Funct Integr Genomics DOI 10.1007/s10142-014-0430-z
ORIGINAL PAPER
Cloning and functional characterization of nitrilase from Fusarium proliferatum AUF-2 for detoxification of nitriles Farnaz Yusuf & Irshad Ahmad Rather & Urmila Jamwal & Sumit G. Gandhi & Asha Chaubey
Received: 9 July 2014 / Revised: 17 December 2014 / Accepted: 25 December 2014 # Springer-Verlag Berlin Heidelberg 2015
Abstract A fungal nitrilase gene from Fusarium proliferatum AUF-2 was cloned through reverse transcription-PCR. The open reading frame consisted of 903 bp and potentially encoded a protein of 301 amino acid residues with a theoretical molecular mass of 33.0 kDa. The encoding gene was expressed in Escherichia coli strain BL21 and the recombinant protein with His6-tag was purified to electrophoretic homogeneity. The purified enzyme exhibited optimal activity in the range of 35–40 °C and pH 8.0. EDTA, Mg2+, Zn2+, Ca2+, Fe2+, Fe3+ and Mn2+ stimulated hydrolytic activity, whereas Cu2+, Co2+ and Ni2+ had inhibitory effect on nitrilase activity. Ag+ ions showed a strong inhibitory effect on the recombinant nitrilase activity. This nitrilase was specific towards aliphatic, heterocyclic and aromatic nitriles. The kinetic parameters Vmax and Km for benzonitrile substrate were determined to be 14.6 μmol/min/mg protein and 1.55 mM, respectively. Homology modelling and molecular docking studies provided an insight into the substrate specificity and the proposed catalytic triad for recombinant nitrilase consisted of Glu-54, Lys-133 and Cys-175. This is the first report on the cloning and heterologous expression of nitrilase from Fusarium proliferatum.
Keywords Fusarium proliferatum . Nitrilase . Cloning . Heterologous expression . Structure modelling F. Yusuf : I. A. Rather : U. Jamwal : S. G. Gandhi (*) : A. Chaubey (*) CSIR-Indian Institute of Integrative Medicine, Canal Road, Jammu 180001, India e-mail: [email protected] e-mail: [email protected] S. G. Ghandi e-mail: [email protected] A. Chaubey e-mail: [email protected]
Abbreviations IPTG Isopropyl β-D-1-thiogalactopyranoside RACE Rapid amplification of cDNA ends RT-PCR Reverse transcriptase-polymerase chain reaction UTR Untranslated region SDS Sodium dodecyl sulphate-polyacrylamide gel PAGE electrophoresis DTT Dithiothreitol EDTA Ethylenediaminetetraacetic acid CTAB Cetyltrimethylammonium bromide ORF Open reading frame PMSF Phenylmethylsulphonyl fluoride Ni-NTA Nickel-nitrilotriacetic acid
Introduction Nitrilases (EC 3.5.5.1) constitute branch 1 of the nitrilase superfamily, which consists of enzymes acting on non-peptide C–N bonds (Brenner 2002). Nitrilases are versatile enzymes in biocatalysis, mediating the hydrolysis of diverse nitriles under mild conditions directly into their corresponding acids without the formation of any toxic side products, thus, having minimal impact on environment. They have played a crucial role in detoxification of nitrile-contaminated wastes (Gong et al. 2012a; Zhu et al. 2013). Nitrilases are notably reported for the production of nicotinic acid, ibuprofen, acrylic acid and hydroxy acids, such as mandelic, 3-hydroxyvaleric and glycolic acid (Zhang et al. 2011; Petrickova et al. 2012). Their activities are often independent of expensive cofactors, hence, making them more suitable for industrial applications (Nestl et al. 2011). Nitrilases have been reported since 1960’s with the first report from plant (Thimann and Mahadevan 1964) and since then, an increasing number of nitrilases from different sources
Funct Integr Genomics
have been discovered. Nitrilases have been found in bacteria (Banerjee et al. 2002), fungi (Martinkova et al. 2009), plants (Schreiner et al. 2010) and animals (Pace and Brenner 2001). According to both activity screens and gene database searches, filamentous fungi appear to be rich sources of nitrilases (Petrickova et al. 2012). However, fungal nitrilases have been less explored than the bacterial ones (Gong et al. 2012a). Since biocatalysts from the native source have limitations with respect to some enzymatic properties in process development, a recombinant enzyme may provide the possibility to meet the synthetic application requirements with high efficiency. It may also lead to a better understanding and improvement in enzyme function for various biotechnological applications. Several nitrilase genes have been cloned from various organisms and introduced into appropriate host strains. The first nitrilase gene cloned and expressed in Escherichia coli was from Klebsiella ozaenae (Stalker et al. 1988). Since then, several researchers reported on cloning of bacterial nitrilases (Qiu et al. 2014; Zhu et al. 2013; Wang et al. 2013; Liu et al. 2011; Luo et al. 2010; Mueller et al. 2006; Kiziak et al. 2005; Bhalla et al. 1995). Recently, nitrilase from Pseudomanas sp. has been cloned and expressed in E. coli. This nitrilase was biochemically characterized (Duca et al. 2014). Heterologous expression of genes that encodes nitrilases from filamentous fungi has been investigated scarcely. So far, nitrilases from Aspergillus niger CBS 513.88, A. niger K10, Gibberella moniliformis, Neurospora crassa OR74A and Penicillium marneffei ATCC 18224 have been cloned and expressed in E. coli (Petrickova et al. 2012). Nitrilase from Gibberella intermedia CA3-1 was heterologously expressed and characterized by Gong et al. (2012b). Kaplan et al. (2013) reported expression of several fungal and bacterial nitrilases identified by genome mining and studied their substrate specificity. Although, there are reports on nitrilase production from Fusarium proliferatum (Yusuf et al. 2013a, 2013b; Jin et al. 2012), to the best of our knowledge, there are no reports on heterologous expression of nitrilase from F. proliferatum. Therefore, studies on F. proliferatum nitrilase gene expression needs to be done in order to advance our understanding for nitrile hydrolysis. In our previous work, a fungus F. proliferatum strain AUF-2 (Yusuf et al. 2013a, 2013b) was shown to be a promising strain for nitrilase production. Present report relates to cloning of its nitrilase gene through reverse transcription-PCR (RT-PCR) and its heterologous expression in E. coli for use in possible industrial applications.
Materials and methods Strains, plasmids, enzymes and chemicals Fusarium proliferatum strain AUF-2, used in this study, was grown and maintained on a modified Czapek-Dox agar
medium as described previously (Yusuf et al. 2013a). E. coli strains DH5 and BL21 (DE3) were used as hosts for cloning and expression experiments, respectively. The plasmid pTZ57R/T InsTA (Fermentas, USA) and pET-28a (Novagen, USA) were used for cloning and expression of the nitrilase in E. coli. Restriction endonuclease, T4 DNA ligase and Taq DNA polymerase were obtained from Fermentas, USA. IPTG and X-gal were obtained from Sigma-Aldrich, USA. Cloning of core fragment The core fragment of nitrilase gene of F. proliferatum was amplified from genomic DNA. The DNA was isolated by CTAB extraction method (Doyle and Doyle 1987). Following set of degenerate oligonucleotide primers were used: forward primer S2F1b and reverse primer S2R2a (Table 1). The amplification was carried out in total volume of 50 μL using Eppendorf Mastercycler® pro. PCR programme used for amplification was as follows: initial denaturation (5 min at 95 °C), followed by 35 cycles of denaturation (95 °C for 30 s), annealing (50 °C for 1 min) and primer extension (72 °C for 50 s), followed by final extension step for 10 min at 72 °C. The fragment of 573 bp was obtained which was cloned into the pTZ57R/T InsTA cloning vector (Fermentas, USA) and was subjected to nucleotide sequencing. This fragment was used for designing gene specific primers for the cloning of 5′ and 3′ ends of the nitrilase by performing RACE-PCR. RNA isolation and cDNA synthesis The culture was grown in Czapek-Dox medium at 28 °C, 200 rpm for 72 h, thereafter harvested by centrifugation at
Table 1 The relevant primer sequences used in cloning and expression of nitrilase from Fusarium proliferatum (AUF-2) Primer name
Primer sequence (5′→3′)
S2F1b S2R2a FZ1R FZ1F 3′ RACE outer primer
TTACCHGARTGYTTYAAY RTG DCC RTA NGC RTG RTA GTAGTACTTCTTCGTATTCGGGCTG TGAACTAGCCACCATTGCAGCTCG GCGAGCACAGAATTAATACGACT
3′ RACE inner primer CGCGGATCCGAATTAATACGACTCACTA TAGG FNT GTA GTA CTT CTT CGT ATT CGG GCT G 5′ RACE outer primer GCTGATGGCGATGAATGAACACTG 5′ RACE inner primer CGCGGATCCGAACACTGCGTTTGCTG GCTTTGATG Pnitf tttCCATGGTTATGCGAACTGTCCTTGGC CGAC Pnitr tttAAGCTTGTGGCCGTATGCGTGGTAGCC
Funct Integr Genomics
15,000×g for 15 min at 4 °C. Total RNA was extracted from the fungal mycelia using TRIzol reagent (Invitrogen), and the quality and quantity of RNA was checked on 2 % agarose gel electrophoresis and by spectrophotometry analysis (Thermo Scientific NanoDrop 2000c, USA), respectively. DNA was removed from the RNA sample using the Ambion® DNAfree™ kit according to the manufacturer’s instructions. Complementary DNA (cDNA) synthesis was carried out using M-MLV reverse transcriptase (Promega) with an oligo(dT) primer following the manufacturer’s instructions.
Cloning of 3′ RACE and 5′ RACE First-strand cDNA synthesis for 3′ and 5′ RACE was carried out using First Choice® RLM-RACE Kit (Ambion, USA) following the manufacturer’s instructions. All the relevant primer sequences used in cloning and expression of nitrilase from F. proliferatum AUF-2 are shown in Table 1. The 3′ RACE-PCR reaction was carried out using FZ1R and 3′ RACE outer primer. Nested PCR was performed using FZ1F along with 3′ RACE inner primer by using primary PCR product as template. Both the primary and nested PCR reactions were carried under the following thermal profile conditions: initial denaturation (5 min at 95 °C), followed by 35 cycles of denaturation (95 °C for 20 s), annealing (60 °C for 30 s) and primer extension (72 °C for 30 s), followed by final extension step for 5 min at 72 °C. Similar procedure was followed to carry out 5′ RACE-PCR in which FNT and 5′ RACE outer and FNT and 5′ RACE inner primers were used for the initial and nested PCR reactions, respectively. Thermal profile for both initial and nested PCR was as follows: initial denaturation (3 min at 95 °C), followed by 35 cycles of denaturation (95 °C for 20 s), annealing (56 °C for 30 s) and primer extension (72 °C for 35 s), followed by final extension step for 5 min at 72 °C. Amplified DNA fragments of both 3′ and 5′ RACE were cloned in pTZ57R/T InsTA cloning vector (InsTA Clone PCR Cloning Kit; Fermentas, USA) and transformed into DH5α competent cells. Positive clones based on blue white screening were selected and sequenced using ABI 3130xl Genetic Analyzer (Applied Biosystems, USA). Sequences of core fragment, 5′ and 3′ RACE products were assembled, and full length cDNA sequence of nitrilase gene was obtained (Fig. 1). Basic Local Alignment Search Tool (BLAST, www.ncbi.nlm.nih.gov/blast) was employed for the GenBank search and identity assessment. Nucleotide sequence of nitrilase obtained was conceptually translated using ExPASy tool (http://web.expasy.org/cgibin/translate/dna). The sequence of nitrilase gene from F. proliferatum AUF-2 has been submitted to NCBI GenBank (accession no. KF003025).
Fig. 1 Cloning of the fungal nitrilase gene from Fusarium proliferatum AUF-2: amplification of the DNA sequence encoding nitrilase gene (lane 1: marker, lane 2: PCR product amplified using degenerate forward primer S2F1b and reverse primer S2R2a)
Construction of expression plasmid for nitrilase gene For cloning the full-length coding sequence of nitrilase gene of F. proliferatum AUF-2, a pair of primers was designed as follows: Pnitf and Pnitr, incorporating HindШ and NcoI sites, respectively. Full-length ORF was amplified from oligo(dT)primed cDNA using proof-reading DNA polymerase-Deep VentR™ (New England Biolabs). PCR was performed with cDNA with following programme: initial denaturation (5 min at 95 °C), followed by 35 cycles of denaturation (95 °C for 20 s), annealing (58 °C for 30 s) and primer extension (72 °C for 1 min), followed by final extension step for 5 min at 72 °C. The PCR product was double digested with HindШ and NcoI. The resulting 903 bp fragment containing the intact nitrilase genes was ligated using T4 DNA ligase into the pET28a vector which had been linearized with the enzymes of HindШ and NcoI. pET28a plasmid containing in frame insertion of nitrilase gene was transformed into chemically competent E. coli DH5α cells. Clones were confirmed for sequence, orientation and coding frame using restriction analysis, PCR and sequencing.
Heterologous expression and purification of His6-tagged nitrilase The recombinant plasmid carrying the nitrilase genes was transformed into E. coli BL21 (DE3) cells. The resulting recombinant cells, BL21(DE3)/pET-Nit, were grown at 37 °C in 50 mL of LB media containing 50 μL of kanamycin (50 mg/mL). Production of recombinant enzyme was induced by addition of 1 mM IPTG when optical density (at 600 nm) of the culture broth reached between 0.6 and 0.8. The cells were incubated at 20 °C for 20 h after induction and were harvested by centrifugation at 5000×g for 10 min at 4 °C. The cells were washed with PBS buffer. The cells were then resuspended in lysis buffer (50 mM NaH2PO4, 300 mM NaCl, 1 mM DTT, 10 mM imidazole, 1 mM PMSF pH 8.0) and disrupted at 4 °C by
Funct Integr Genomics
ultrasonication using the ultrasonic cell disruptor (Sartorius stedim LABSONIC M) which was operated at 100 W for 15 min. The cell debris was removed by centrifugation (14, 000×g, 30 min, 4 °C). Since the recombinant nitrilase carried a C-terminal affinity tag of six consecutive histidine residues, it was purified using the QIAexpress Ni-NTA protein purification system (Qiagen). The cell-free extracts were applied onto a NiNTA superflow column (10 mL), which was previously equilibrated with equilibration buffer (50 mM NaH2PO4, 300 mM NaCl, 1 mM DTT, 10 mM imidazole pH 8.0). The unbound protein was washed out from the column by wash buffer (50 mM NaH2PO4, 300 mM NaCl, 1 mM DTT, 20 mM imidazole pH 8.0). The elution was carried using the elution buffer (50 mM NaH2PO4, 300 mM NaCl, 1 mM DTT, 250 mM imidazole pH 8.0). Protein concentration was determined by the Coomassie brilliant blue G-250 dye-binding method (Bradford 1976) using bovine serum albumin as standard protein.
Fig. 2 Amino acid sequence alignment of nitrilases from different origin. The nitrilase from F. oxysporum (EWZ37052), F. verticilliodes (EWG40656), F. proliferatum AUF-2 (KF003025), putative nitrilase from M. anisopliae (EFY98466), N. crassa (EAA31670), putative nitrilase from E. lata (EMR71034) and A. fumigatus (XP751200)
different substrate concentrations (0.5–50 mM). Michaelis– Menten constant was calculated from Lineweaver–Burk plot.
Substrate spectrum of recombinant nitrilase The substrate spectrum was assayed using 20 mM of various nitriles as the substrate (Table 2). The conversion was assayed by determining ammonia generated in the reaction mixture as aforementioned. A control experiment without enzyme was performed for each substrate.
SDS-PAGE analysis Cell-free extracts and elution fractions were analysed by 12 % SDS-PAGE using a Mini-gel system (Bio-Rad). The gels were cast with 0.75-mm spacers (Bio-Rad). SDS-PAGE was performed according to Laemmli (1970). Standard molecular weight markers in the range of 14.4–116 kDa were procured from Fermentas, USA.
Effect of pH and temperature The influence of pH on the nitrilase activity was measured under the standard assay conditions using 100 mM buffers in the range of pH 4.0–5.0 (citrate), pH 6.0–8.0 (phosphate), pH 9.0–10.0 (Glycine-NaOH). The temperature dependence
Nitrilase assay Nitrilase activity was measured using benzonitrile as substrate in a total reaction volume of 250 μL and incubated at 37 °C for 30 min. The standard reaction consisted of 50–60 μg of enzyme in 100 mM phosphate buffer (pH 8.0) and 20 mM of substrate. The enzyme activity was determined by measuring the ammonia generation by the phenol–hypochlorite method in the reaction mixture as reported earlier (Yusuf et al. 2013a). Alternatively, rapid semiquantitative detection of nitrilase activity of purified enzyme was measured by monitoring the absorption of benzoic acid at 238 nm on Labindia UV-3000 (ε=3.3 L/mmol/cm) as described by Vejvoda et al. (2008). The standard assay consisted of 50–60 μg of the protein in a total reaction volume of 600 μL using 0.5 mM benzonitrile in 100 mM phosphate buffer (pH 8.0). A reaction mixture without enzyme was used as the blank. All assays were performed in triplicate, and the results shown are average values of these experiments with standard errors. Kinetic parameters of the recombinant nitrilase To study the kinetic parameters of the purified nitrilase towards benzonitrile, the activity assays were performed with
Table 2 Substrate spectrum of recombinant nitrilase from Fusarium proliferatum AUF-2 Substrate
Relative activity %
Benzonitrile Acetonitrile Propionitrile Butyronitrile Acrylonitrile Fumaronitrile Succinonitrile Mandelonitrile Di-phenylacetonitrile Glutaronitrile 3-Nitrobenzonitrile 4-Nitrobenzonitrile 2-Cyanopyridine 3-Cyanopyridine 4-Cyanopyridine 3-phenylpropionitrile
100a 135 416 425 400 ND ND 69 72 319 110 151 110 151 225 151
3-Aminobutyronitrile 4-Aminobutyronitrile
201 251
ND means not detected a
Specific activity 5.3 U/mg protein
Funct Integr Genomics
Funct Integr Genomics
of the recombinant nitrilase was estimated under the standard conditions (pH 8.0) in the range of 20–60 °C. Effect of metal ions and co-solvents The effect of various metal ions (Ca 2+ , Cu2+, Fe2+ , Fe3+, Mn2+, Zn2+, Ca2+, Mg2+, Ba2+, Li+, Co2+, Ag+ and EDTA) on the enzyme activity was tested at a final concentration of 1 mM. The influence of the solvents ethanol, methanol, hexane, toluene, dichloromethane and propanol was tested at 5 % (v/v). Sequence analysis The nucleotide sequences of the partial gene fragment and 3′ and 5′ RACE-PCR products were assembled using the assembly tool in CLC Genomics Workbench (http:// www.clcbio.com/products/clc-genomics-workbench/). ORF Finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html) was used to predict the possible ORFs in the full length nitrilase from F. proliferatum AUF-2 nucleotide sequence. The nucleotide sequence of nitrilase was
Fig. 3 Nucleotide and the deduced amino acid sequence of nitrilase. 5′ and 3′ UTR are shown in blue and red box, respectively
conceptually translated using ExPASy Translate Tool (http://web.expasy.org/cgi-bin/translate/dna). Multiple sequence alignment was carried out with related protein sequences from different origins (Fig. 2) to assess the degree of homology, using the ClustalW2 tool (http:// www.clustal.org/clustal2/). The theoretical isoelectric point and molecular weight of the protein was calculated using ComputePI tool on ExPASy website (http://web.expasy.org/compute_pi/). SOPMA (http:// npsa-pbil.ibcp.fr/cgi-bin/secpred_sopma.pl) was used for prediction of protein secondary structure. 3D structure modelling of the protein was done using the automated mode of SWISS-MODEL tool on the ExPASy website (http://swissmodel.expasy.org/workspace/). Default parameters were used for all the above softwares (unless specified otherwise).
Homology modelling and docking studies The 3D structure of nitrilase was built using online SWISSMODEL software (http://swissmodel.expasy.org/). Template was selected by modeller based on its features and alignment
Funct Integr Genomics
with the target. The template used by modeller for building model was the crystal structure of nitrilase protein NIT3 from Sacharomyces cerevisiae (PDB ID: 1F89) with a 2.40 Å resolution.
Results Cloning and sequence analysis of the fungal nitrilase gene The nitrilase sequences available in NCBI GenBank were used to design degenerate primers, based on the conserved domain deduced from the reported amino acid and nucleotide sequences encoding nitrilase from fungal source. The core amplicon of 573 bp was obtained. Sequence of the core amplicon was used for designing 5′ and 3′ RACE primers. RACE-PCR was carried out to obtain the 5′ and 3′ ends of the cDNA, giving an amplicon size of approximately 504 and 488 bp, respectively. The full-length clone (Fig. 1) of 903 bp was sequenced and submitted to NCBI GenBank (accession no. KF003025). The sequence analysis demonstrated that the target fragment contained an open reading frame of 903 nucleotides, starting with an ATG codon at position 166 and ending with TAA codon at position 903. The 5′ and 3′ UTR are 165 and 122 bp including polyA tail, respectively.
Heterologous expression of the F. proliferatum nitrilase and its purification To express the gene encoding nitrilase, primers Pnitf and Pnitr were designed according to the sequencing result of pTZ57R/T-NIT, with NcoI and HindIII sites, respectively. PCR amplification was conducted by adopting the recombined plasmid pTZ57R/T-NIT obtained above as the template, and the DNA fragment encoding the nitrilase gene was subcloned into an expression vector pET28a(+) to construct the recombinant plasmid pET28a(+)NIT. Subsequently, the recombinant plasmids were then transformed into chemically competent cells of E. coli BL21 (DE3). The positive transformant containing recombinant pET28a(+)-NIT was identified by colony PCR and double enzymatic digestion. The recombinant cell harbouring pET28a (+)-NIT was induced by 1 mM of IPTG at 20 °C for about 20 h when the OD600 reached the value of 0.6 to 0.8. Protein bands from SDS-PAGE were visualized by staining with
Analysis of the deduced amino acid sequence The nitrilase encoded a protein of 301-amino-acid with a theoretical molecular mass of 33 kDa which is in close agreement with the apparent molecular weight of 37 kDa. It was having the theoretical isoelectric point of 5.83. The protein consists of 24.3 % alpha helix, 26.3 % extended strand, random coils 42 % and beta turns 7.3 %. The sequence alignment results (Fig. 2) indicated that the fungal nitrilase from F. proliferatum AUF-2 showed 98 % identity with the nitrilase from Fusarium oxysporum (EWZ 37052) and Fusarium v e r t i c i l l i o d e s ( E W G 4 0 6 5 6 ) . T h e i d e n t i t i e s of F. proliferatum AUF-2 nitrilase gene to the other nitrilases from, Eutypa lata (EMR 71034), Metarhizium anisopliae (EFY 98466), Neurospora crassa (EAA 31670), Aspergillus fumigatus (XP751200) were 72, 76, 70 and 69 %, respectively. Nucleotide and the deduced amino acid sequence of nitrilase from F. proliferatum AUF-2 are shown in Fig. 3.
Fig. 4 SDS-PAGE of the recombinant nitrilase from Fusarium proliferatum (AUF-2) stained with Coomassie brilliant blue R-250
Funct Integr Genomics
Coomassie brilliant blue. The molecular mass of the recombinant nitrilase was approximately 37 kDa (Fig. 4). These data are in agreement with those derived from DNA sequencing.
Effects of the environmental factors on the nitrilase activity The highest nitrilase activity was found in the temperature range of 35 to 40 °C. The nitrilase activity gradually increased from 20 to 40 °C and decreased drastically above 45 °C (Fig. 5a). The nitrilase showed an optimum activity at pH 8.0. As shown in Fig. 5b, this enzyme exhibited a broad pH range, from pH 6.0 to10.0. The nitrilase activity in presence of various metal ions was determined (Fig. 5c). The enzyme activity
Fig. 6 3D model of recombinant nitrilase from Fusarium proliferatum (AUF-2)
Fig. 5 Effects of environmental factors on the activity of nitrilase for benzonitrile (specific activity of the enzyme showing 100 % activity was 5.3 U/mg protein). a Effect of temperature on nitrilase activity. The relative activity was expressed at the percentage of the activity at 37 °C. b Effect of pH on nitrilase activity. The relative activity was expressed at the
percentage of the activity at pH 8.0. c Effect of metal ions on nitrilase activity. The relative activity was expressed at the percentage of the activity without addition of metal ions. d Effect of organic solvents on nitrilase activity. The relative activity was expressed at the percentage of the activity without addition of organic solvents
Funct Integr Genomics
was strongly inhibited by Ag+ . The metal ions like Ni2+, Co2+ and Cu2+ caused a decrease in enzymatic activity, while as Zn2+, Ca2+, Mg2+, Mn2+, Fe2+, Fe3+ and EDTA improved the nitrilase activity. The effect of co-solvents 5 % (v/v) on nitrilase activity was studied (Fig. 5d). It was observed that the enzyme was relatively active in methanol followed by ethanol. The activity decreased drastically in other solvents like propanol, hexane, toluene and dichloromethane. Substrate spectrum of the recombinant nitrilase The recombinant nitrilase from F. proliferatum AUF-2 was able to hydrolyze a wide range of nitriles (Table 2). This nitrilase is highly specific towards aliphatic, aromatic and heterocyclic nitriles. However, no activity was detected for dinitriles. Kinetic parameters of the recombinant nitrilase The kinetic parameters of the recombinant nitrilase were determined with benzonitrile as the substrate. It was calculated that Vmax and Km were 14.6 μmol/min/mg protein and 1.55 mM, respectively using benzonitrile as substrate.
region, 11.8 % residues in the additional allowed region, 2.5 % in the generously allowed region and 0.8 % in the disallowed region (Fig. 7). The results of the PROCHECK analysis indicate that a relatively low percentage of residues have phi/psi angles in the disallowed regions suggesting the acceptability of Ramachandran plots for nitrilase protein. The nitrilase protein was prepared for docking calculations using the Protein Preparation Workflow (Schroidinger Suite 2012, Protein Preparation Wizard). Hydrogen atoms were added to the protein model. The added hydrogen atoms were minimized to have a stable energy conformation and also to relax the conformation from close contacts. The conserved catalytic residues Glu-54, Lys-133 and Cys-175 from nitrilase protein were proposed to be the catalytic triad of nitrilase. The resulting model was used for docking studies by generating a cubic grid of 20 Å around the defined catalytic triad pocket (CEK). Ligand docking was carried out using Glide XP precision mode. The molecular docking studies of the F. proliferatum AUF2 nitrilase show substrate interactions in the active site. Figure 8 demonstrates the results of molecular docking of various nitrile substrates with the catalytic triad of nitrilase. Bond lengths between the –N of nitrile substrate and –H associated with sulphur of Cys 175; –H
Homology modelling, identification of binding site and molecular docking 3D homology model of nitrilases was generated using online SWISS-MODEL software (http://swissmodel.expasy.org/) as shown in Fig. 6. The template used by modeller for building model was the crystal structure of nitrilase protein NIT3 from S. cerevisiae (PDB ID: 1F89) with a 2.40 Å resolution. We selected this protein, as it belongs to the branch 10 of nitrilase superfamily and also, the nitrilase domain structures are present in the protein (Pace and Brenner 2001; Kumaran et al. 2003). F. proliferatum AUF-2 nitrilase gene has a primary sequence identity of 51.76 % and sequence coverage of 93 % with NIT3 gene from S. cerevisiae. The model was built in the absence of ligands and has a QMEAN Z-score of −2.644. Protein refinements were performed using Protein Preparation Wizard in Maestro v9.3 (Schrodinger, LLC, USA) (http://www.schrodinger.com/). The stereo chemical analysis of the modelled proteins was carried out using Ramachandran plot obtained from Procheck module of the SAVES server (http://services. mbi.ucla.edu/SAVES/). The stereo-chemical qualities of the predicted models of nitrilase were validated by PROCHECK server. Ramachandran plot analysis of nitrilase showed 84.9 % residues in the most favourable
Fig. 7 Ramachandran plot of recombinant nitrilase from Fusarium proliferatum (AUF-2). The plot calculations on the 3D models of F. proliferatum nitrilase was computed with the PROCHECK server. The most favoured regions are coloured red (A, B, L) and additional allowed (a, b, l, p), generously allowed (−a, −b, −l, −p) and disallowed regions are indicated as yellow, light yellow and white regions, respectively
Funct Integr Genomics
Fig. 8 Molecular docking of nitrilase from Fusarium proliferatum (AUF-2): diagram showing a acetonitrile, b acrylonitrile, c butyronitrile, d benzonitrile, e diphenyl acetonitrile, f fumaronitrile, g 2-cyanopyridine, h 3-cyanopyridine, i 4-cyanopyridine
of Lys 133 and –O of Glu 54 are shown with each substrate. In the docking studies (Table 3), it was revealed that the nitrilase was more specific towards higher aliphatic nitriles, followed by heterocyclic and aromatic nitriles, respectively. These results further confirmed the results of wet lab experiments as shown in Table 2.
Discussion Nitrilase enzymes are part of a large superfamily, classified into 13 branches, of which only branch 1 (EC 3.5.5.1) converts nitriles directly to their corresponding carboxylic acids without formation of any amide (Duca
et al. 2014). Due to the increasing demand of nitrilases in industrial applications, discovery of novel nitrilases h a s r e c e i v e d c o n s i d e r a b l e a t t e n t i o n . R e c e n t l y, F. proliferatum has been reported as a potential nitrilase producer (Jin et al. 2012; Yusuf et al. 2013a, 2013b). In our previous studies, we reported nitrilase from F. proliferatum AUF-2 with overall nitrilase production of 26-58 U/g wet cell biomass for benzonitrile (Yusuf et al. 2013a, 2013b). In order to over-express this nitrilase, we cloned nitrilase gene from F. proliferatum AUF-2 into E. coli host, resulting in 24 U/g wet cell biomass of nitrilase activity for benzonitrile substrate. The sequence analysis demonstrated that the target fragment contained an open reading frame of 903 bp, encoding a protein of 301 amino acid residues. A theoretical molecular mass of 33.0 kDa has been observed
Funct Integr Genomics Table 3 Substrates docking studies of recombinant nitrilase from Fusarium proliferatum AUF-2 Substrate
Docked energy (kcal/mol)
MMGBSAdG bind
S-Naproxen Nitrile R-Naproxen Nitrile R-Mandelonitrile S-Mandelonitrile (S)-2-phenylbutyronitrile (R)-2-phenylbutyronitrile 2-Cyanopyridine 3-Cyanopyridine 4-Cyanopyridine
−5.295 −5.235 −4.668 −4.406 −4.490 −4.528 −3.265 −3.458 −3.105
−44.203 −39.049 −27.797 −34.615 −38.726 −37.001 −24.351 −26.734 −22.248
Diphenylacetonitrile 3-Nitrobenzonitrile 4-Nitrobenzonitrile Benzonitrile Acetonitrile Acrylonitrile Propionitrile Butyronitrile
−4.282 −3.439 −3.664 −3.595 −1.629 −0.946 −1.008 −2.334
−37.926 −29.540 −29.433 −18.587 −9.340 −11.830 −15.582 −23.620
Fumaronitrile 3-Aminobutyronitrile 4-Aminobutyronitrile 3-Phenylpropionitrile
−1.529 −3.317 −2.671 −3.452
−16.064 −26.235 −26.343 −35.587
for the recombinant nitrilase from F. proliferatum AUF2. Other fungal nitrilases expressed in E. coli have been reported to have a molecular mass in the same range, e.g. 35–45 kDa (Petrickova et al. 2012; Gong et al. 2012b). The recombinant nitrilase reported herein has demonstrated wide substrate specificity, acting on aliphatic, heterocyclic and aromatic nitriles. Based on resting cells activity for benzonitrile substrate, nitrilase production in the recombinant F. proliferatum AUF-2 was found to be 144 U/L culture. It was also observed that the nitrilase from F. proliferatum AUF-2 has a higher affinity towards aliphatic substrates as shown in Table 2. It was also observed that the nitrilase activity increased with the increase in carbon chain of nitrile substrates. This is in agreement with the substrate affinity of the wild-type nitrilase from F. proliferatum AUF-2 and other previously reported nitrilases from Alcaligenes faecalis ZJUTB10 (Liu et al. 2011) and G. intermedia (Gong et al. 2012b). The preference for hydrolysis of heterocyclic nitriles was in the order of para > meta > ortho, as also reported for G. intermedia (Gong et al. 2012b). These results were further confirmed by the molecular docking studies as shown in Table 3.
Characterization studies showed that this nitrilase has the highest activity in the range of 35–40 °C and alkaline pH favoured its activity. The nitrilase activity decreased sharply above 40 °C, which is similar to P. putida CGMCC3830 (Zhu et al. 2013). The enzyme has broad pH range (pH 6.0–9.0) as found in F. oxysporum f sp. melonis (Goldlust and Bohak 1989) and G. intermedia (Gong et al. 2012b). It was also observed that the nitrilase activity was enhanced in the presence of metal ions like Zn2+, Ca2+, Mg2+, Mn2+, Fe2+, Fe3+ and EDTA as found in G. intermedia and A. faecalis ZJUTB10 (Gong et al. 2012b; Liu et al. 2011). Enzyme activity was strongly suppressed by thiol-binding metal ions such as Ag+, as previously observed in the case of G. intermedia (Gong et al. 2012b), P. putida CGMCC3830 (Zhu et al. 2013), Pyrococcus abyssi (Mueller et al. 2006), Fusarium solani O1 (Vejvoda et al. 2008) and A. niger K10 (Kaplan et al. 2006). The recombinant nitrilase was active in 5 % (v/v) methanol while as the nitrilase activity was greatly decreased when propanol and toluene were used as co-solvents as was found in G. intermedia (Gong et al. 2012b). The encoding protein sequence of nitrilase from F. proliferatum AUF-2 showed 98 % identity with the n i t r i l a s e f r o m F. o x y s p o r u m ( E W Z 3 7 0 5 2 ) a n d F. verticilliodes (EWG 40656), 76 % with M. anisopliae (EFY 98466), 72 % with E. lata (EMR 71034), 70 % with N. crassa (EAA 31670) and 69 % with A. fumigatus (XP751200) (Fig. 2). In reference to the biochemically characterized nitrilases, A. faecalis ZJUTB10 nitrilase showed 33 % identity, whereas, nitrilase from A. niger K10 showed 22 % identity with the recombinant nitrilase from F. proliferatum AUF-2. Nitrilases are believed to have catalytic triad consisting of glutamate, cysteine and lysine residues at their catalytic site (Brenner 2002). Our molecular docking studies suggested that the catalytic triad in nitrilase from F. proliferatum AUF-2 consists of Glu-54, Lys-133 and Cys-175 residues. Docking studies by Liu et al. (2011) suggested a catalytic triad comprising of Glu-47, Lys129 and Cys-163 in nitrilase from A. faecalis ZJUTB10. Molecular docking studies with wide substrate spectrum (Table 3) and supporting wet lab experiments (Table 2) reveal that the recombinant nitrilase can hydrolyse a wide range of nitrile substrates and can be useful for detoxification of nitriles from the contaminants and industrial wastes. Acknowledgments The financial support received from the 12th FYP Project—Plant-Microbe and Soil Interactions (PMSI; BSC0117), for this work is gratefully acknowledged.
Funct Integr Genomics
References Banerjee A, Sharma R, Banerjee UC (2002) The nitrile-degrading enzymes: current status and future prospects. Appl Microbiol Biotechnol 60:33–44 Bhalla TC, Aoshima M, Misawa S, Muramatsu R, Furuhashi K (1995) The molecular cloning and sequencing of the nitrilase gene of Rhodococcus rhodochrous PA-34. Acta Biotechnol 3:297–306 Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248–254 Brenner C (2002) Catalysis in the nitrilase superfamily. Curr Opin Struct Biol 12:775–782 Doyle JJ, Doyle JL (1987) A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem Bull 19:11–15 Duca D, Rose DR, Glick BR (2014) Characterization of a nitrilase and a nitrile hydratase from Pseudomonas sp. UW4 that converts indole3-acetonitrile to produce indole-3-acetic acid. Appl Environ Microbiol 80:4640–4649 Goldlust A, Bohak Z (1989) Induction, purification, and characterization of the nitrilase of Fusarium oxysporum f sp. melonis. Biotechnol Appl Biochem 11:581–601 Gong JS, Lu ZM, Li H, Shi JS, Zhou ZM, Xu ZH (2012a) Nitrilases in nitrile biocatalysis: recent progress and forthcoming research. Microb Cell Factories 11:142 Gong JS, Li H, Zhu XY, Lu ZM, Wu Y, Shi JS, Xu ZH (2012b) Fungal His-tagged nitrilase from Gibberella intermedia: gene cloning, heterologous expression and biochemical properties. PLoS ONE 7(11): e50622. doi:10.1371/journal.pone.0050622 Jin LQ, Liu ZQ, Xu JM, Zheng YG (2012) Biosynthesis of nicotinic acid from 3-cyanopyridine by a newly isolated Fusarium proliferatum ZJB-09150. World J Microbiol Biotechnol 3:431–440 Kaplan O, Vejvoda V, Plihal O, Pompach P, Kavan D et al (2006) Purification and characterization of a nitrilase from Aspergillus niger K10. Appl Microbiol Biotechnol 73:567–575 Kaplan O, Vesela AB, Petrickova A, Pasquarelli F, Picmanova M, Rinagelova A, Bhalla TC, Patek M, Martinkova L (2013) A comparative study of nitrilases identified by genome mining. Mol Biotechnol 54:996–1003 Kiziak C, Conradt D, Stolz A, Mattes R, Klein J (2005) Nitrilase from Pseudomonas fluorescens EBC191: cloning and heterologous expression of the gene and biochemical characterization of the recombinant enzyme. Microbiology 151:3639–3648 Kumaran D, Eswaramoorthy S, Gerchman SE, Kycia H, Studier FW, Swaminathan S (2003) Crystal structure of a putative CN hydrolase from yeast. Proteins 52:283–291 Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680–685 Liu ZQ, Dong LZ, Cheng F, Xue YP, Wang YS, Ding JN, Zheng YG, Shen YC (2011) Gene cloning, expression, and characterization of a nitrilase from Alcaligenes faecalis ZJUTB10. J Agric Food Chem 59:11560–11570 Luo H, Fan L, Chang Y, Ma J, Yu H, Shen Z (2010) Gene cloning, overexpression, and characterization of the nitrilase from
Rhodococcus rhodochrous tg1-A6 in E. Coli. Appl Biochem Biotechnol 160:393–400 Martinkova L, Vejvoda V, Kaplan O, Kubac D, Malandra A, Cantarella M, Bezouska K, Kren V (2009) Fungal nitrilases as biocatalysts: recent developments. Biotechnol Adv 27:661–670 Mueller P, Egorova K, Vorgias CE, Boutou E, Trauthwein H et al (2006) Cloning, overexpression, and characterization of a thermoactive nitrilase from the hyperthermophilic archaeon Pyrococcus abyssi. Prot Exp Purif 47:672–681 Nestl BM, Nebel BA, Hauer B (2011) Recent progress in industrial biocatalysis. Curr Opin Chem Biol 15:187–193 Pace HC, Brenner C (2001) The nitrilase superfamily: classification, structure and function. Genome Biol 2:1–9 Petrickova A, Vesela AB, Kaplan O, Kubac D, Uhnakova B, Malandra A, Felsberg J, Rinagelova A, Weyrauch P, Kren V, Bezouska K, Martinkova L (2012) Purification and characterization of heterologously expressed nitrilases from filamentous fungi. Appl Microbiol Biotechnol 93:1553–1561 Qiu J, Su EZ, Wang HL, Cai WW, Wang W, Wei DZ (2014) Cloning, overexpression, and characterization of a high enantioselective nitrilase from Sphingomonas wittichii RW1 for asymmetric synthesis of (R)-Phenylglycine. Appl Biochem Biotechnol 173:365–377 Schreiner U, Steinkellner G, Rozzell JD, Glieder A, Winkler M (2010) Improved fitness of Arabidopsis thaliana nitrilase 2. Chem Cat Chem 2:263–267 Stalker DM, Malyj LD, McBride KE (1988) Purification and properties of a nitrilase specific for the herbicide bromoxynil and corresponding nucleotide sequence analysis of the bxn gene. J Biol Chem 263: 6310–6314 Thimann KV, Mahadevan S (1964) Nitrilase occurrence, preparation and general properties of the enzyme. Arch Biochem Biophys 105:133–141 Vejvoda V, Kaplan O, Bezouska K, Pompach P, Sulc M et al (2008) Purification and characterization of a nitrilase from Fusarium solani O1. J Mol Catal B Enzym 50:99–106 Wang H, Li G, Li M, Wei D, Wang X (2013) A novel nitrilase from Rhodobacter sphaeroides LHS-305: cloning, heterologous expression and biochemical characterization. World J Microbiol Biotechnol 30:245–252 Yusuf F, Chaubey A, Jamwal U, Parshad R (2013a) A new isolate from Fusarium proliferatum (AUF-2) for efficient nitrilase production. Appl Biochem Biotechnol 171:1022–1031 Yusuf F, Chaubey A, Raina A, Jamwal U, Parshad R (2013b) Enhancing nitrilase production from Fusarium proliferatum using response surface methodology. Springer Plus 2:290 Zhang ZJ, Xu JH, He YC, Ouyang LM, Liu YY (2011) Cloning and biochemical properties of a highly thermostable and enantioselective nitrilase from Alcaligenes sp. ECU0401 and its potential for (R)-(−)-mandelic acid production. Bioprocess Biosyst Eng 34:315–322 Zhu XY, Gong JS, Li H, Lu ZM, Zhou ZM, Shi JS, Xu ZH (2013) Characterization and functional cloning of an aromatic nitrilase from Pseudomonas putida CGMCC3830 with high conversion efficiency toward cyanopyridine. J Mol Cat B: Enzym 97:175–183
ORIGINAL PAPER
Cloning and functional characterization of nitrilase from Fusarium proliferatum AUF-2 for detoxification of nitriles Farnaz Yusuf & Irshad Ahmad Rather & Urmila Jamwal & Sumit G. Gandhi & Asha Chaubey
Received: 9 July 2014 / Revised: 17 December 2014 / Accepted: 25 December 2014 # Springer-Verlag Berlin Heidelberg 2015
Abstract A fungal nitrilase gene from Fusarium proliferatum AUF-2 was cloned through reverse transcription-PCR. The open reading frame consisted of 903 bp and potentially encoded a protein of 301 amino acid residues with a theoretical molecular mass of 33.0 kDa. The encoding gene was expressed in Escherichia coli strain BL21 and the recombinant protein with His6-tag was purified to electrophoretic homogeneity. The purified enzyme exhibited optimal activity in the range of 35–40 °C and pH 8.0. EDTA, Mg2+, Zn2+, Ca2+, Fe2+, Fe3+ and Mn2+ stimulated hydrolytic activity, whereas Cu2+, Co2+ and Ni2+ had inhibitory effect on nitrilase activity. Ag+ ions showed a strong inhibitory effect on the recombinant nitrilase activity. This nitrilase was specific towards aliphatic, heterocyclic and aromatic nitriles. The kinetic parameters Vmax and Km for benzonitrile substrate were determined to be 14.6 μmol/min/mg protein and 1.55 mM, respectively. Homology modelling and molecular docking studies provided an insight into the substrate specificity and the proposed catalytic triad for recombinant nitrilase consisted of Glu-54, Lys-133 and Cys-175. This is the first report on the cloning and heterologous expression of nitrilase from Fusarium proliferatum.
Keywords Fusarium proliferatum . Nitrilase . Cloning . Heterologous expression . Structure modelling F. Yusuf : I. A. Rather : U. Jamwal : S. G. Gandhi (*) : A. Chaubey (*) CSIR-Indian Institute of Integrative Medicine, Canal Road, Jammu 180001, India e-mail: [email protected] e-mail: [email protected] S. G. Ghandi e-mail: [email protected] A. Chaubey e-mail: [email protected]
Abbreviations IPTG Isopropyl β-D-1-thiogalactopyranoside RACE Rapid amplification of cDNA ends RT-PCR Reverse transcriptase-polymerase chain reaction UTR Untranslated region SDS Sodium dodecyl sulphate-polyacrylamide gel PAGE electrophoresis DTT Dithiothreitol EDTA Ethylenediaminetetraacetic acid CTAB Cetyltrimethylammonium bromide ORF Open reading frame PMSF Phenylmethylsulphonyl fluoride Ni-NTA Nickel-nitrilotriacetic acid
Introduction Nitrilases (EC 3.5.5.1) constitute branch 1 of the nitrilase superfamily, which consists of enzymes acting on non-peptide C–N bonds (Brenner 2002). Nitrilases are versatile enzymes in biocatalysis, mediating the hydrolysis of diverse nitriles under mild conditions directly into their corresponding acids without the formation of any toxic side products, thus, having minimal impact on environment. They have played a crucial role in detoxification of nitrile-contaminated wastes (Gong et al. 2012a; Zhu et al. 2013). Nitrilases are notably reported for the production of nicotinic acid, ibuprofen, acrylic acid and hydroxy acids, such as mandelic, 3-hydroxyvaleric and glycolic acid (Zhang et al. 2011; Petrickova et al. 2012). Their activities are often independent of expensive cofactors, hence, making them more suitable for industrial applications (Nestl et al. 2011). Nitrilases have been reported since 1960’s with the first report from plant (Thimann and Mahadevan 1964) and since then, an increasing number of nitrilases from different sources
Funct Integr Genomics
have been discovered. Nitrilases have been found in bacteria (Banerjee et al. 2002), fungi (Martinkova et al. 2009), plants (Schreiner et al. 2010) and animals (Pace and Brenner 2001). According to both activity screens and gene database searches, filamentous fungi appear to be rich sources of nitrilases (Petrickova et al. 2012). However, fungal nitrilases have been less explored than the bacterial ones (Gong et al. 2012a). Since biocatalysts from the native source have limitations with respect to some enzymatic properties in process development, a recombinant enzyme may provide the possibility to meet the synthetic application requirements with high efficiency. It may also lead to a better understanding and improvement in enzyme function for various biotechnological applications. Several nitrilase genes have been cloned from various organisms and introduced into appropriate host strains. The first nitrilase gene cloned and expressed in Escherichia coli was from Klebsiella ozaenae (Stalker et al. 1988). Since then, several researchers reported on cloning of bacterial nitrilases (Qiu et al. 2014; Zhu et al. 2013; Wang et al. 2013; Liu et al. 2011; Luo et al. 2010; Mueller et al. 2006; Kiziak et al. 2005; Bhalla et al. 1995). Recently, nitrilase from Pseudomanas sp. has been cloned and expressed in E. coli. This nitrilase was biochemically characterized (Duca et al. 2014). Heterologous expression of genes that encodes nitrilases from filamentous fungi has been investigated scarcely. So far, nitrilases from Aspergillus niger CBS 513.88, A. niger K10, Gibberella moniliformis, Neurospora crassa OR74A and Penicillium marneffei ATCC 18224 have been cloned and expressed in E. coli (Petrickova et al. 2012). Nitrilase from Gibberella intermedia CA3-1 was heterologously expressed and characterized by Gong et al. (2012b). Kaplan et al. (2013) reported expression of several fungal and bacterial nitrilases identified by genome mining and studied their substrate specificity. Although, there are reports on nitrilase production from Fusarium proliferatum (Yusuf et al. 2013a, 2013b; Jin et al. 2012), to the best of our knowledge, there are no reports on heterologous expression of nitrilase from F. proliferatum. Therefore, studies on F. proliferatum nitrilase gene expression needs to be done in order to advance our understanding for nitrile hydrolysis. In our previous work, a fungus F. proliferatum strain AUF-2 (Yusuf et al. 2013a, 2013b) was shown to be a promising strain for nitrilase production. Present report relates to cloning of its nitrilase gene through reverse transcription-PCR (RT-PCR) and its heterologous expression in E. coli for use in possible industrial applications.
Materials and methods Strains, plasmids, enzymes and chemicals Fusarium proliferatum strain AUF-2, used in this study, was grown and maintained on a modified Czapek-Dox agar
medium as described previously (Yusuf et al. 2013a). E. coli strains DH5 and BL21 (DE3) were used as hosts for cloning and expression experiments, respectively. The plasmid pTZ57R/T InsTA (Fermentas, USA) and pET-28a (Novagen, USA) were used for cloning and expression of the nitrilase in E. coli. Restriction endonuclease, T4 DNA ligase and Taq DNA polymerase were obtained from Fermentas, USA. IPTG and X-gal were obtained from Sigma-Aldrich, USA. Cloning of core fragment The core fragment of nitrilase gene of F. proliferatum was amplified from genomic DNA. The DNA was isolated by CTAB extraction method (Doyle and Doyle 1987). Following set of degenerate oligonucleotide primers were used: forward primer S2F1b and reverse primer S2R2a (Table 1). The amplification was carried out in total volume of 50 μL using Eppendorf Mastercycler® pro. PCR programme used for amplification was as follows: initial denaturation (5 min at 95 °C), followed by 35 cycles of denaturation (95 °C for 30 s), annealing (50 °C for 1 min) and primer extension (72 °C for 50 s), followed by final extension step for 10 min at 72 °C. The fragment of 573 bp was obtained which was cloned into the pTZ57R/T InsTA cloning vector (Fermentas, USA) and was subjected to nucleotide sequencing. This fragment was used for designing gene specific primers for the cloning of 5′ and 3′ ends of the nitrilase by performing RACE-PCR. RNA isolation and cDNA synthesis The culture was grown in Czapek-Dox medium at 28 °C, 200 rpm for 72 h, thereafter harvested by centrifugation at
Table 1 The relevant primer sequences used in cloning and expression of nitrilase from Fusarium proliferatum (AUF-2) Primer name
Primer sequence (5′→3′)
S2F1b S2R2a FZ1R FZ1F 3′ RACE outer primer
TTACCHGARTGYTTYAAY RTG DCC RTA NGC RTG RTA GTAGTACTTCTTCGTATTCGGGCTG TGAACTAGCCACCATTGCAGCTCG GCGAGCACAGAATTAATACGACT
3′ RACE inner primer CGCGGATCCGAATTAATACGACTCACTA TAGG FNT GTA GTA CTT CTT CGT ATT CGG GCT G 5′ RACE outer primer GCTGATGGCGATGAATGAACACTG 5′ RACE inner primer CGCGGATCCGAACACTGCGTTTGCTG GCTTTGATG Pnitf tttCCATGGTTATGCGAACTGTCCTTGGC CGAC Pnitr tttAAGCTTGTGGCCGTATGCGTGGTAGCC
Funct Integr Genomics
15,000×g for 15 min at 4 °C. Total RNA was extracted from the fungal mycelia using TRIzol reagent (Invitrogen), and the quality and quantity of RNA was checked on 2 % agarose gel electrophoresis and by spectrophotometry analysis (Thermo Scientific NanoDrop 2000c, USA), respectively. DNA was removed from the RNA sample using the Ambion® DNAfree™ kit according to the manufacturer’s instructions. Complementary DNA (cDNA) synthesis was carried out using M-MLV reverse transcriptase (Promega) with an oligo(dT) primer following the manufacturer’s instructions.
Cloning of 3′ RACE and 5′ RACE First-strand cDNA synthesis for 3′ and 5′ RACE was carried out using First Choice® RLM-RACE Kit (Ambion, USA) following the manufacturer’s instructions. All the relevant primer sequences used in cloning and expression of nitrilase from F. proliferatum AUF-2 are shown in Table 1. The 3′ RACE-PCR reaction was carried out using FZ1R and 3′ RACE outer primer. Nested PCR was performed using FZ1F along with 3′ RACE inner primer by using primary PCR product as template. Both the primary and nested PCR reactions were carried under the following thermal profile conditions: initial denaturation (5 min at 95 °C), followed by 35 cycles of denaturation (95 °C for 20 s), annealing (60 °C for 30 s) and primer extension (72 °C for 30 s), followed by final extension step for 5 min at 72 °C. Similar procedure was followed to carry out 5′ RACE-PCR in which FNT and 5′ RACE outer and FNT and 5′ RACE inner primers were used for the initial and nested PCR reactions, respectively. Thermal profile for both initial and nested PCR was as follows: initial denaturation (3 min at 95 °C), followed by 35 cycles of denaturation (95 °C for 20 s), annealing (56 °C for 30 s) and primer extension (72 °C for 35 s), followed by final extension step for 5 min at 72 °C. Amplified DNA fragments of both 3′ and 5′ RACE were cloned in pTZ57R/T InsTA cloning vector (InsTA Clone PCR Cloning Kit; Fermentas, USA) and transformed into DH5α competent cells. Positive clones based on blue white screening were selected and sequenced using ABI 3130xl Genetic Analyzer (Applied Biosystems, USA). Sequences of core fragment, 5′ and 3′ RACE products were assembled, and full length cDNA sequence of nitrilase gene was obtained (Fig. 1). Basic Local Alignment Search Tool (BLAST, www.ncbi.nlm.nih.gov/blast) was employed for the GenBank search and identity assessment. Nucleotide sequence of nitrilase obtained was conceptually translated using ExPASy tool (http://web.expasy.org/cgibin/translate/dna). The sequence of nitrilase gene from F. proliferatum AUF-2 has been submitted to NCBI GenBank (accession no. KF003025).
Fig. 1 Cloning of the fungal nitrilase gene from Fusarium proliferatum AUF-2: amplification of the DNA sequence encoding nitrilase gene (lane 1: marker, lane 2: PCR product amplified using degenerate forward primer S2F1b and reverse primer S2R2a)
Construction of expression plasmid for nitrilase gene For cloning the full-length coding sequence of nitrilase gene of F. proliferatum AUF-2, a pair of primers was designed as follows: Pnitf and Pnitr, incorporating HindШ and NcoI sites, respectively. Full-length ORF was amplified from oligo(dT)primed cDNA using proof-reading DNA polymerase-Deep VentR™ (New England Biolabs). PCR was performed with cDNA with following programme: initial denaturation (5 min at 95 °C), followed by 35 cycles of denaturation (95 °C for 20 s), annealing (58 °C for 30 s) and primer extension (72 °C for 1 min), followed by final extension step for 5 min at 72 °C. The PCR product was double digested with HindШ and NcoI. The resulting 903 bp fragment containing the intact nitrilase genes was ligated using T4 DNA ligase into the pET28a vector which had been linearized with the enzymes of HindШ and NcoI. pET28a plasmid containing in frame insertion of nitrilase gene was transformed into chemically competent E. coli DH5α cells. Clones were confirmed for sequence, orientation and coding frame using restriction analysis, PCR and sequencing.
Heterologous expression and purification of His6-tagged nitrilase The recombinant plasmid carrying the nitrilase genes was transformed into E. coli BL21 (DE3) cells. The resulting recombinant cells, BL21(DE3)/pET-Nit, were grown at 37 °C in 50 mL of LB media containing 50 μL of kanamycin (50 mg/mL). Production of recombinant enzyme was induced by addition of 1 mM IPTG when optical density (at 600 nm) of the culture broth reached between 0.6 and 0.8. The cells were incubated at 20 °C for 20 h after induction and were harvested by centrifugation at 5000×g for 10 min at 4 °C. The cells were washed with PBS buffer. The cells were then resuspended in lysis buffer (50 mM NaH2PO4, 300 mM NaCl, 1 mM DTT, 10 mM imidazole, 1 mM PMSF pH 8.0) and disrupted at 4 °C by
Funct Integr Genomics
ultrasonication using the ultrasonic cell disruptor (Sartorius stedim LABSONIC M) which was operated at 100 W for 15 min. The cell debris was removed by centrifugation (14, 000×g, 30 min, 4 °C). Since the recombinant nitrilase carried a C-terminal affinity tag of six consecutive histidine residues, it was purified using the QIAexpress Ni-NTA protein purification system (Qiagen). The cell-free extracts were applied onto a NiNTA superflow column (10 mL), which was previously equilibrated with equilibration buffer (50 mM NaH2PO4, 300 mM NaCl, 1 mM DTT, 10 mM imidazole pH 8.0). The unbound protein was washed out from the column by wash buffer (50 mM NaH2PO4, 300 mM NaCl, 1 mM DTT, 20 mM imidazole pH 8.0). The elution was carried using the elution buffer (50 mM NaH2PO4, 300 mM NaCl, 1 mM DTT, 250 mM imidazole pH 8.0). Protein concentration was determined by the Coomassie brilliant blue G-250 dye-binding method (Bradford 1976) using bovine serum albumin as standard protein.
Fig. 2 Amino acid sequence alignment of nitrilases from different origin. The nitrilase from F. oxysporum (EWZ37052), F. verticilliodes (EWG40656), F. proliferatum AUF-2 (KF003025), putative nitrilase from M. anisopliae (EFY98466), N. crassa (EAA31670), putative nitrilase from E. lata (EMR71034) and A. fumigatus (XP751200)
different substrate concentrations (0.5–50 mM). Michaelis– Menten constant was calculated from Lineweaver–Burk plot.
Substrate spectrum of recombinant nitrilase The substrate spectrum was assayed using 20 mM of various nitriles as the substrate (Table 2). The conversion was assayed by determining ammonia generated in the reaction mixture as aforementioned. A control experiment without enzyme was performed for each substrate.
SDS-PAGE analysis Cell-free extracts and elution fractions were analysed by 12 % SDS-PAGE using a Mini-gel system (Bio-Rad). The gels were cast with 0.75-mm spacers (Bio-Rad). SDS-PAGE was performed according to Laemmli (1970). Standard molecular weight markers in the range of 14.4–116 kDa were procured from Fermentas, USA.
Effect of pH and temperature The influence of pH on the nitrilase activity was measured under the standard assay conditions using 100 mM buffers in the range of pH 4.0–5.0 (citrate), pH 6.0–8.0 (phosphate), pH 9.0–10.0 (Glycine-NaOH). The temperature dependence
Nitrilase assay Nitrilase activity was measured using benzonitrile as substrate in a total reaction volume of 250 μL and incubated at 37 °C for 30 min. The standard reaction consisted of 50–60 μg of enzyme in 100 mM phosphate buffer (pH 8.0) and 20 mM of substrate. The enzyme activity was determined by measuring the ammonia generation by the phenol–hypochlorite method in the reaction mixture as reported earlier (Yusuf et al. 2013a). Alternatively, rapid semiquantitative detection of nitrilase activity of purified enzyme was measured by monitoring the absorption of benzoic acid at 238 nm on Labindia UV-3000 (ε=3.3 L/mmol/cm) as described by Vejvoda et al. (2008). The standard assay consisted of 50–60 μg of the protein in a total reaction volume of 600 μL using 0.5 mM benzonitrile in 100 mM phosphate buffer (pH 8.0). A reaction mixture without enzyme was used as the blank. All assays were performed in triplicate, and the results shown are average values of these experiments with standard errors. Kinetic parameters of the recombinant nitrilase To study the kinetic parameters of the purified nitrilase towards benzonitrile, the activity assays were performed with
Table 2 Substrate spectrum of recombinant nitrilase from Fusarium proliferatum AUF-2 Substrate
Relative activity %
Benzonitrile Acetonitrile Propionitrile Butyronitrile Acrylonitrile Fumaronitrile Succinonitrile Mandelonitrile Di-phenylacetonitrile Glutaronitrile 3-Nitrobenzonitrile 4-Nitrobenzonitrile 2-Cyanopyridine 3-Cyanopyridine 4-Cyanopyridine 3-phenylpropionitrile
100a 135 416 425 400 ND ND 69 72 319 110 151 110 151 225 151
3-Aminobutyronitrile 4-Aminobutyronitrile
201 251
ND means not detected a
Specific activity 5.3 U/mg protein
Funct Integr Genomics
Funct Integr Genomics
of the recombinant nitrilase was estimated under the standard conditions (pH 8.0) in the range of 20–60 °C. Effect of metal ions and co-solvents The effect of various metal ions (Ca 2+ , Cu2+, Fe2+ , Fe3+, Mn2+, Zn2+, Ca2+, Mg2+, Ba2+, Li+, Co2+, Ag+ and EDTA) on the enzyme activity was tested at a final concentration of 1 mM. The influence of the solvents ethanol, methanol, hexane, toluene, dichloromethane and propanol was tested at 5 % (v/v). Sequence analysis The nucleotide sequences of the partial gene fragment and 3′ and 5′ RACE-PCR products were assembled using the assembly tool in CLC Genomics Workbench (http:// www.clcbio.com/products/clc-genomics-workbench/). ORF Finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html) was used to predict the possible ORFs in the full length nitrilase from F. proliferatum AUF-2 nucleotide sequence. The nucleotide sequence of nitrilase was
Fig. 3 Nucleotide and the deduced amino acid sequence of nitrilase. 5′ and 3′ UTR are shown in blue and red box, respectively
conceptually translated using ExPASy Translate Tool (http://web.expasy.org/cgi-bin/translate/dna). Multiple sequence alignment was carried out with related protein sequences from different origins (Fig. 2) to assess the degree of homology, using the ClustalW2 tool (http:// www.clustal.org/clustal2/). The theoretical isoelectric point and molecular weight of the protein was calculated using ComputePI tool on ExPASy website (http://web.expasy.org/compute_pi/). SOPMA (http:// npsa-pbil.ibcp.fr/cgi-bin/secpred_sopma.pl) was used for prediction of protein secondary structure. 3D structure modelling of the protein was done using the automated mode of SWISS-MODEL tool on the ExPASy website (http://swissmodel.expasy.org/workspace/). Default parameters were used for all the above softwares (unless specified otherwise).
Homology modelling and docking studies The 3D structure of nitrilase was built using online SWISSMODEL software (http://swissmodel.expasy.org/). Template was selected by modeller based on its features and alignment
Funct Integr Genomics
with the target. The template used by modeller for building model was the crystal structure of nitrilase protein NIT3 from Sacharomyces cerevisiae (PDB ID: 1F89) with a 2.40 Å resolution.
Results Cloning and sequence analysis of the fungal nitrilase gene The nitrilase sequences available in NCBI GenBank were used to design degenerate primers, based on the conserved domain deduced from the reported amino acid and nucleotide sequences encoding nitrilase from fungal source. The core amplicon of 573 bp was obtained. Sequence of the core amplicon was used for designing 5′ and 3′ RACE primers. RACE-PCR was carried out to obtain the 5′ and 3′ ends of the cDNA, giving an amplicon size of approximately 504 and 488 bp, respectively. The full-length clone (Fig. 1) of 903 bp was sequenced and submitted to NCBI GenBank (accession no. KF003025). The sequence analysis demonstrated that the target fragment contained an open reading frame of 903 nucleotides, starting with an ATG codon at position 166 and ending with TAA codon at position 903. The 5′ and 3′ UTR are 165 and 122 bp including polyA tail, respectively.
Heterologous expression of the F. proliferatum nitrilase and its purification To express the gene encoding nitrilase, primers Pnitf and Pnitr were designed according to the sequencing result of pTZ57R/T-NIT, with NcoI and HindIII sites, respectively. PCR amplification was conducted by adopting the recombined plasmid pTZ57R/T-NIT obtained above as the template, and the DNA fragment encoding the nitrilase gene was subcloned into an expression vector pET28a(+) to construct the recombinant plasmid pET28a(+)NIT. Subsequently, the recombinant plasmids were then transformed into chemically competent cells of E. coli BL21 (DE3). The positive transformant containing recombinant pET28a(+)-NIT was identified by colony PCR and double enzymatic digestion. The recombinant cell harbouring pET28a (+)-NIT was induced by 1 mM of IPTG at 20 °C for about 20 h when the OD600 reached the value of 0.6 to 0.8. Protein bands from SDS-PAGE were visualized by staining with
Analysis of the deduced amino acid sequence The nitrilase encoded a protein of 301-amino-acid with a theoretical molecular mass of 33 kDa which is in close agreement with the apparent molecular weight of 37 kDa. It was having the theoretical isoelectric point of 5.83. The protein consists of 24.3 % alpha helix, 26.3 % extended strand, random coils 42 % and beta turns 7.3 %. The sequence alignment results (Fig. 2) indicated that the fungal nitrilase from F. proliferatum AUF-2 showed 98 % identity with the nitrilase from Fusarium oxysporum (EWZ 37052) and Fusarium v e r t i c i l l i o d e s ( E W G 4 0 6 5 6 ) . T h e i d e n t i t i e s of F. proliferatum AUF-2 nitrilase gene to the other nitrilases from, Eutypa lata (EMR 71034), Metarhizium anisopliae (EFY 98466), Neurospora crassa (EAA 31670), Aspergillus fumigatus (XP751200) were 72, 76, 70 and 69 %, respectively. Nucleotide and the deduced amino acid sequence of nitrilase from F. proliferatum AUF-2 are shown in Fig. 3.
Fig. 4 SDS-PAGE of the recombinant nitrilase from Fusarium proliferatum (AUF-2) stained with Coomassie brilliant blue R-250
Funct Integr Genomics
Coomassie brilliant blue. The molecular mass of the recombinant nitrilase was approximately 37 kDa (Fig. 4). These data are in agreement with those derived from DNA sequencing.
Effects of the environmental factors on the nitrilase activity The highest nitrilase activity was found in the temperature range of 35 to 40 °C. The nitrilase activity gradually increased from 20 to 40 °C and decreased drastically above 45 °C (Fig. 5a). The nitrilase showed an optimum activity at pH 8.0. As shown in Fig. 5b, this enzyme exhibited a broad pH range, from pH 6.0 to10.0. The nitrilase activity in presence of various metal ions was determined (Fig. 5c). The enzyme activity
Fig. 6 3D model of recombinant nitrilase from Fusarium proliferatum (AUF-2)
Fig. 5 Effects of environmental factors on the activity of nitrilase for benzonitrile (specific activity of the enzyme showing 100 % activity was 5.3 U/mg protein). a Effect of temperature on nitrilase activity. The relative activity was expressed at the percentage of the activity at 37 °C. b Effect of pH on nitrilase activity. The relative activity was expressed at the
percentage of the activity at pH 8.0. c Effect of metal ions on nitrilase activity. The relative activity was expressed at the percentage of the activity without addition of metal ions. d Effect of organic solvents on nitrilase activity. The relative activity was expressed at the percentage of the activity without addition of organic solvents
Funct Integr Genomics
was strongly inhibited by Ag+ . The metal ions like Ni2+, Co2+ and Cu2+ caused a decrease in enzymatic activity, while as Zn2+, Ca2+, Mg2+, Mn2+, Fe2+, Fe3+ and EDTA improved the nitrilase activity. The effect of co-solvents 5 % (v/v) on nitrilase activity was studied (Fig. 5d). It was observed that the enzyme was relatively active in methanol followed by ethanol. The activity decreased drastically in other solvents like propanol, hexane, toluene and dichloromethane. Substrate spectrum of the recombinant nitrilase The recombinant nitrilase from F. proliferatum AUF-2 was able to hydrolyze a wide range of nitriles (Table 2). This nitrilase is highly specific towards aliphatic, aromatic and heterocyclic nitriles. However, no activity was detected for dinitriles. Kinetic parameters of the recombinant nitrilase The kinetic parameters of the recombinant nitrilase were determined with benzonitrile as the substrate. It was calculated that Vmax and Km were 14.6 μmol/min/mg protein and 1.55 mM, respectively using benzonitrile as substrate.
region, 11.8 % residues in the additional allowed region, 2.5 % in the generously allowed region and 0.8 % in the disallowed region (Fig. 7). The results of the PROCHECK analysis indicate that a relatively low percentage of residues have phi/psi angles in the disallowed regions suggesting the acceptability of Ramachandran plots for nitrilase protein. The nitrilase protein was prepared for docking calculations using the Protein Preparation Workflow (Schroidinger Suite 2012, Protein Preparation Wizard). Hydrogen atoms were added to the protein model. The added hydrogen atoms were minimized to have a stable energy conformation and also to relax the conformation from close contacts. The conserved catalytic residues Glu-54, Lys-133 and Cys-175 from nitrilase protein were proposed to be the catalytic triad of nitrilase. The resulting model was used for docking studies by generating a cubic grid of 20 Å around the defined catalytic triad pocket (CEK). Ligand docking was carried out using Glide XP precision mode. The molecular docking studies of the F. proliferatum AUF2 nitrilase show substrate interactions in the active site. Figure 8 demonstrates the results of molecular docking of various nitrile substrates with the catalytic triad of nitrilase. Bond lengths between the –N of nitrile substrate and –H associated with sulphur of Cys 175; –H
Homology modelling, identification of binding site and molecular docking 3D homology model of nitrilases was generated using online SWISS-MODEL software (http://swissmodel.expasy.org/) as shown in Fig. 6. The template used by modeller for building model was the crystal structure of nitrilase protein NIT3 from S. cerevisiae (PDB ID: 1F89) with a 2.40 Å resolution. We selected this protein, as it belongs to the branch 10 of nitrilase superfamily and also, the nitrilase domain structures are present in the protein (Pace and Brenner 2001; Kumaran et al. 2003). F. proliferatum AUF-2 nitrilase gene has a primary sequence identity of 51.76 % and sequence coverage of 93 % with NIT3 gene from S. cerevisiae. The model was built in the absence of ligands and has a QMEAN Z-score of −2.644. Protein refinements were performed using Protein Preparation Wizard in Maestro v9.3 (Schrodinger, LLC, USA) (http://www.schrodinger.com/). The stereo chemical analysis of the modelled proteins was carried out using Ramachandran plot obtained from Procheck module of the SAVES server (http://services. mbi.ucla.edu/SAVES/). The stereo-chemical qualities of the predicted models of nitrilase were validated by PROCHECK server. Ramachandran plot analysis of nitrilase showed 84.9 % residues in the most favourable
Fig. 7 Ramachandran plot of recombinant nitrilase from Fusarium proliferatum (AUF-2). The plot calculations on the 3D models of F. proliferatum nitrilase was computed with the PROCHECK server. The most favoured regions are coloured red (A, B, L) and additional allowed (a, b, l, p), generously allowed (−a, −b, −l, −p) and disallowed regions are indicated as yellow, light yellow and white regions, respectively
Funct Integr Genomics
Fig. 8 Molecular docking of nitrilase from Fusarium proliferatum (AUF-2): diagram showing a acetonitrile, b acrylonitrile, c butyronitrile, d benzonitrile, e diphenyl acetonitrile, f fumaronitrile, g 2-cyanopyridine, h 3-cyanopyridine, i 4-cyanopyridine
of Lys 133 and –O of Glu 54 are shown with each substrate. In the docking studies (Table 3), it was revealed that the nitrilase was more specific towards higher aliphatic nitriles, followed by heterocyclic and aromatic nitriles, respectively. These results further confirmed the results of wet lab experiments as shown in Table 2.
Discussion Nitrilase enzymes are part of a large superfamily, classified into 13 branches, of which only branch 1 (EC 3.5.5.1) converts nitriles directly to their corresponding carboxylic acids without formation of any amide (Duca
et al. 2014). Due to the increasing demand of nitrilases in industrial applications, discovery of novel nitrilases h a s r e c e i v e d c o n s i d e r a b l e a t t e n t i o n . R e c e n t l y, F. proliferatum has been reported as a potential nitrilase producer (Jin et al. 2012; Yusuf et al. 2013a, 2013b). In our previous studies, we reported nitrilase from F. proliferatum AUF-2 with overall nitrilase production of 26-58 U/g wet cell biomass for benzonitrile (Yusuf et al. 2013a, 2013b). In order to over-express this nitrilase, we cloned nitrilase gene from F. proliferatum AUF-2 into E. coli host, resulting in 24 U/g wet cell biomass of nitrilase activity for benzonitrile substrate. The sequence analysis demonstrated that the target fragment contained an open reading frame of 903 bp, encoding a protein of 301 amino acid residues. A theoretical molecular mass of 33.0 kDa has been observed
Funct Integr Genomics Table 3 Substrates docking studies of recombinant nitrilase from Fusarium proliferatum AUF-2 Substrate
Docked energy (kcal/mol)
MMGBSAdG bind
S-Naproxen Nitrile R-Naproxen Nitrile R-Mandelonitrile S-Mandelonitrile (S)-2-phenylbutyronitrile (R)-2-phenylbutyronitrile 2-Cyanopyridine 3-Cyanopyridine 4-Cyanopyridine
−5.295 −5.235 −4.668 −4.406 −4.490 −4.528 −3.265 −3.458 −3.105
−44.203 −39.049 −27.797 −34.615 −38.726 −37.001 −24.351 −26.734 −22.248
Diphenylacetonitrile 3-Nitrobenzonitrile 4-Nitrobenzonitrile Benzonitrile Acetonitrile Acrylonitrile Propionitrile Butyronitrile
−4.282 −3.439 −3.664 −3.595 −1.629 −0.946 −1.008 −2.334
−37.926 −29.540 −29.433 −18.587 −9.340 −11.830 −15.582 −23.620
Fumaronitrile 3-Aminobutyronitrile 4-Aminobutyronitrile 3-Phenylpropionitrile
−1.529 −3.317 −2.671 −3.452
−16.064 −26.235 −26.343 −35.587
for the recombinant nitrilase from F. proliferatum AUF2. Other fungal nitrilases expressed in E. coli have been reported to have a molecular mass in the same range, e.g. 35–45 kDa (Petrickova et al. 2012; Gong et al. 2012b). The recombinant nitrilase reported herein has demonstrated wide substrate specificity, acting on aliphatic, heterocyclic and aromatic nitriles. Based on resting cells activity for benzonitrile substrate, nitrilase production in the recombinant F. proliferatum AUF-2 was found to be 144 U/L culture. It was also observed that the nitrilase from F. proliferatum AUF-2 has a higher affinity towards aliphatic substrates as shown in Table 2. It was also observed that the nitrilase activity increased with the increase in carbon chain of nitrile substrates. This is in agreement with the substrate affinity of the wild-type nitrilase from F. proliferatum AUF-2 and other previously reported nitrilases from Alcaligenes faecalis ZJUTB10 (Liu et al. 2011) and G. intermedia (Gong et al. 2012b). The preference for hydrolysis of heterocyclic nitriles was in the order of para > meta > ortho, as also reported for G. intermedia (Gong et al. 2012b). These results were further confirmed by the molecular docking studies as shown in Table 3.
Characterization studies showed that this nitrilase has the highest activity in the range of 35–40 °C and alkaline pH favoured its activity. The nitrilase activity decreased sharply above 40 °C, which is similar to P. putida CGMCC3830 (Zhu et al. 2013). The enzyme has broad pH range (pH 6.0–9.0) as found in F. oxysporum f sp. melonis (Goldlust and Bohak 1989) and G. intermedia (Gong et al. 2012b). It was also observed that the nitrilase activity was enhanced in the presence of metal ions like Zn2+, Ca2+, Mg2+, Mn2+, Fe2+, Fe3+ and EDTA as found in G. intermedia and A. faecalis ZJUTB10 (Gong et al. 2012b; Liu et al. 2011). Enzyme activity was strongly suppressed by thiol-binding metal ions such as Ag+, as previously observed in the case of G. intermedia (Gong et al. 2012b), P. putida CGMCC3830 (Zhu et al. 2013), Pyrococcus abyssi (Mueller et al. 2006), Fusarium solani O1 (Vejvoda et al. 2008) and A. niger K10 (Kaplan et al. 2006). The recombinant nitrilase was active in 5 % (v/v) methanol while as the nitrilase activity was greatly decreased when propanol and toluene were used as co-solvents as was found in G. intermedia (Gong et al. 2012b). The encoding protein sequence of nitrilase from F. proliferatum AUF-2 showed 98 % identity with the n i t r i l a s e f r o m F. o x y s p o r u m ( E W Z 3 7 0 5 2 ) a n d F. verticilliodes (EWG 40656), 76 % with M. anisopliae (EFY 98466), 72 % with E. lata (EMR 71034), 70 % with N. crassa (EAA 31670) and 69 % with A. fumigatus (XP751200) (Fig. 2). In reference to the biochemically characterized nitrilases, A. faecalis ZJUTB10 nitrilase showed 33 % identity, whereas, nitrilase from A. niger K10 showed 22 % identity with the recombinant nitrilase from F. proliferatum AUF-2. Nitrilases are believed to have catalytic triad consisting of glutamate, cysteine and lysine residues at their catalytic site (Brenner 2002). Our molecular docking studies suggested that the catalytic triad in nitrilase from F. proliferatum AUF-2 consists of Glu-54, Lys-133 and Cys-175 residues. Docking studies by Liu et al. (2011) suggested a catalytic triad comprising of Glu-47, Lys129 and Cys-163 in nitrilase from A. faecalis ZJUTB10. Molecular docking studies with wide substrate spectrum (Table 3) and supporting wet lab experiments (Table 2) reveal that the recombinant nitrilase can hydrolyse a wide range of nitrile substrates and can be useful for detoxification of nitriles from the contaminants and industrial wastes. Acknowledgments The financial support received from the 12th FYP Project—Plant-Microbe and Soil Interactions (PMSI; BSC0117), for this work is gratefully acknowledged.
Funct Integr Genomics
References Banerjee A, Sharma R, Banerjee UC (2002) The nitrile-degrading enzymes: current status and future prospects. Appl Microbiol Biotechnol 60:33–44 Bhalla TC, Aoshima M, Misawa S, Muramatsu R, Furuhashi K (1995) The molecular cloning and sequencing of the nitrilase gene of Rhodococcus rhodochrous PA-34. Acta Biotechnol 3:297–306 Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248–254 Brenner C (2002) Catalysis in the nitrilase superfamily. Curr Opin Struct Biol 12:775–782 Doyle JJ, Doyle JL (1987) A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem Bull 19:11–15 Duca D, Rose DR, Glick BR (2014) Characterization of a nitrilase and a nitrile hydratase from Pseudomonas sp. UW4 that converts indole3-acetonitrile to produce indole-3-acetic acid. Appl Environ Microbiol 80:4640–4649 Goldlust A, Bohak Z (1989) Induction, purification, and characterization of the nitrilase of Fusarium oxysporum f sp. melonis. Biotechnol Appl Biochem 11:581–601 Gong JS, Lu ZM, Li H, Shi JS, Zhou ZM, Xu ZH (2012a) Nitrilases in nitrile biocatalysis: recent progress and forthcoming research. Microb Cell Factories 11:142 Gong JS, Li H, Zhu XY, Lu ZM, Wu Y, Shi JS, Xu ZH (2012b) Fungal His-tagged nitrilase from Gibberella intermedia: gene cloning, heterologous expression and biochemical properties. PLoS ONE 7(11): e50622. doi:10.1371/journal.pone.0050622 Jin LQ, Liu ZQ, Xu JM, Zheng YG (2012) Biosynthesis of nicotinic acid from 3-cyanopyridine by a newly isolated Fusarium proliferatum ZJB-09150. World J Microbiol Biotechnol 3:431–440 Kaplan O, Vejvoda V, Plihal O, Pompach P, Kavan D et al (2006) Purification and characterization of a nitrilase from Aspergillus niger K10. Appl Microbiol Biotechnol 73:567–575 Kaplan O, Vesela AB, Petrickova A, Pasquarelli F, Picmanova M, Rinagelova A, Bhalla TC, Patek M, Martinkova L (2013) A comparative study of nitrilases identified by genome mining. Mol Biotechnol 54:996–1003 Kiziak C, Conradt D, Stolz A, Mattes R, Klein J (2005) Nitrilase from Pseudomonas fluorescens EBC191: cloning and heterologous expression of the gene and biochemical characterization of the recombinant enzyme. Microbiology 151:3639–3648 Kumaran D, Eswaramoorthy S, Gerchman SE, Kycia H, Studier FW, Swaminathan S (2003) Crystal structure of a putative CN hydrolase from yeast. Proteins 52:283–291 Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680–685 Liu ZQ, Dong LZ, Cheng F, Xue YP, Wang YS, Ding JN, Zheng YG, Shen YC (2011) Gene cloning, expression, and characterization of a nitrilase from Alcaligenes faecalis ZJUTB10. J Agric Food Chem 59:11560–11570 Luo H, Fan L, Chang Y, Ma J, Yu H, Shen Z (2010) Gene cloning, overexpression, and characterization of the nitrilase from
Rhodococcus rhodochrous tg1-A6 in E. Coli. Appl Biochem Biotechnol 160:393–400 Martinkova L, Vejvoda V, Kaplan O, Kubac D, Malandra A, Cantarella M, Bezouska K, Kren V (2009) Fungal nitrilases as biocatalysts: recent developments. Biotechnol Adv 27:661–670 Mueller P, Egorova K, Vorgias CE, Boutou E, Trauthwein H et al (2006) Cloning, overexpression, and characterization of a thermoactive nitrilase from the hyperthermophilic archaeon Pyrococcus abyssi. Prot Exp Purif 47:672–681 Nestl BM, Nebel BA, Hauer B (2011) Recent progress in industrial biocatalysis. Curr Opin Chem Biol 15:187–193 Pace HC, Brenner C (2001) The nitrilase superfamily: classification, structure and function. Genome Biol 2:1–9 Petrickova A, Vesela AB, Kaplan O, Kubac D, Uhnakova B, Malandra A, Felsberg J, Rinagelova A, Weyrauch P, Kren V, Bezouska K, Martinkova L (2012) Purification and characterization of heterologously expressed nitrilases from filamentous fungi. Appl Microbiol Biotechnol 93:1553–1561 Qiu J, Su EZ, Wang HL, Cai WW, Wang W, Wei DZ (2014) Cloning, overexpression, and characterization of a high enantioselective nitrilase from Sphingomonas wittichii RW1 for asymmetric synthesis of (R)-Phenylglycine. Appl Biochem Biotechnol 173:365–377 Schreiner U, Steinkellner G, Rozzell JD, Glieder A, Winkler M (2010) Improved fitness of Arabidopsis thaliana nitrilase 2. Chem Cat Chem 2:263–267 Stalker DM, Malyj LD, McBride KE (1988) Purification and properties of a nitrilase specific for the herbicide bromoxynil and corresponding nucleotide sequence analysis of the bxn gene. J Biol Chem 263: 6310–6314 Thimann KV, Mahadevan S (1964) Nitrilase occurrence, preparation and general properties of the enzyme. Arch Biochem Biophys 105:133–141 Vejvoda V, Kaplan O, Bezouska K, Pompach P, Sulc M et al (2008) Purification and characterization of a nitrilase from Fusarium solani O1. J Mol Catal B Enzym 50:99–106 Wang H, Li G, Li M, Wei D, Wang X (2013) A novel nitrilase from Rhodobacter sphaeroides LHS-305: cloning, heterologous expression and biochemical characterization. World J Microbiol Biotechnol 30:245–252 Yusuf F, Chaubey A, Jamwal U, Parshad R (2013a) A new isolate from Fusarium proliferatum (AUF-2) for efficient nitrilase production. Appl Biochem Biotechnol 171:1022–1031 Yusuf F, Chaubey A, Raina A, Jamwal U, Parshad R (2013b) Enhancing nitrilase production from Fusarium proliferatum using response surface methodology. Springer Plus 2:290 Zhang ZJ, Xu JH, He YC, Ouyang LM, Liu YY (2011) Cloning and biochemical properties of a highly thermostable and enantioselective nitrilase from Alcaligenes sp. ECU0401 and its potential for (R)-(−)-mandelic acid production. Bioprocess Biosyst Eng 34:315–322 Zhu XY, Gong JS, Li H, Lu ZM, Zhou ZM, Shi JS, Xu ZH (2013) Characterization and functional cloning of an aromatic nitrilase from Pseudomonas putida CGMCC3830 with high conversion efficiency toward cyanopyridine. J Mol Cat B: Enzym 97:175–183
