Neuroscience 294 (2015) 109–115
CLONING AND SEROTONERGIC REGULATION OF RING FINGER PROTEIN38 (rnf38) IN THE BRAIN OF MEDAKA (ORYZIAS LATIPES) S. MORIYA, * N. B. KHEL AND I. S. PARHAR
involved in various cellular processes through protein– protein or protein–DNA interactions (Saurin et al., 1996; Borden, 2000). Many RING finger proteins, such as PJA1, neuroregulin receptor degradation protein-1 and Parkin play important roles in their ubiquitin-conjugating enzyme (E2)-dependent E3 ubiquitin ligase activities (Morett and Bork, 1999; Yu et al., 2002; Tan et al., 2011). Furthermore, several RING finger proteins such as AO7 and Cbl bind to E2 ubiquitin enzymes and regulate ubiquitination (Lorick et al., 1999; Yokouchi et al., 1999; Freemont, 2000). Therefore, involvement in ubiquitination is considered as a general function of RING finger proteins. On the other hand, several RING finger proteins such as RING finger protein8 have other functions like transcription-stimulating activity (Takano et al., 2004). RING finger protein 38 (Rnf38) possesses a conserved RING-H2 domain among species, which consists of C-X2-C-X(9–39)-C-X(1–3)-H-X(2–3)-H-X2-CX(4–48)-C-X2-C where C is cysteine residue, H is histidine residue and X is any amino acid residue and binds two zinc atoms (Fig. 1) (Freemont et al., 1991; Freemont, 1993; Nalepa et al., 2006), and is widely expressed throughout the body in human, especially highly expressed in the heart, brain, placenta and the testis (Eisenberg et al., 2002). The role of Rnf38 remains unknown. Serotonin (5-HT) is a key modulator of numerous physiological processes and behaviors, such as mood, anxiety and sexual behaviors (Jacobs and Azmitia, 1992; Lucki, 1998), therefore, many genes are regulated by the serotonergic system (Sillaber et al., 2008; Park et al., 2012). Antidepressant-related gene 34 (Adgr34), a RING finger protein, is regulated by the serotonergic system (Yamada et al., 2000). Adrg34 gene expression is induced in the rat hippocampus and the frontal cortex by disruption of the serotonergic system. Furthermore, another RING finger protein, Rines regulates the serotonergic system by modulating ubiquitination and degradation of monoamine oxidase A, which is the catabolic enzyme of amine neurotransmitters such as 5-HT (Kabayama et al., 2013). We speculate that Rnf38 is also regulated by the serotonergic system in the brain. Selective serotonin reuptake inhibitors (SSRIs) induce an increase in extracellular 5-HT by inhibition of reuptake of 5-HT through serotonin transporter at neurons, therefore, SSRIs have been used to evaluate effects of the serotonergic system in fish. Fluoxetine (FLU), which is one of SSRIs, exposure decreases feeding rates and growth in fathead minnows (Pimephales promelas)
Brain Research Institute, Jeffrey Cheah School of Medicine and Health Sciences, Monash University Malaysia, PJ 46150, Malaysia
Abstract—Serotonin (5-HT) is a key regulator of mood and sexual behaviors. 5-HT reuptake inhibitors have been used as antidepressants. Really interesting new gene (RING) finger proteins have been associated with 5-HT regulation but their role remains largely unknown. Some RING finger proteins are involved in the serotonergic system, therefore, we speculate that the gene expression of RING finger protein38 (rnf38) is regulated by the serotonergic system. In the present study, we aimed to identify the full length sequence of medaka (Oryzias latipes) rnf38 mRNA and investigate its association with the serotonergic system using an antidepressant, citalopram (CIT). We identified the full length rnf38 cDNA, which consisted of 2726 nucleotides spanning 12 exons and the deduced protein sequence consisting of 518 amino acid residues including a RING finger domain, a KIT motif and a coiled-coil domain. Medaka exposed to 107 M of CIT showed anxiety-like behavior. The expressions of 5-HT-related genes, pet1, solute carrier family 6, member 4A (slc6a4) and tryptophan hydroxylase (tph2) were significantly low (P < 0.05) in the hindbrain. On the other hand, rnf38 gene was significantly high (P < 0.05) in the telencephalon and the hypothalamus. This shows that 5-HT synthesis and transport in the hindbrain is suppressed by CIT, which induces rnf38 gene expression in the forebrain where 5-HT neurons project. Thus, the expression of rnf38 is negatively regulated by the serotonergic system. Ó 2015 The Authors. Published by Elsevier Ltd. on behalf of IBRO. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Key words: rnf38, RING finger domain, serotonergic system, citalopram, medaka brain.
INTRODUCTION Really interesting new gene (RING) finger protein is a protein which possesses a characteristic zinc-binding motif (RING finger domain). The RING finger proteins are *Corresponding author. Tel: +60-3-5514-6376; fax: +60-3-55146341. E-mail address: [email protected] (S. Moriya). Abbreviations: CIT, citalopram; FLU, fluoxetine; RING, really interesting new gene; rnf38, RING finger protein38; RO, reverse osmosis; SSRIs, selective serotonin reuptake inhibitors.
http://dx.doi.org/10.1016/j.neuroscience.2015.03.012 0306-4522/Ó 2015 The Authors. Published by Elsevier Ltd. on behalf of IBRO. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/). 109
110
S. Moriya et al. / Neuroscience 294 (2015) 109–115
Fig. 1. Schematic structure of RING-H2 domain. C: cysteine residue, H: histidine residue, X: any amino acid residue and Zn: zinc. Modified from Nalepa et al. (2006).
(Stanley et al., 2007), exerts negative effects on swimming and feeding behavior of hybrid striped bass (Morone saxatiles Morone chrysops) (Gaworecki and Klaine, 2008), delays the development of sexual characteristics of maturing western mosquitofish (Gambusia affinis) (Henry and Black, 2008), alters plasma estradiol, and inhibited egg production in zebrafish (Lister et al., 2009). In the bluehead wrasse, chronic administration of FLU causes reduction of aggressive behavior (Semsar et al., 2004). Furthermore, fish exhibit anxiety-like behavior against novelty stress and 5-HT levels affect their behavior (Blaser and Gerlai, 2006; Levin et al., 2007). In zebrafish, manipulation of 5-HT levels with FLU affects anxiety-like behavior in the novel tank (Cachat et al., 2010). The present study was designed to identify the full length sequence of medaka (Oryzias latipes) rnf38 mRNA and correlate the expression of rnf38 gene with 5-HT-related genes, tryptophan hydroxylase (tph2, regulator of 5-HT synthesis), solute carrier family 6, member 4A (slc6a4, encodes 5-HT transporter) and pet1 (transcript factor regulating tph2 and slc6a4) in the brain by manipulating the serotonergic system using a SSRI, citalopram (CIT). In addition, we assessed anxiety-like behavior following CIT treatment to evaluate the effect of CIT.
dissected. Total RNA was isolated from the medaka whole brain with TRIzol (Invitrogen, Carlsbad, CA, USA) and converted to cDNA with SuperScript III reverse transcriptase (Invitrogen) and oligo d(T) primer. Partial CDS region was amplified with PCR. The primers were designed based on the genomic sequence of a predicted medaka rnf38 gene (accession No. ENSORLG00000 003296). The primer sequences were as follows: forward primer, 50 -GGGACAAGATGGAGGACAGTCCCAC-30 , and reverse primer, 50 -CAGTTGACGCGACTCAAAGTCAC TC-30 . The PCR reaction was performed in a 20-ll reaction mixture containing 1 HotStarTaq Master Mix (Qiagen, Hilden, Germany), 0.5 lM each of the primers and 1 ll of cDNA. The reaction program consisted of 95 °C for 5 min, 35 cycles of 95 °C for 30 s, 60 °C for 30 s and 72 °C for 2 min followed by 72 °C for 3 min. The amplified DNA was subjected to direct sequencing using BigDye Terminator v3.1 Cycle Sequencing kit (Applied Biosystems, Foster City, CA, USA) and 3130 Genetic Analyzer (Applied Biosystems). Full length rnf38 mRNA sequence was identified by 30 and 50 -rapid amplification of cDNA end (RACE). Genespecific primers were designed based on the identified partial mRNA sequence. For 30 -RACE, 1 lg of total RNA was converted to cDNA with SuperScript III (Invitrogen) and 50 pmol of oligo d(T)-containing adapter primer (AP) in 20-ll volume according to the manufacturer’s instruction. The converted cDNA was subjected to PCR in a 10-ll reaction containing 1 HotStarTaq Master Mix, 10 pmol each of Abridged universal amplification primer (AUAP, Invitrogen), and a gene-specific primer 50 -CTGTGCGTAGTGTGTATGAGTG-30 . The reaction program consisted of 95 °C for 5 min, 35 cycles of 94 °C for 30 s, 64 °C for 30 s and 72 °C for 3 min followed by 72 °C for 10 min. For 50 -RACE, 1 lg of the total RNA was converted to cDNA in 20-ll volume with SuperScript III (Invitrogen), 2 pmol of gene-specific primer 50 -CTGGACCTCCGAG GCATCTGCAC-30 . Polyadenine was added at the 30 end of the cDNA with terminal transferase (Roche Diagnostics, Mannheim, Germany) according to the manufacturer’s instruction. The polycytosine -tailed cDNA
EXPERIMENTAL PROCEDURES Animals Five-month-old male medaka (O. latipes) were maintained in fresh water at 27 ± 1.0 °C under a controlled natural photo regimen (14-h light/10-h dark cycle). The fish were fed Advanced Fish Diets (ZM, Winchester, UK) twice daily. All experimental procedures were performed in accordance with the guidelines of the Animal Ethics Committee of Monash University (approval No. SOBSB_MY_2010_64). Cloning of full length rnf38 cDNA Medaka were anesthetized by immersing in a 0.01% solution of benzocaine (Sigma, St. Louis, MO, USA), killed by decapitation and the fresh brains were
Fig. 2. Schematic drawing of the sagittal brain section of the medaka showing the regions used for gene expression analysis. The Region I (telencephalic region): the telencephalon, the preoptic area and olfactory bulb, the Region II (optic tectum): the optic tectum, the Region III (hypothalamic region): the hypothalamus and midbrain, the Region IV (cerebellum): the cerebellum and the Region V (hindbrain): the hindbrain and the spinal cord.
S. Moriya et al. / Neuroscience 294 (2015) 109–115 Table 1. Real-time PCR primers used in this study Gene
Sequence (50 –30 )
Product size (bp)
b-actin
GAGCTATGAGCTGCCTGACG GCAGGACTCCATACCAAGGA GCGGAGGAAAGCTCATGTTC AGGAACTGCCACAGCTGGAT CGTGACTTGGTCCAACTTATCC AGCTGGTGCAGACCTGATGA TGTTTGATCACCGGAACCAG TCGTTGATGGGACAGAAGGA TGACCCAGCCTTCTTGATTC ATCCTCTGTAACGGTGAACG
103
pet1 slc6a4 tph2 rnf38
139 93
111
50 -TAGGAGAAGATGGAGTGGAGG-30 . The reaction program consisted of 95 °C for 5 min, 35 cycles of 94 °C for 30 s, 64 °C for 30 s and 72 °C for 4 min followed by 72 °C for 10 min. The complete nucleotide sequence of rnf38 mRNA was confirmed by a sequence analysis of each PCR product. A RING finger domain was further analyzed by the simple modular architecture research tool (SMART) (Schultz et al., 1998; Letunic et al., 2012).
88 138
was subjected to PCR reaction in 20-ll volume containing 1 HotStarTaq Master Mix, 10 pmol each of 50 -RACE abridged anchor primer (Invitrogen) and a gene-specific primer 50 -GCGTATGGCATCTCTCTGGTATG-30 . The reaction program consisted of 95 °C for 5 min, 35 cycles of 94 °C for 30 s, 64 °C for 30 s and 72 °C for 4 min followed by 72 °C for 10 min. Furthermore, 1 ll of the PCR reaction mixture was subjected to nested PCR. Nested PCR was performed in a 20-ll reaction mixture containing 1 HotStarTaq Master Mix, 10 pmol each of AUAP (Invitrogen) and a gene-specific primer
CIT treatment CIT (Sigma–Aldrich, St. Louis, MO, USA) was dissolved in reverse osmosis (RO) water to final concentrations of 0 (control), 107 and 108 M. Fish were randomly selected and divided into three groups (N = 10 in each group). The treatment was performed in the tanks (280 mm (L) 210 mm (W) 180 mm (H)) containing 3 L of water with different concentrations of CIT. During the experiment, CIT solution was changed every day for 14 days. Doses 107 M and 108 M were selected based on the previous study using male goldfish, where male goldfish exposed to 1.7 107 M FLU for 14 days had disrupted reproductive physiology such as decreased milt volume and testosterone levels (Mennigen et al., 2010). This suggests that exposure to 1.7 107 M SSRI is
Fig. 3. (A) Deduced amino acid sequence of medaka Rnf38 and predicted domains. Coiled-coil domain is amino acids 412–432, KIL motif is amino acids 443–439, RING finger domain is amino acids 466–506. (B) Alignment of RING finger domain among human (AF394047), rat (NP_604462), mouse (NP_598825), drosophila (XP_082352), and Arabidopsis (NP_566651). Shaded boxes indicate amino acids involved in zinc coordination.
112
S. Moriya et al. / Neuroscience 294 (2015) 109–115
Fig. 4. Effect of CIT exposure on medaka behavior. (A) Latency to enter top half of the tank. (B) Number of transitions between the top half and bottom half of the tank. Time spent at the bottom half (C) and the top half (D) of the tank. All of data are presented as mean ± SEM and analyzed by a one-way ANOVA and Tukey’s post hoc test for multiple comparisons. ⁄P < 0.05.
effective in fish. Therefore, fish were exposed to 107 M and 108 M of CIT in this study to investigate the association of the serotonergic system with rnf38 gene expression. Anxiety-like behavior test After 14-day exposure to CIT, the fish (control: N = 9; CIT (108 M): N = 8; CIT (107 M): N = 9) were subjected to the anxiety-like behavior test. Anxiety-like behavior was tested following our previously published method (Khor et al., 2013). In brief, a tank with dimensions of 280 mm (L) 210 mm (W) 180 mm (H) was filled with 7 L of RO water. A camera was set at the side of the tank, approximately 1 m away. After 14-day exposure, each fish was transferred into the tank, and behavioral response to novel environment was recorded for 10 min. For the behavior analysis, the tank was marked into two equal top and bottom halves. Parameters analyzed in this study were latency to enter into the top half of the tank, the number of transitions between top and bottom halves and the time spent in the bottom half and top half. Gene expression analysis of rnf38 and 5-HT-related genes After completion of behavioral test, fish (control: N = 9; CIT (108 M): N = 8; CIT (107 M): N = 8) were anesthetized by immersing in a 0.01% solution of benzocaine (Sigma) and killed by decapitation. Fresh brains were dissected, and embedded in Tissue Tek OCT compound (Sakura Finetechnical, Tokyo, Japan), and frozen in powdered dry-ice. Brain sections were cut into
sagittal planes (15 lm) and mounted onto a polyethylene naphthalate membrane (PEN, Leica Microsystems, Wetzlar, Germany) attached slide glasses and stored at 80 °C until use. The sections were briefly fixed in 70% ethanol and stained with Cresyl Violet to identify brain nuclei. The brains were divided into five regions (Fig. 2) by a laser microdissection system (ArcturusXT, Applied Biosystems, Foster, CA). Region I (telencephalic region) included the telencephalon, preoptic area and the olfactory bulbs, Region II (optic tectum) included the optic tectum, Region III (hypothalamic region) included the hypothalamus and the midbrain, Region IV (cerebellum) included the cerebellum and Region V (hindbrain) included the hindbrain and the spinal cord. The procedure for the laser microdissection has been described in detail by Ogawa et al. (2012). The laser-dissected tissues of each brain region attached to PEN membrane were pooled into a microtube containing 200 ll of TRIzol (Invitrogen, Carlsbad, CA), and total RNA was isolated according to the manufacturer’s instructions. The entire isolated total RNA was subjected to cDNA synthesis with High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Carlsbad, CA) in 20-ll volume according to the manufacturer’s instruction.mRNA levels of b-actin, pet1, slc6a4, tph2 and rnf38 genes were examined by real-time PCR. Real-time PCR was performed in 10-ll reaction mixtures containing 1 POWER SYBR Green PCR Master Mix (Applied Biosystems), 0.2 lM each forward and reverse primer, and 1-ll cDNA. The primers used are shown in Table 1. Real-time PCR was performed using a StepOnePlus (Applied Biosystems) with conditions of 95 °C for 10 min,
S. Moriya et al. / Neuroscience 294 (2015) 109–115
113
followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min followed by a dissociation step. The levels of each mRNA type were normalized to b-actin mRNA with the ddCt method and the gene expression level in the control sample was defined as 1.0 for each brain region. Data analysis Statistical analysis was performed by a one-way ANOVA and Tukey’s post hoc test for multiple comparisons using SPSS 18. P < 0.05 was considered as significant.
RESULTS Full length rnf38 mRNA sequence The identified full length rnf38 mRNA (Genbank accession No. KF431968) consisted of 2726 nucleotides spanning 12 exons when compared to the medaka genome. The coding region starts at the first base of exon 3 and extends to the 60th base of the exon 12. The deduced protein sequence region consisted of 518 amino acid residues including a RING finger domain, identified as RING-H2 (C-X2-C-X14C-X-H-X2-H-X2-C-X10-C-X2-C) (Fig. 3A). In addition to the RING finger domain, a KIL motif (K-X2-I/L-X2-I/L) and a coiled-coil domain was also seen in the deduced sequence (Fig. 3A). The RING-H2 sequence of Rnf38 is conserved among the human, rat, mouse, drosophila and Arabidopsis (Fig. 3B). Behavior analysis After 14-day exposure to CIT, the fish (control group, 108 M group and 107 M group) were subjected to the behavioral test (Fig. 4). The latency to the top half of the tank was significantly high in the 107 M group compared to the control group. The number of transitions was significantly low in the 107 M group. The 108 M group revealed no significant difference in the latency and the number of transitions. The time spent at the bottom half and top half showed no significant difference in both groups. Gene expression analysis 7
The pet1 mRNA levels were significantly low in the 10 M group of the hypothalamic region and the 107 M group and 108 M group of the hindbrain (Fig. 5A). The mRNA levels of slc6a4 and tph2 were significantly low in the 107 M group of the hindbrain and no significant difference was observed in the hypothalamic region (Fig. 5B, C). rnf38 gene expression was examined in all of the five regions (Fig. 6). rnf38 gene expression was significantly increased in the 107 M group in the telencephalic region and hypothalamic region. In the other regions and concentration, no significant difference was observed.
DISCUSSION Full length cDNA of medaka rnf38 was identified and compared with other species. The RING finger domain, the KIL motif and the coiled-coil domain were predicted from the deduced amino acid sequence. The RING-H2
Fig. 5. Effect of CIT exposure on 5-HT-related gene expression in the medaka brain. pet1 (A), slc6a4 (B) and tph2 (C) gene expressions were examined. The gene expression in the relevant region of control sample was defined as 1.0. All of data are presented as mean ± SEM and analyzed by a one-way ANOVA and Tukey’s post hoc test for multiple comparisons. ⁄P < 0.05.
domain of medaka Rnf38 is conserved among a wide range of eukaryotes, which include the human, rat, mouse, drosophila and Arabidopsis. The KIL motif (Eisenberg et al., 2002) is present in a subset of the RING-H2 domain and is located shortly upstream of the RING-H2 domain (Macdonald et al., 1999). The coiledcoil domain (Lupas et al., 1991) is also characterized close to the RING finger domain region of the human, rat and mouse (Eisenberg et al., 2002). The coiled-coil domain is involved in protein–protein/DNA interaction, which is observed in functional proteins, like some transcription factors, c-fos and tropomyosin (Zuo et al., 2010; Moore et al., 2011). mPY motif and SH2 binding
114
S. Moriya et al. / Neuroscience 294 (2015) 109–115
where pet1 expressing 5-HT neurons send projections in the zebrafish (Lillesaar et al., 2009). This suggests that the rnf38 gene in the telencephalic and hypothalamic region is induced by the decline of 5-HT levels. Induction of Rnf38 may be involved in the anxiety-like behavior or non-cell autonomous by the decline of 5-HT levels. Furthermore, the Rnf38 may play a common role in 5-HT-related physiologies through protein–protein/ DNA interactions among vertebrates because of conservation of the amino acid sequence.
CONCLUSION Fig. 6. Effect of CIT on rnf38 gene expression in the medaka brain. The gene expression in the relevant region of control sample was defined as 1.0. All of data are presented as mean ± SEM and analyzed by a one-way ANOVA and Tukey’s post hoc test for multiple comparisons. ⁄P < 0.05.
motif, which are key domains for ubiquitination, were not present. Therefore, Rnf38 may not be involved in ubiquitination as observed in many RING finger proteins, but may be involved in other functions such as a transcription factor (Morett and Bork, 1999; Yu et al., 2002; Tan et al., 2011). Furthermore, since all functional domains of Rnf38 including the RING finger domain, the KIL motif and the coiled-coil domain are highly conserved among species, the role of Rnf38 could also be conserved. To evaluate the effect of CIT treatment, anxiety-like behavior test was performed by transferring the fish to the novel tank after CIT exposure. Behavioral analysis revealed anxiety-like behavior in the 107 M group. The latency to the top half was increased and the number of transitions was decreased compared to the control group. Similar behavioral changes have been observed in other fish (Blaser and Gerlai, 2006; Levin et al., 2007; Lister et al., 2009; Cachat et al., 2010). In the bluehead wrasse, chronic administration of FLU causes reduction of aggressive behavior (Semsar et al., 2004). In the present study, medaka exposed to CIT had low pet1 mRNA levels in the hypothalamic region and pet1, slc6a4 and tph2 mRNA levels in the hindbrain. In zebrafish, several populations of pet1 expressing 5-HT neurons have been reported in the hypothalamus and the hindbrain (Lillesaar, 2011). This suggests that 5-HT synthesis and transport in pet1 expressing 5-HT neurons is suppressed by CIT exposure. The decreased presynaptic 5-HT could cause anxiety-like behavior. Furthermore, the pet1 expressing 5-HT neurons in the hindbrain may also be involved in the behavioral changes, since mRNA levels of the slc6a4 and tph2 were suppressed only in the hindbrain of the 107 M group. On the other hand, behavioral changes were not observed in the 108 M group. This result is comparable with goldfish experiment exposed to FLU (Mennigen et al., 2010). This is probably due to no change of 5-HT synthesis and transport. In fact, there are no changes in mRNA levels of slc6a4 and tph2 in both the hypothalamic region and hindbrain of the 108 M group. The rnf38 was ubiquitously expressed in all regions of the brain. The rnf38 expression was increased by CIT only in the telencephalic and the hypothalamic region,
In this research, the full length sequence of medaka rnf38 mRNA was identified and the RING finger domain and the KIL domain which is accompanied by RING finger domain was identified. Medaka exposed to CIT exhibited anxietylike behavior, suppression of the serotonergic systemrelated genes mainly in the hindbrain, and increase of the rnf38 gene expression in the telencephalic and the hypothalamic region. It suggests that rnf38 expression is negatively regulated by the serotonergic system. Acknowledgments—We thank Dr. Tomoko Soga, Dr. Takashi Kitahashi and Dr. Satoshi Ogawa for their constructive comments and Ms. Jalilah Idris and Ms. Asha Thanabalan for their excellent technical assistance. This work was supported by grants from Monash University Sunway Campus (SM-10-01) and Malaysian Ministry of Higher Education (FRGS/2/2010/SG/MUSM/03/3, FRGS/1/2013/ SKK01/MUSM/03/1, and FRGS/1/2013/SKK01/ MUSM/03/6).
REFERENCES Blaser R, Gerlai R (2006) Behavioral phenotyping in zebrafish: comparison of three behavioral quantification methods. Behav Res Methods 38:456–469. Borden KL (2000) RING domains: master builders of molecular scaffolds? J Mol Biol 295:1103–1112. Cachat J, Stewart A, Grossman L, Gaikwad S, Kadri F, Chung KM, Wu N, Wong K, Roy S, Suciu C, Goodspeed J, Elegante M, Bartels B, Elkhayat S, Tien D, Tan J, Denmark A, Gilder T, Kyzar E, DiLeo J, Frank K, Chang K, Utterback E, Hart P, Kalueff AV (2010) Measuring behavioral and endocrine responses to novelty stress in adult zebrafish. Nat Protocols 5:1786–1799. Eisenberg I, Hochner H, Levi T, Yelin R, Kahan T, MitraniRosenbaum S (2002) Cloning and characterization of a novel human gene RNF38 encoding a conserved putative protein with a RING finger domain. Biochem Biophys Res Commun 294:1169–1176. Freemont PS (1993) The RING finger. A novel protein sequence motif related to the zinc finger. Ann N Y Acad Sci 684:174–192. Freemont PS (2000) RING for destruction? Curr Biol 10:R84–R87. Freemont PS, Hanson IM, Trowsdale J (1991) A novel cysteine-rich sequence motif. Cell 64:483–484. Gaworecki KM, Klaine SJ (2008) Behavioral and biochemical responses of hybrid striped bass during and after fluoxetine exposure. Aquat Toxicol 88:207–213. Henry TB, Black MC (2008) Acute and chronic toxicity of fluoxetine (selective serotonin reuptake inhibitor) in western mosquitofish. Arch Environ Contam Toxicol 54:325–330. Jacobs BL, Azmitia EC (1992) Structure and function of the brain serotonin system. Physiol Rev 72:165–229. Kabayama M, Sakoori K, Yamada K, Ornthanalai VG, Ota M, Morimura N, Katayama K, Murphy NP, Aruga J (2013) Rines E3
S. Moriya et al. / Neuroscience 294 (2015) 109–115 ubiquitin ligase regulates MAO-A levels and emotional responses. J Neurosci 33:12940–12953. Khor YM, Soga T, Parhar IS (2013) Caffeine neuroprotects against dexamethasone-induced anxiety-like behaviour in the Zebrafish (Danio rerio). Gen Comp Endocrinol 181:310–315. Letunic I, Doerks T, Bork P (2012) SMART 7: recent updates to the protein domain annotation resource. Nucleic Acids Res 40:D302–D305. Levin ED, Bencan Z, Cerutti DT (2007) Anxiolytic effects of nicotine in zebrafish. Physiol Behav 90:54–58. Lillesaar C (2011) The serotonergic system in fish. J Chem Neuroanat 41:294–308. Lillesaar C, Stigloher C, Tannhauser B, Wullimann MF, Bally-Cuif L (2009) Axonal projections originating from raphe serotonergic neurons in the developing and adult zebrafish, Danio rerio, using transgenics to visualize raphe-specific pet1 expression. J Comp Neurol 512:158–182. Lister A, Regan C, Van Zwol J, Van Der Kraak G (2009) Inhibition of egg production in zebrafish by fluoxetine and municipal effluents: a mechanistic evaluation. Aquat Toxicol 95:320–329. Lorick KL, Jensen JP, Fang S, Ong AM, Hatakeyama S, Weissman AM (1999) RING fingers mediate ubiquitin-conjugating enzyme (E2)-dependent ubiquitination. Proc Natl Acad Sci U S A 96:11364–11369. Lucki I (1998) The spectrum of behaviors influenced by serotonin. Biol Psychiatry 44:151–162. Lupas A, Van Dyke M, Stock J (1991) Predicting coiled coils from protein sequences. Science 252:1162–1164. Macdonald DH, Lahiri D, Sampath A, Chase A, Sohal J, Cross NC (1999) Cloning and characterization of RNF6, a novel RING finger gene mapping to 13q12. Genomics 58:94–97. Mennigen JA, Lado WE, Zamora JM, Duarte-Guterman P, Langlois VS, Metcalfe CD, Chang JP, Moon TW, Trudeau VL (2010) Waterborne fluoxetine disrupts the reproductive axis in sexually mature male goldfish, Carassius auratus. Aquat Toxicol 100:354–364. Moore JR, Li X, Nirody J, Fischer S, Lehman W (2011) Structural implications of conserved aspartate residues located in tropomyosin’s coiled-coil core. Bioarchitecture 1:250–255. Morett E, Bork P (1999) A novel transactivation domain in parkin. Trends Biochem Sci 24:229–231. Nalepa G, Rolfe M, Harper JW (2006) Drug discovery in the ubiquitinproteasome system. Nat Rev Drug Discov 5:596–613. Ogawa S, Ng KW, Ramadasan PN, Nathan FM, Parhar IS (2012) Habenular Kiss1 neurons modulate the serotonergic system in the brain of zebrafish. Endocrinology 153:2398–2407.
115
Park JW, Heah TP, Gouffon JS, Henry TB, Sayler GS (2012) Global gene expression in larval zebrafish (Danio rerio) exposed to selective serotonin reuptake inhibitors (fluoxetine and sertraline) reveals unique expression profiles and potential biomarkers of exposure. Environ Pollut 167:163–170. Saurin AJ, Borden KL, Boddy MN, Freemont PS (1996) Does this have a familiar RING? Trends Biochem Sci 21:208–214. Schultz J, Milpetz F, Bork P, Ponting CP (1998) SMART, a simple modular architecture research tool: identification of signaling domains. Proc Natl Acad Sci U S A 95:5857–5864. Semsar K, Perreault HA, Godwin J (2004) Fluoxetine-treated male wrasses exhibit low AVT expression. Brain Res 1029:141–147. Sillaber I, Panhuysen M, Henniger MH, Ohl F, Ku¨hne C, Pu¨tz B, Pohl T, Deussing J, Paez-Pereda M, Holsboer F (2008) Profiling of behavioral changes and hippocampal gene expression in mice chronically treated with the SSRI paroxetine. Psychopharmacology 200:557–572. Stanley JK, Ramirez AJ, Chambliss CK, Brooks BW (2007) Enantiospecific sublethal effects of the antidepressant fluoxetine to a model aquatic vertebrate and invertebrate. Chemosphere 69:9–16. Takano Y, Adachi S, Okuno M, Muto Y, Yoshioka T, MatsushimaNishiwaki R, Tsurumi H, Ito K, Friedman SL, Moriwaki H, Kojima S, Okano Y (2004) The RING finger protein, RNF8, interacts with retinoid X receptor alpha and enhances its transcriptionstimulating activity. J Biol Chem 279:18926–18934. Tan Y, Yu F, Pereira A, Morin P, Zhou J (2011) Suppression of Nrdp1 toxicity by Parkin in Drosophila models. Biochem Biophys Res Commun 416:18–23. Yamada M, Yamada M, Yamazaki S, Takahashi K, Nishioka G, Kudo K, Ozawa H, Yamada S, Kiuchi Y, Kamijima K, Higuchi T, Momose K (2000) Identification of a novel gene with RING-H2 finger motif induced after chronic antidepressant treatment in rat brain. Biochem Biophys Res Commun 278:150–157. Yokouchi M, Kondo T, Houghton A, Bartkiewicz M, Horne WC, Zhang H, Yoshimura A, Baron R (1999) Ligand-induced ubiquitination of the epidermal growth factor receptor involves the interaction of the c-Cbl RING finger and UbcH7. J Biol Chem 274:31707–31712. Yu P, Chen Y, Tagle DA, Cai T (2002) PJA1, encoding a RING-H2 finger ubiquitin ligase, is a novel human X chromosome gene abundantly expressed in brain. Genomics 79:869–874. Zuo Z, Gandhi NS, Mancera RL (2010) Calculations of the free energy of interaction of the c-Fos-c-Jun coiled coil: effects of the solvation model and the inclusion of polarization effects. J Chem Inf Model 50:2201–2212.
(Accepted 5 March 2015) (Available online 12 March 2015)
CLONING AND SEROTONERGIC REGULATION OF RING FINGER PROTEIN38 (rnf38) IN THE BRAIN OF MEDAKA (ORYZIAS LATIPES) S. MORIYA, * N. B. KHEL AND I. S. PARHAR
involved in various cellular processes through protein– protein or protein–DNA interactions (Saurin et al., 1996; Borden, 2000). Many RING finger proteins, such as PJA1, neuroregulin receptor degradation protein-1 and Parkin play important roles in their ubiquitin-conjugating enzyme (E2)-dependent E3 ubiquitin ligase activities (Morett and Bork, 1999; Yu et al., 2002; Tan et al., 2011). Furthermore, several RING finger proteins such as AO7 and Cbl bind to E2 ubiquitin enzymes and regulate ubiquitination (Lorick et al., 1999; Yokouchi et al., 1999; Freemont, 2000). Therefore, involvement in ubiquitination is considered as a general function of RING finger proteins. On the other hand, several RING finger proteins such as RING finger protein8 have other functions like transcription-stimulating activity (Takano et al., 2004). RING finger protein 38 (Rnf38) possesses a conserved RING-H2 domain among species, which consists of C-X2-C-X(9–39)-C-X(1–3)-H-X(2–3)-H-X2-CX(4–48)-C-X2-C where C is cysteine residue, H is histidine residue and X is any amino acid residue and binds two zinc atoms (Fig. 1) (Freemont et al., 1991; Freemont, 1993; Nalepa et al., 2006), and is widely expressed throughout the body in human, especially highly expressed in the heart, brain, placenta and the testis (Eisenberg et al., 2002). The role of Rnf38 remains unknown. Serotonin (5-HT) is a key modulator of numerous physiological processes and behaviors, such as mood, anxiety and sexual behaviors (Jacobs and Azmitia, 1992; Lucki, 1998), therefore, many genes are regulated by the serotonergic system (Sillaber et al., 2008; Park et al., 2012). Antidepressant-related gene 34 (Adgr34), a RING finger protein, is regulated by the serotonergic system (Yamada et al., 2000). Adrg34 gene expression is induced in the rat hippocampus and the frontal cortex by disruption of the serotonergic system. Furthermore, another RING finger protein, Rines regulates the serotonergic system by modulating ubiquitination and degradation of monoamine oxidase A, which is the catabolic enzyme of amine neurotransmitters such as 5-HT (Kabayama et al., 2013). We speculate that Rnf38 is also regulated by the serotonergic system in the brain. Selective serotonin reuptake inhibitors (SSRIs) induce an increase in extracellular 5-HT by inhibition of reuptake of 5-HT through serotonin transporter at neurons, therefore, SSRIs have been used to evaluate effects of the serotonergic system in fish. Fluoxetine (FLU), which is one of SSRIs, exposure decreases feeding rates and growth in fathead minnows (Pimephales promelas)
Brain Research Institute, Jeffrey Cheah School of Medicine and Health Sciences, Monash University Malaysia, PJ 46150, Malaysia
Abstract—Serotonin (5-HT) is a key regulator of mood and sexual behaviors. 5-HT reuptake inhibitors have been used as antidepressants. Really interesting new gene (RING) finger proteins have been associated with 5-HT regulation but their role remains largely unknown. Some RING finger proteins are involved in the serotonergic system, therefore, we speculate that the gene expression of RING finger protein38 (rnf38) is regulated by the serotonergic system. In the present study, we aimed to identify the full length sequence of medaka (Oryzias latipes) rnf38 mRNA and investigate its association with the serotonergic system using an antidepressant, citalopram (CIT). We identified the full length rnf38 cDNA, which consisted of 2726 nucleotides spanning 12 exons and the deduced protein sequence consisting of 518 amino acid residues including a RING finger domain, a KIT motif and a coiled-coil domain. Medaka exposed to 107 M of CIT showed anxiety-like behavior. The expressions of 5-HT-related genes, pet1, solute carrier family 6, member 4A (slc6a4) and tryptophan hydroxylase (tph2) were significantly low (P < 0.05) in the hindbrain. On the other hand, rnf38 gene was significantly high (P < 0.05) in the telencephalon and the hypothalamus. This shows that 5-HT synthesis and transport in the hindbrain is suppressed by CIT, which induces rnf38 gene expression in the forebrain where 5-HT neurons project. Thus, the expression of rnf38 is negatively regulated by the serotonergic system. Ó 2015 The Authors. Published by Elsevier Ltd. on behalf of IBRO. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Key words: rnf38, RING finger domain, serotonergic system, citalopram, medaka brain.
INTRODUCTION Really interesting new gene (RING) finger protein is a protein which possesses a characteristic zinc-binding motif (RING finger domain). The RING finger proteins are *Corresponding author. Tel: +60-3-5514-6376; fax: +60-3-55146341. E-mail address: [email protected] (S. Moriya). Abbreviations: CIT, citalopram; FLU, fluoxetine; RING, really interesting new gene; rnf38, RING finger protein38; RO, reverse osmosis; SSRIs, selective serotonin reuptake inhibitors.
http://dx.doi.org/10.1016/j.neuroscience.2015.03.012 0306-4522/Ó 2015 The Authors. Published by Elsevier Ltd. on behalf of IBRO. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/). 109
110
S. Moriya et al. / Neuroscience 294 (2015) 109–115
Fig. 1. Schematic structure of RING-H2 domain. C: cysteine residue, H: histidine residue, X: any amino acid residue and Zn: zinc. Modified from Nalepa et al. (2006).
(Stanley et al., 2007), exerts negative effects on swimming and feeding behavior of hybrid striped bass (Morone saxatiles Morone chrysops) (Gaworecki and Klaine, 2008), delays the development of sexual characteristics of maturing western mosquitofish (Gambusia affinis) (Henry and Black, 2008), alters plasma estradiol, and inhibited egg production in zebrafish (Lister et al., 2009). In the bluehead wrasse, chronic administration of FLU causes reduction of aggressive behavior (Semsar et al., 2004). Furthermore, fish exhibit anxiety-like behavior against novelty stress and 5-HT levels affect their behavior (Blaser and Gerlai, 2006; Levin et al., 2007). In zebrafish, manipulation of 5-HT levels with FLU affects anxiety-like behavior in the novel tank (Cachat et al., 2010). The present study was designed to identify the full length sequence of medaka (Oryzias latipes) rnf38 mRNA and correlate the expression of rnf38 gene with 5-HT-related genes, tryptophan hydroxylase (tph2, regulator of 5-HT synthesis), solute carrier family 6, member 4A (slc6a4, encodes 5-HT transporter) and pet1 (transcript factor regulating tph2 and slc6a4) in the brain by manipulating the serotonergic system using a SSRI, citalopram (CIT). In addition, we assessed anxiety-like behavior following CIT treatment to evaluate the effect of CIT.
dissected. Total RNA was isolated from the medaka whole brain with TRIzol (Invitrogen, Carlsbad, CA, USA) and converted to cDNA with SuperScript III reverse transcriptase (Invitrogen) and oligo d(T) primer. Partial CDS region was amplified with PCR. The primers were designed based on the genomic sequence of a predicted medaka rnf38 gene (accession No. ENSORLG00000 003296). The primer sequences were as follows: forward primer, 50 -GGGACAAGATGGAGGACAGTCCCAC-30 , and reverse primer, 50 -CAGTTGACGCGACTCAAAGTCAC TC-30 . The PCR reaction was performed in a 20-ll reaction mixture containing 1 HotStarTaq Master Mix (Qiagen, Hilden, Germany), 0.5 lM each of the primers and 1 ll of cDNA. The reaction program consisted of 95 °C for 5 min, 35 cycles of 95 °C for 30 s, 60 °C for 30 s and 72 °C for 2 min followed by 72 °C for 3 min. The amplified DNA was subjected to direct sequencing using BigDye Terminator v3.1 Cycle Sequencing kit (Applied Biosystems, Foster City, CA, USA) and 3130 Genetic Analyzer (Applied Biosystems). Full length rnf38 mRNA sequence was identified by 30 and 50 -rapid amplification of cDNA end (RACE). Genespecific primers were designed based on the identified partial mRNA sequence. For 30 -RACE, 1 lg of total RNA was converted to cDNA with SuperScript III (Invitrogen) and 50 pmol of oligo d(T)-containing adapter primer (AP) in 20-ll volume according to the manufacturer’s instruction. The converted cDNA was subjected to PCR in a 10-ll reaction containing 1 HotStarTaq Master Mix, 10 pmol each of Abridged universal amplification primer (AUAP, Invitrogen), and a gene-specific primer 50 -CTGTGCGTAGTGTGTATGAGTG-30 . The reaction program consisted of 95 °C for 5 min, 35 cycles of 94 °C for 30 s, 64 °C for 30 s and 72 °C for 3 min followed by 72 °C for 10 min. For 50 -RACE, 1 lg of the total RNA was converted to cDNA in 20-ll volume with SuperScript III (Invitrogen), 2 pmol of gene-specific primer 50 -CTGGACCTCCGAG GCATCTGCAC-30 . Polyadenine was added at the 30 end of the cDNA with terminal transferase (Roche Diagnostics, Mannheim, Germany) according to the manufacturer’s instruction. The polycytosine -tailed cDNA
EXPERIMENTAL PROCEDURES Animals Five-month-old male medaka (O. latipes) were maintained in fresh water at 27 ± 1.0 °C under a controlled natural photo regimen (14-h light/10-h dark cycle). The fish were fed Advanced Fish Diets (ZM, Winchester, UK) twice daily. All experimental procedures were performed in accordance with the guidelines of the Animal Ethics Committee of Monash University (approval No. SOBSB_MY_2010_64). Cloning of full length rnf38 cDNA Medaka were anesthetized by immersing in a 0.01% solution of benzocaine (Sigma, St. Louis, MO, USA), killed by decapitation and the fresh brains were
Fig. 2. Schematic drawing of the sagittal brain section of the medaka showing the regions used for gene expression analysis. The Region I (telencephalic region): the telencephalon, the preoptic area and olfactory bulb, the Region II (optic tectum): the optic tectum, the Region III (hypothalamic region): the hypothalamus and midbrain, the Region IV (cerebellum): the cerebellum and the Region V (hindbrain): the hindbrain and the spinal cord.
S. Moriya et al. / Neuroscience 294 (2015) 109–115 Table 1. Real-time PCR primers used in this study Gene
Sequence (50 –30 )
Product size (bp)
b-actin
GAGCTATGAGCTGCCTGACG GCAGGACTCCATACCAAGGA GCGGAGGAAAGCTCATGTTC AGGAACTGCCACAGCTGGAT CGTGACTTGGTCCAACTTATCC AGCTGGTGCAGACCTGATGA TGTTTGATCACCGGAACCAG TCGTTGATGGGACAGAAGGA TGACCCAGCCTTCTTGATTC ATCCTCTGTAACGGTGAACG
103
pet1 slc6a4 tph2 rnf38
139 93
111
50 -TAGGAGAAGATGGAGTGGAGG-30 . The reaction program consisted of 95 °C for 5 min, 35 cycles of 94 °C for 30 s, 64 °C for 30 s and 72 °C for 4 min followed by 72 °C for 10 min. The complete nucleotide sequence of rnf38 mRNA was confirmed by a sequence analysis of each PCR product. A RING finger domain was further analyzed by the simple modular architecture research tool (SMART) (Schultz et al., 1998; Letunic et al., 2012).
88 138
was subjected to PCR reaction in 20-ll volume containing 1 HotStarTaq Master Mix, 10 pmol each of 50 -RACE abridged anchor primer (Invitrogen) and a gene-specific primer 50 -GCGTATGGCATCTCTCTGGTATG-30 . The reaction program consisted of 95 °C for 5 min, 35 cycles of 94 °C for 30 s, 64 °C for 30 s and 72 °C for 4 min followed by 72 °C for 10 min. Furthermore, 1 ll of the PCR reaction mixture was subjected to nested PCR. Nested PCR was performed in a 20-ll reaction mixture containing 1 HotStarTaq Master Mix, 10 pmol each of AUAP (Invitrogen) and a gene-specific primer
CIT treatment CIT (Sigma–Aldrich, St. Louis, MO, USA) was dissolved in reverse osmosis (RO) water to final concentrations of 0 (control), 107 and 108 M. Fish were randomly selected and divided into three groups (N = 10 in each group). The treatment was performed in the tanks (280 mm (L) 210 mm (W) 180 mm (H)) containing 3 L of water with different concentrations of CIT. During the experiment, CIT solution was changed every day for 14 days. Doses 107 M and 108 M were selected based on the previous study using male goldfish, where male goldfish exposed to 1.7 107 M FLU for 14 days had disrupted reproductive physiology such as decreased milt volume and testosterone levels (Mennigen et al., 2010). This suggests that exposure to 1.7 107 M SSRI is
Fig. 3. (A) Deduced amino acid sequence of medaka Rnf38 and predicted domains. Coiled-coil domain is amino acids 412–432, KIL motif is amino acids 443–439, RING finger domain is amino acids 466–506. (B) Alignment of RING finger domain among human (AF394047), rat (NP_604462), mouse (NP_598825), drosophila (XP_082352), and Arabidopsis (NP_566651). Shaded boxes indicate amino acids involved in zinc coordination.
112
S. Moriya et al. / Neuroscience 294 (2015) 109–115
Fig. 4. Effect of CIT exposure on medaka behavior. (A) Latency to enter top half of the tank. (B) Number of transitions between the top half and bottom half of the tank. Time spent at the bottom half (C) and the top half (D) of the tank. All of data are presented as mean ± SEM and analyzed by a one-way ANOVA and Tukey’s post hoc test for multiple comparisons. ⁄P < 0.05.
effective in fish. Therefore, fish were exposed to 107 M and 108 M of CIT in this study to investigate the association of the serotonergic system with rnf38 gene expression. Anxiety-like behavior test After 14-day exposure to CIT, the fish (control: N = 9; CIT (108 M): N = 8; CIT (107 M): N = 9) were subjected to the anxiety-like behavior test. Anxiety-like behavior was tested following our previously published method (Khor et al., 2013). In brief, a tank with dimensions of 280 mm (L) 210 mm (W) 180 mm (H) was filled with 7 L of RO water. A camera was set at the side of the tank, approximately 1 m away. After 14-day exposure, each fish was transferred into the tank, and behavioral response to novel environment was recorded for 10 min. For the behavior analysis, the tank was marked into two equal top and bottom halves. Parameters analyzed in this study were latency to enter into the top half of the tank, the number of transitions between top and bottom halves and the time spent in the bottom half and top half. Gene expression analysis of rnf38 and 5-HT-related genes After completion of behavioral test, fish (control: N = 9; CIT (108 M): N = 8; CIT (107 M): N = 8) were anesthetized by immersing in a 0.01% solution of benzocaine (Sigma) and killed by decapitation. Fresh brains were dissected, and embedded in Tissue Tek OCT compound (Sakura Finetechnical, Tokyo, Japan), and frozen in powdered dry-ice. Brain sections were cut into
sagittal planes (15 lm) and mounted onto a polyethylene naphthalate membrane (PEN, Leica Microsystems, Wetzlar, Germany) attached slide glasses and stored at 80 °C until use. The sections were briefly fixed in 70% ethanol and stained with Cresyl Violet to identify brain nuclei. The brains were divided into five regions (Fig. 2) by a laser microdissection system (ArcturusXT, Applied Biosystems, Foster, CA). Region I (telencephalic region) included the telencephalon, preoptic area and the olfactory bulbs, Region II (optic tectum) included the optic tectum, Region III (hypothalamic region) included the hypothalamus and the midbrain, Region IV (cerebellum) included the cerebellum and Region V (hindbrain) included the hindbrain and the spinal cord. The procedure for the laser microdissection has been described in detail by Ogawa et al. (2012). The laser-dissected tissues of each brain region attached to PEN membrane were pooled into a microtube containing 200 ll of TRIzol (Invitrogen, Carlsbad, CA), and total RNA was isolated according to the manufacturer’s instructions. The entire isolated total RNA was subjected to cDNA synthesis with High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Carlsbad, CA) in 20-ll volume according to the manufacturer’s instruction.mRNA levels of b-actin, pet1, slc6a4, tph2 and rnf38 genes were examined by real-time PCR. Real-time PCR was performed in 10-ll reaction mixtures containing 1 POWER SYBR Green PCR Master Mix (Applied Biosystems), 0.2 lM each forward and reverse primer, and 1-ll cDNA. The primers used are shown in Table 1. Real-time PCR was performed using a StepOnePlus (Applied Biosystems) with conditions of 95 °C for 10 min,
S. Moriya et al. / Neuroscience 294 (2015) 109–115
113
followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min followed by a dissociation step. The levels of each mRNA type were normalized to b-actin mRNA with the ddCt method and the gene expression level in the control sample was defined as 1.0 for each brain region. Data analysis Statistical analysis was performed by a one-way ANOVA and Tukey’s post hoc test for multiple comparisons using SPSS 18. P < 0.05 was considered as significant.
RESULTS Full length rnf38 mRNA sequence The identified full length rnf38 mRNA (Genbank accession No. KF431968) consisted of 2726 nucleotides spanning 12 exons when compared to the medaka genome. The coding region starts at the first base of exon 3 and extends to the 60th base of the exon 12. The deduced protein sequence region consisted of 518 amino acid residues including a RING finger domain, identified as RING-H2 (C-X2-C-X14C-X-H-X2-H-X2-C-X10-C-X2-C) (Fig. 3A). In addition to the RING finger domain, a KIL motif (K-X2-I/L-X2-I/L) and a coiled-coil domain was also seen in the deduced sequence (Fig. 3A). The RING-H2 sequence of Rnf38 is conserved among the human, rat, mouse, drosophila and Arabidopsis (Fig. 3B). Behavior analysis After 14-day exposure to CIT, the fish (control group, 108 M group and 107 M group) were subjected to the behavioral test (Fig. 4). The latency to the top half of the tank was significantly high in the 107 M group compared to the control group. The number of transitions was significantly low in the 107 M group. The 108 M group revealed no significant difference in the latency and the number of transitions. The time spent at the bottom half and top half showed no significant difference in both groups. Gene expression analysis 7
The pet1 mRNA levels were significantly low in the 10 M group of the hypothalamic region and the 107 M group and 108 M group of the hindbrain (Fig. 5A). The mRNA levels of slc6a4 and tph2 were significantly low in the 107 M group of the hindbrain and no significant difference was observed in the hypothalamic region (Fig. 5B, C). rnf38 gene expression was examined in all of the five regions (Fig. 6). rnf38 gene expression was significantly increased in the 107 M group in the telencephalic region and hypothalamic region. In the other regions and concentration, no significant difference was observed.
DISCUSSION Full length cDNA of medaka rnf38 was identified and compared with other species. The RING finger domain, the KIL motif and the coiled-coil domain were predicted from the deduced amino acid sequence. The RING-H2
Fig. 5. Effect of CIT exposure on 5-HT-related gene expression in the medaka brain. pet1 (A), slc6a4 (B) and tph2 (C) gene expressions were examined. The gene expression in the relevant region of control sample was defined as 1.0. All of data are presented as mean ± SEM and analyzed by a one-way ANOVA and Tukey’s post hoc test for multiple comparisons. ⁄P < 0.05.
domain of medaka Rnf38 is conserved among a wide range of eukaryotes, which include the human, rat, mouse, drosophila and Arabidopsis. The KIL motif (Eisenberg et al., 2002) is present in a subset of the RING-H2 domain and is located shortly upstream of the RING-H2 domain (Macdonald et al., 1999). The coiledcoil domain (Lupas et al., 1991) is also characterized close to the RING finger domain region of the human, rat and mouse (Eisenberg et al., 2002). The coiled-coil domain is involved in protein–protein/DNA interaction, which is observed in functional proteins, like some transcription factors, c-fos and tropomyosin (Zuo et al., 2010; Moore et al., 2011). mPY motif and SH2 binding
114
S. Moriya et al. / Neuroscience 294 (2015) 109–115
where pet1 expressing 5-HT neurons send projections in the zebrafish (Lillesaar et al., 2009). This suggests that the rnf38 gene in the telencephalic and hypothalamic region is induced by the decline of 5-HT levels. Induction of Rnf38 may be involved in the anxiety-like behavior or non-cell autonomous by the decline of 5-HT levels. Furthermore, the Rnf38 may play a common role in 5-HT-related physiologies through protein–protein/ DNA interactions among vertebrates because of conservation of the amino acid sequence.
CONCLUSION Fig. 6. Effect of CIT on rnf38 gene expression in the medaka brain. The gene expression in the relevant region of control sample was defined as 1.0. All of data are presented as mean ± SEM and analyzed by a one-way ANOVA and Tukey’s post hoc test for multiple comparisons. ⁄P < 0.05.
motif, which are key domains for ubiquitination, were not present. Therefore, Rnf38 may not be involved in ubiquitination as observed in many RING finger proteins, but may be involved in other functions such as a transcription factor (Morett and Bork, 1999; Yu et al., 2002; Tan et al., 2011). Furthermore, since all functional domains of Rnf38 including the RING finger domain, the KIL motif and the coiled-coil domain are highly conserved among species, the role of Rnf38 could also be conserved. To evaluate the effect of CIT treatment, anxiety-like behavior test was performed by transferring the fish to the novel tank after CIT exposure. Behavioral analysis revealed anxiety-like behavior in the 107 M group. The latency to the top half was increased and the number of transitions was decreased compared to the control group. Similar behavioral changes have been observed in other fish (Blaser and Gerlai, 2006; Levin et al., 2007; Lister et al., 2009; Cachat et al., 2010). In the bluehead wrasse, chronic administration of FLU causes reduction of aggressive behavior (Semsar et al., 2004). In the present study, medaka exposed to CIT had low pet1 mRNA levels in the hypothalamic region and pet1, slc6a4 and tph2 mRNA levels in the hindbrain. In zebrafish, several populations of pet1 expressing 5-HT neurons have been reported in the hypothalamus and the hindbrain (Lillesaar, 2011). This suggests that 5-HT synthesis and transport in pet1 expressing 5-HT neurons is suppressed by CIT exposure. The decreased presynaptic 5-HT could cause anxiety-like behavior. Furthermore, the pet1 expressing 5-HT neurons in the hindbrain may also be involved in the behavioral changes, since mRNA levels of the slc6a4 and tph2 were suppressed only in the hindbrain of the 107 M group. On the other hand, behavioral changes were not observed in the 108 M group. This result is comparable with goldfish experiment exposed to FLU (Mennigen et al., 2010). This is probably due to no change of 5-HT synthesis and transport. In fact, there are no changes in mRNA levels of slc6a4 and tph2 in both the hypothalamic region and hindbrain of the 108 M group. The rnf38 was ubiquitously expressed in all regions of the brain. The rnf38 expression was increased by CIT only in the telencephalic and the hypothalamic region,
In this research, the full length sequence of medaka rnf38 mRNA was identified and the RING finger domain and the KIL domain which is accompanied by RING finger domain was identified. Medaka exposed to CIT exhibited anxietylike behavior, suppression of the serotonergic systemrelated genes mainly in the hindbrain, and increase of the rnf38 gene expression in the telencephalic and the hypothalamic region. It suggests that rnf38 expression is negatively regulated by the serotonergic system. Acknowledgments—We thank Dr. Tomoko Soga, Dr. Takashi Kitahashi and Dr. Satoshi Ogawa for their constructive comments and Ms. Jalilah Idris and Ms. Asha Thanabalan for their excellent technical assistance. This work was supported by grants from Monash University Sunway Campus (SM-10-01) and Malaysian Ministry of Higher Education (FRGS/2/2010/SG/MUSM/03/3, FRGS/1/2013/ SKK01/MUSM/03/1, and FRGS/1/2013/SKK01/ MUSM/03/6).
REFERENCES Blaser R, Gerlai R (2006) Behavioral phenotyping in zebrafish: comparison of three behavioral quantification methods. Behav Res Methods 38:456–469. Borden KL (2000) RING domains: master builders of molecular scaffolds? J Mol Biol 295:1103–1112. Cachat J, Stewart A, Grossman L, Gaikwad S, Kadri F, Chung KM, Wu N, Wong K, Roy S, Suciu C, Goodspeed J, Elegante M, Bartels B, Elkhayat S, Tien D, Tan J, Denmark A, Gilder T, Kyzar E, DiLeo J, Frank K, Chang K, Utterback E, Hart P, Kalueff AV (2010) Measuring behavioral and endocrine responses to novelty stress in adult zebrafish. Nat Protocols 5:1786–1799. Eisenberg I, Hochner H, Levi T, Yelin R, Kahan T, MitraniRosenbaum S (2002) Cloning and characterization of a novel human gene RNF38 encoding a conserved putative protein with a RING finger domain. Biochem Biophys Res Commun 294:1169–1176. Freemont PS (1993) The RING finger. A novel protein sequence motif related to the zinc finger. Ann N Y Acad Sci 684:174–192. Freemont PS (2000) RING for destruction? Curr Biol 10:R84–R87. Freemont PS, Hanson IM, Trowsdale J (1991) A novel cysteine-rich sequence motif. Cell 64:483–484. Gaworecki KM, Klaine SJ (2008) Behavioral and biochemical responses of hybrid striped bass during and after fluoxetine exposure. Aquat Toxicol 88:207–213. Henry TB, Black MC (2008) Acute and chronic toxicity of fluoxetine (selective serotonin reuptake inhibitor) in western mosquitofish. Arch Environ Contam Toxicol 54:325–330. Jacobs BL, Azmitia EC (1992) Structure and function of the brain serotonin system. Physiol Rev 72:165–229. Kabayama M, Sakoori K, Yamada K, Ornthanalai VG, Ota M, Morimura N, Katayama K, Murphy NP, Aruga J (2013) Rines E3
S. Moriya et al. / Neuroscience 294 (2015) 109–115 ubiquitin ligase regulates MAO-A levels and emotional responses. J Neurosci 33:12940–12953. Khor YM, Soga T, Parhar IS (2013) Caffeine neuroprotects against dexamethasone-induced anxiety-like behaviour in the Zebrafish (Danio rerio). Gen Comp Endocrinol 181:310–315. Letunic I, Doerks T, Bork P (2012) SMART 7: recent updates to the protein domain annotation resource. Nucleic Acids Res 40:D302–D305. Levin ED, Bencan Z, Cerutti DT (2007) Anxiolytic effects of nicotine in zebrafish. Physiol Behav 90:54–58. Lillesaar C (2011) The serotonergic system in fish. J Chem Neuroanat 41:294–308. Lillesaar C, Stigloher C, Tannhauser B, Wullimann MF, Bally-Cuif L (2009) Axonal projections originating from raphe serotonergic neurons in the developing and adult zebrafish, Danio rerio, using transgenics to visualize raphe-specific pet1 expression. J Comp Neurol 512:158–182. Lister A, Regan C, Van Zwol J, Van Der Kraak G (2009) Inhibition of egg production in zebrafish by fluoxetine and municipal effluents: a mechanistic evaluation. Aquat Toxicol 95:320–329. Lorick KL, Jensen JP, Fang S, Ong AM, Hatakeyama S, Weissman AM (1999) RING fingers mediate ubiquitin-conjugating enzyme (E2)-dependent ubiquitination. Proc Natl Acad Sci U S A 96:11364–11369. Lucki I (1998) The spectrum of behaviors influenced by serotonin. Biol Psychiatry 44:151–162. Lupas A, Van Dyke M, Stock J (1991) Predicting coiled coils from protein sequences. Science 252:1162–1164. Macdonald DH, Lahiri D, Sampath A, Chase A, Sohal J, Cross NC (1999) Cloning and characterization of RNF6, a novel RING finger gene mapping to 13q12. Genomics 58:94–97. Mennigen JA, Lado WE, Zamora JM, Duarte-Guterman P, Langlois VS, Metcalfe CD, Chang JP, Moon TW, Trudeau VL (2010) Waterborne fluoxetine disrupts the reproductive axis in sexually mature male goldfish, Carassius auratus. Aquat Toxicol 100:354–364. Moore JR, Li X, Nirody J, Fischer S, Lehman W (2011) Structural implications of conserved aspartate residues located in tropomyosin’s coiled-coil core. Bioarchitecture 1:250–255. Morett E, Bork P (1999) A novel transactivation domain in parkin. Trends Biochem Sci 24:229–231. Nalepa G, Rolfe M, Harper JW (2006) Drug discovery in the ubiquitinproteasome system. Nat Rev Drug Discov 5:596–613. Ogawa S, Ng KW, Ramadasan PN, Nathan FM, Parhar IS (2012) Habenular Kiss1 neurons modulate the serotonergic system in the brain of zebrafish. Endocrinology 153:2398–2407.
115
Park JW, Heah TP, Gouffon JS, Henry TB, Sayler GS (2012) Global gene expression in larval zebrafish (Danio rerio) exposed to selective serotonin reuptake inhibitors (fluoxetine and sertraline) reveals unique expression profiles and potential biomarkers of exposure. Environ Pollut 167:163–170. Saurin AJ, Borden KL, Boddy MN, Freemont PS (1996) Does this have a familiar RING? Trends Biochem Sci 21:208–214. Schultz J, Milpetz F, Bork P, Ponting CP (1998) SMART, a simple modular architecture research tool: identification of signaling domains. Proc Natl Acad Sci U S A 95:5857–5864. Semsar K, Perreault HA, Godwin J (2004) Fluoxetine-treated male wrasses exhibit low AVT expression. Brain Res 1029:141–147. Sillaber I, Panhuysen M, Henniger MH, Ohl F, Ku¨hne C, Pu¨tz B, Pohl T, Deussing J, Paez-Pereda M, Holsboer F (2008) Profiling of behavioral changes and hippocampal gene expression in mice chronically treated with the SSRI paroxetine. Psychopharmacology 200:557–572. Stanley JK, Ramirez AJ, Chambliss CK, Brooks BW (2007) Enantiospecific sublethal effects of the antidepressant fluoxetine to a model aquatic vertebrate and invertebrate. Chemosphere 69:9–16. Takano Y, Adachi S, Okuno M, Muto Y, Yoshioka T, MatsushimaNishiwaki R, Tsurumi H, Ito K, Friedman SL, Moriwaki H, Kojima S, Okano Y (2004) The RING finger protein, RNF8, interacts with retinoid X receptor alpha and enhances its transcriptionstimulating activity. J Biol Chem 279:18926–18934. Tan Y, Yu F, Pereira A, Morin P, Zhou J (2011) Suppression of Nrdp1 toxicity by Parkin in Drosophila models. Biochem Biophys Res Commun 416:18–23. Yamada M, Yamada M, Yamazaki S, Takahashi K, Nishioka G, Kudo K, Ozawa H, Yamada S, Kiuchi Y, Kamijima K, Higuchi T, Momose K (2000) Identification of a novel gene with RING-H2 finger motif induced after chronic antidepressant treatment in rat brain. Biochem Biophys Res Commun 278:150–157. Yokouchi M, Kondo T, Houghton A, Bartkiewicz M, Horne WC, Zhang H, Yoshimura A, Baron R (1999) Ligand-induced ubiquitination of the epidermal growth factor receptor involves the interaction of the c-Cbl RING finger and UbcH7. J Biol Chem 274:31707–31712. Yu P, Chen Y, Tagle DA, Cai T (2002) PJA1, encoding a RING-H2 finger ubiquitin ligase, is a novel human X chromosome gene abundantly expressed in brain. Genomics 79:869–874. Zuo Z, Gandhi NS, Mancera RL (2010) Calculations of the free energy of interaction of the c-Fos-c-Jun coiled coil: effects of the solvation model and the inclusion of polarization effects. J Chem Inf Model 50:2201–2212.
(Accepted 5 March 2015) (Available online 12 March 2015)
