

27.94 70

Topt (°C)

30

70

100

80

105

Arginine (%)/lysine (%)

4.28/11.23

6.95/4.53

4.44/8.33

4.91/6.98

4.57/8.54

6.81/4.63

Proline percent (%)

3.74

4.23

5.83

5.43

3.66

4.9

Reference

Present work

Wu et al. (2006)

Sunna and Bergquist (2003)

Fukumura et al. (1995)

Winterhalter and Liebl (1995)

Zhou et al. (2012)

123

Extremophiles (2014) 18:441–450

Fig. 5 Salt activation and salt tolerance of XynA. a The effect of NaCl on the activity of XynA. The enzyme activity was measured at 30 °C at pH 6.5 containing 0–5 M NaCl. b The effect of NaCl on the stability of XynA. The enzyme was incubated with 0–5 M NaCl (pH 6.5) at 30 °C for 2 h. The residual activity of XynA was assayed under standard conditions. The enzyme without incubation was taken as control. The error bars represent the standard deviations of three measurements

(Liu et al. 2012), the halotolerant xylanase from Bacillus subtilis cho40 (Khandeparker et al. 2011), XynFCB and XynA from Thermoanaerobacterium saccharolyticum (T. saccharolyticum) NTOU1 (Hung et al. 2011a, b), the xylanase from Bacillus pumilus (B. pumilus) strain, and GESF-1 (Menon et al. 2010) and XynA from G. mesophila KMM 241 (Guo et al. 2009). However, compared with the aforementioned xylanases, only XynA from Z. profunda showed optimal activity at 3 M NaCl, and maintained nearly 100 % activity at 5 M NaCl. XynA from T. saccharolyticum NTOU1 was reported to have the highest salt activation, exhibiting a 0.9-fold increase in activity with 0.4 M NaCl, while XynA possessed similar efficiency with 3 M NaCl and showed a greater salt tolerance than XynA from T. saccharolyticum NTOU1, which could maintain activity with 1 M NaCl. Furthermore, at a higher NaCl concentration (5 M), XynA could retain nearly 100 % activity while M11 could retain only 47 % activity. The kinetic parameters for XynA were assayed with and without additional 3 M NaCl using beechwood xylan as

447

substrate at 30 °C and pH 6.5. In the absence of additional NaCl, the Km and kcat values were 2.98 mg/ml and 47.26 s-1, respectively, while in the presence of 3 M NaCl, the Km and kcat values were 1.15 mg/ml and 80.33 s-1, respectively. Thus, the Km, kcat and kcat/Km values of the latter were 0.39-, 1.7- and 4.41-fold of the values of the former, indicating that the enzyme activity was significantly enhanced in the presence of NaCl. Furthermore, the Km value (2.98 mg/ml) of XynA for beechwood xylan was lower than that of several other salttolerant xylanases, such as 13 mg/ml for XynFCB from T. saccharolyticum NTOU1 toward beechwood xylan at 30 °C (Hung et al. 2011b), 5.3 mg/ml for the xylanase from the Marine B. pumilus strain, GESF-1, using birchwood xylan as substrate (Menon et al. 2010), and 11.6 mg/ ml for ThxynA from Thermobifida halotolerans YIM 90462T, using oat spelt xylan as substrate (Zhang et al. 2012). However, XynA had a higher Km value than xylanase T-6 from Bacillus stearothermophilus T-6 (1.63 mg/ ml, against oat spelt xylan) (Khasin et al. 1993) and XynA from G. mesophila KMM 241 (1.22 mg/ml, using beechwood xylan as substrate) (Guo et al. 2009), but XynA had a lower Km value (1.15 mg/ml) than either of them in the presence of 3 M NaCl. All these data indicated that XynA exhibited higher salt activation and catalytic efficiency. Interestingly, NaCl could enhance not only the activity, but also the thermostability of XynA. After 1 h incubation at 40 °C, XynA retained 67 % activity in the presence of NaCl, but only 37 % of the activity in the absence of NaCl. After 1 h incubation at 45 °C, only 23 % activity could be detected in the absence of NaCl, but 58 % activity remained in the presence of 3 M NaCl (Fig. 4c), indicating the significant effect of NaCl on xylanase thermostability. To further verify the effect of NaCl on the thermostability of XynA, intrinsic fluorescence spectra were determined to assess global structural changes at 45 °C for 1 h with and without 3 M NaCl (Fig. 6). Intrinsic fluorescence mainly caused by tryptophan residues is widely used for structural and denaturation studies of enzymes. The fluorescence emission of XynA from Z. profunda without pre-incubation at 45 °C exhibited a maximum at around 328 nm. However the emission maximum wavelength red shifted to 332 and 344 nm with the intensity of about 62 % after the enzyme was pre-incubated at 45 °C for 1 h in 3 M NaCl and 0 M NaCl, respectively. Such red shifts, which were observed in many proteins, are caused by an increased solvent accessibility of tryptophan residues during the unfolding process. The fluorescence emission red shift can reflect the degree of protein conformation changes and they are positively correlated in a certain range. So the shifts indicated that tryptophan residues were more exposed to solvent and XynA was more loosely folded in 0 M NaCl than 3 M NaCl after pre-incubation at 45 °C for 1 h. The decrease in

123

448

Extremophiles (2014) 18:441–450

Fig. 6 Intrinsic fluorescence measurements. Fluorescence emission spectra of XynA were recorded with an excitation wavelength of 280 nm. Green (filled circle): purified XynA without incubation at 45 °C; red (filled square): XynA was incubated at 45 °C for 1 h in 3 M NaCl; blue (filled triangle): XynA was incubated at 45 °C for 1 h in 0 M NaCl

intensity with temperature reflected quenching due to greater thermal motion. There has been no report demonstrating that NaCl can affect both the activity and the thermostability of halophilic xylanase. It has been reported that the salt-tolerant proteins usually have an excess of acidic amino acids, which are usually on the surface of the protein. The acidic amino acids had a high water binding capacity and could form a solvation shell on the surface of the proteins to keep them hydrated, facilitating their adaptation to the environmental pressure that represents the high salt concentration (Fukuchi et al. 2003; Setati 2010; Van Den Burg 2003). When compared with other salt-tolerant xylanases (Table 3) that have been purified and characterized, the amino acid sequence analysis found that more acidic amino acids were present in XynA. To uncover the surface electrostatic potential of XynA, a 3D model of XynA was built. Based on the best template Itx6 (PDB code 1n82A; 42.25 % identity) which

Table 3 Differences between the amino acid composition of XynA and other salt-active xylanases Parameters

XynA

XynAHJ3

XynA

Xyn10A

XynFCB

XynA

Amino acid identity to XynA (%)

100

27.94

36.94

42.78

16.48

17.83

Acidic amino acids

16.31

10.35

12.06

15.68

14.65

12.88 33.10

a

Hydrophobic amino acids (%)

34.76

38.69

37.59

33.14

36.51

Highest activity with NaCl (%)

180

\100

120

134

160

190

Concentration of NaCl (M)b

3

none

0.5

0.5

2.1

0.4

Reference

Present work

Zhou et al. (2012)

Guo et al. (2009)

Bai et al. (2012)

Hung et al. (2011b)

Hung et al. (2011a)

a

Hydrophobic amino acids: A I L F W V

b

The concentration of NaCl at which the enzymes display the highest activity

Fig. 7 The surface electrostatic potential of XynA obtained by SYBYL. The blue surface represents higher negative electrostatic potentials and the red surface represents lower negative electrostatic potentials. The right image is the 180° rotated view of the left one

123

Extremophiles (2014) 18:441–450

is a thermophilic xylanase from G. stearothermophilus, the final model containing residues 40–371 of XynA was ˚ , indicating constructed, with a small rmsd value of 1.45 A the overall good quality of the model. The surface properties of XynA were analyzed, and the entire protein surface was found to be wrapped by negative electrostatic potential (Fig. 7). This particular charge distribution at the protein surface might enable XynA to maintain a better stability of the protein in a high salt environment than other salt-tolerant enzymes. Additionally, XynA seemed to be more deficient than others in hydrophobic amino acids. An excess of acidic amino acids and a deficiency of hydrophobic amino acids could result in structural instability (Khandeparker et al. 2011). The results in this study at least partially, if not completely, demonstrated that structural stability could be greatly enhanced by increasing NaCl concentration. In conclusion, compared to XynA from G. mesophila KMM 241, the only characterized xylanase with both coldactive and halophilic properties (Guo et al. 2009), the XynA from Z. profunda, exhibited a better thermostability, higher salt activation, greater salt tolerance and higher catalytic efficiency at 3 M NaCl. These characteristics not only make XynA from Z. profunda a good candidate for further research on the structure–function relationship, but also suggest its potential for industrial applications due to its advantages in many of the low-temperature processes, in particular, in the food industry for processing sea food and saline food, and in the production of bioethanol from marine seaweeds. Acknowledgments This study was supported by grants from the National Natural Science Foundation of China (No.J1103510).

References Ahmed S, Riaz S, Jamil A (2009) Molecular cloning of fungal xylanases: an overview. Appl Microbiol Biotechnol 84:19–35 Bai W, Xue Y, Zhou C, Ma Y (2012) Cloning, expression and characterization of a novel salt-tolerant xylanase from Bacillus sp. SN5. Biotechnol Lett 34:2093–2099 Bajpai P (1997) Microbial xylanolytic enzyme system: properties and applications. Adv Appl Microbiol 43:141–194 Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein–dye binding. Anal Biochem 72:248–254 Butt MS, Tahir-Nadeem M, Ahmad Z, Sultan MT (2008) Xylanases and their applications in baking industry. Food Technol Biotechnol 46:22–31 Collins T, Gerday C, Feller G (2005) Xylanases, xylanase families and extremophilic xylanases. FEMS Microbiol Rev 29:3–23 Feller G, Gerday C (1997) Review Psychrophilic enzymes: molecular basis of cold adaptation. CMLS Cell Mol Life Sci 53:830–841 Fukuchi S, Yoshimune K, Wakayama M, Moriguchi M, Nishikawa K (2003) Unique amino acid composition of proteins in halophilic bacteria. J Mol Biol 327:347–357

449 Fukumura M, Sakka K, Shimada K, Ohmiya K (1995) Nucleotide sequence of the Clostridium stercorarium xynB gene encoding an extremely thermostable xylanase, and characterization of the translated product. Biosci Biotech Bioch 59:40–46 Guo B, Chen XL, Sun CY, Zhou BC, Zhang YZ (2009) Gene cloning, expression and characterization of a new cold-active and salttolerant endo-b-1,4-xylanase from marine Glaciecola mesophila KMM 241. Appl Microbiol Biotechnol 84:1107–1115 Henrissat B, Bairoch A (1996) Updating the sequence-based classification of glycosyl hydrolases. Biochem J 316:695 Hung KS, Liu SM, Fang TY, Tzou WS, Lin FP, Sun KH, Tang SJ (2011a) Characterization of a salt-tolerant xylanase from Thermoanaerobacterium saccharolyticum NTOU1. Biotechnol Lett 33:1441–1447 Hung KS, Liu SM, Tzou WS, Lin FP, Pan CL, Fang TY, Sun KH, Tang SJ (2011b) Characterization of a novel GH10 thermostable, halophilic xylanase from the marine bacterium Thermoanaerobacterium saccharolyticum NTOU1. Process Biochem 46:1257–1263 Juturu V, Wu JC (2012) Microbial xylanases: engineering, production and industrial applications. Biotechnol Adv 30:1219–1227 Khandeparker R, Verma P, Deobagkar D (2011) A novel halotolerant xylanase from marine isolate Bacillus subtilis cho40: gene cloning and sequencing. New Biotechnol 28:814–821 Khasin A, Alchanati I, Shoham Y (1993) Purification and characterization of a thermostable xylanase from Bacillus stearothermophilus T-6. Appl Environ Microbiol 59:1725–1730 Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680–685 Lee CC, Kibblewhite-Accinelli RE, Wagschal K, Robertson GH, Wong DW (2006a) Cloning and characterization of a cold-active xylanase enzyme from an environmental DNA library. Extremophiles 10:295–300 Lee CC, Smith M, Kibblewhite-Accinelli RE, Williams TG, Wagschal K, Robertson GH, Wong DW (2006b) Isolation and characterization of a cold-active xylanase enzyme from Flavobacterium sp. Curr Microbiol 52:112–116 Liu Z, Zhao X, Bai F (2012) Production of xylanase by an alkalinetolerant marine-derived Streptomyces viridochromogenes strain and improvement by ribosome engineering. Appl Microbiol Biotechnol 97:4361–4368 Menon G, Mody K, Keshri J, Jha B (2010) Isolation, purification, and characterization of haloalkaline xylanase from a marine Bacillus pumilus strain, GESF-1. Biotechnol Bioproc Eng 15:998–1005 Miller GL (1959) Use of dinitrosalicylic acid reagent for determination of reducing sugar. Anal Chem 31:426–428 Nystuen A (2000) Lasergene 99. Biotech Softw Internet Rep: Computer Softw J Sci 1:192–197 Oren A (2002) Diversity of halophilic microorganisms: environments, phylogeny, physiology, and applications. J Ind Microbiol Biotechnol 28:56–63 Petrescu I, Lamotte-Brasseur J, Chessa JP, Ntarima P, Claeyssens M, Devreese B, Marino G, Gerday C (2000) Xylanase from the psychrophilic yeast Cryptococcus adeliae. Extremophiles 4:137–144 Qin QL, Zhao DL, Wang J, Chen XL, Dang HY, Li TG, Zhang YZ, Gao PJ (2007) Wangia profunda gen. nov., sp. nov., a novel marine bacterium of the family Flavobacteriaceae isolated from southern Okinawa Trough deep-sea sediment. FEMS Microbiol Lett 271:53–58 Qin QL, Zhang XY, Wang XM, Liu GM, Chen XL, Xie BB, Dang HY, Zhou BC, Yu J, Zhang YZ (2010) The complete genome of Zunongwangia profunda SM-A87 reveals its adaptation to the deep-sea environment and ecological role in sedimentary organic nitrogen degradation. BMC Genom 11:247 Russell NJ (2000) Toward a molecular understanding of cold activity of enzymes from psychrophiles. Extremophiles 4:83–90

123

450 Setati ME (2010) Diversity and industrial potential of hydrolaseproducing halophilic/halotolerant eubacteria. Afr J Biotechnol 9:1555–1560 Sheridan PP, Panasik N, Coombs JM, Brenchley JE (2000) Approaches for deciphering the structural basis of low temperature enzyme activity. BBA Protein Struct Mol 1543:417–433 Sunna A, Bergquist PL (2003) A gene encoding a novel extremely thermostable 1,4-b-xylanase isolated directly from an environmental DNA sample. Extremophiles 7:63–70 Trincone A (2011) Marine biocatalysts: enzymatic features and applications. Mar Drugs 9:478–499 Van Den Burg B (2003) Extremophiles as a source for novel enzymes. Curr Opin Microbiol 6:213–218 Wang G, Luo H, Wang Y, Huang H, Shi P, Yang P, Meng K, Bai Y, Yao B (2011) A novel cold-active xylanase gene from the environmental DNA of goat rumen contents: direct cloning, expression and enzyme characterization. Bioresour Technol 102:3330–3336 Wang SY, Hu W, Lin XY, Wu ZH, Li YZ (2012) A novel cold-active xylanase from the cellulolytic myxobacterium Sorangium

123

Extremophiles (2014) 18:441–450 cellulosum So9733-1: gene cloning, expression, and enzymatic characterization. Appl Microbiol Biotechnol 93:1503–1512 Ward OP, Moo-Young M, Venkat K (1989) Enzymatic degradation of cell wall and related plant polysaccharides. Crit Rev Biotechnol 8:237–274 Winterhalter C, Liebl W (1995) Two Extremely Thermostable Xylanases of the Hyperthermophilic Bacterium Thermotoga maritima MSB8. Appl Environ Microbiol 61:1810–1815 Wu S, Liu B, Zhang X (2006) Characterization of a recombinant thermostable xylanase from deep-sea thermophilic Geobacillus sp. MT-1 in East Pacific. Appl Microbiol Biotechnol 72: 1210–1216 Zhang F, Hu SN, Chen JJ, Lin LB, Wei YL, Tang SK, Xu LH, Li WJ (2012) Purification and partial characterisation of a thermostable xylanase from salt-tolerant Thermobifida halotolerans YIM 90462 T. Process Biochem 47:225–228 Zhou J, Gao Y, Dong Y, Tang X, Li J, Xu B, Mu Y, Wu Q, Huang Z (2012) A novel xylanase with tolerance to ethanol, salt, protease, SDS, heat, and alkali from actinomycete Lechevalieria sp. HJ3. J Ind Microbiol Biotechnol 39:965–975