Mol Biol Rep (2014) 41:6795–6802 DOI 10.1007/s11033-014-3565-z

Cloning and expression of two 9-cis-epoxycarotenoid dioxygenase genes during fruit development and under stress conditions from Malus Hui Xia • Shan Wu • Fengwang Ma

Received: 28 January 2013 / Accepted: 25 June 2014 / Published online: 22 July 2014 Ó Springer Science+Business Media Dordrecht 2014

Abstract There is now biochemical and genetic evidence that oxidative cleavage of cis-epoxycarotenoids by 9-cisepoxycarotenoid dioxygenase (NCED) is the critical step in the regulation of abscisic acid (ABA) synthesis in higher plants. To understand the expression characteristics of NCED during ABA biosynthesis in apple (Malus), two NCED genes cDNA sequence were cloned from Malus prunifolia using RT-PCR techniques, named MpNCED1 and MpNCED2. The two cDNA sequences have full-length open reading frame, encoding a polypeptide of 607 and 614 amino acids, respectively. Sequences analysis showed that the deduced two apple NCED proteins were highly homologous to other NCED proteins from different plant species. Real-time PCR analysis revealed MpNCED2 were expressed continuously during the whole period of apple fruit development with the pattern of ‘‘higher-low-highest’’, while the expression of MpNCED1 clearly declined to a steady low level in the mid-later period of fruit development. Expression of the MpNCED2 increased under the drought stress, high temperature and low temperature strongly and rapidly, whereas expression of the MpNCED1 was detected in response to temperature stress, but did not detected under drought stress. These results revealed that

Hui Xia and Shan Wu have contributed equally to this work. H. Xia Institute of Pomology and Olericulture, Sichuan Agricultural University, Chengdu 611130, Sichuan, People’s Republic of China H. Xia  S. Wu  F. Ma (&) State Key Laboratory of Crop Stress Biology for Arid Areas, College of Horticulture, Northwest A&F University, Yangling 712100, Shaanxi, People’s Republic of China e-mail: [email protected]; [email protected]

MpNCED1 and MpNCED2 may play different roles in regulation of the ABA biosynthesis in fruit development and various stresses response. Keywords Malus  9-cis-epoxycarotenoid dioxygenase  Abscisic acid  Gene expression

Introduction Abscisic acid (ABA) is an important hormone and one of the foremost important signaling molecules in plants, which plays versatile many-sided in regulating many developmental processes and adaptive stress processes [1– 3]. In higher plants, biosynthesis of ABA starts from the epoxidation of zeaxanthin and antheraxanthin to violaxanthin, which occurs in chloroplasts and other plastids and is catalyzed by a zeaxanthin epoxidase (ZEP) [4]. The subsequent conversion to 9-cis-epoxycarotenoid, the cisisomers of violaxanthin and neoxanthin, is catalyzed by the enzyme ABA4 [5]. Both cis-violaxanthin and cis-neoxanthin are alternative substrate of 9-cis-epoxycarotenoid dioxygenase (NCED) and oxidative cleavage of them leads to the production of xanthoxin, the first cytoplasmic precursor for the catalytic conversion to ABA [6–9]. A lot of biochemical and genetic evidence has indicated that NCED is the foremost one which catalyzes the regulating step of this pathway [10, 11]. The first NCED gene (VP14) was cloned in maize by insertional mutagenesis [12]. Since then, a number of NCED genes, which were probably involved in ABA biosynthesis have been reported, such as in Arabidopsis [13, 14], tomato [15], avocado [10], orange [16], persimmon [17], cherry [18] and grape [19].

123

6796

This regulation of ABA biosynthesis occurs during fruit formation and in response to stress conditions. For example, PaNCED1 and PaNCED3 in avocado are strongly induced as the fruit ripened, while PaNCED2 is constitutively expressed during fruit ripening [10]. In orange fruits, expression of the CsNCED1 gene increases in the epicarp during natural and ethylene-induced fruit maturation, in a pattern consistent with the accumulation of ABA. The second gene, CsNCED2, is not detected in fruits [16]. In drought-stressed leaves, accumulation of ABA is well in accordance with an increased expression of the NCED gene [9, 20–24] and accumulation of the corresponding NCED protein [25]. Furthermore, transgenic plants which overexpress the NCED genes can accumulate large amounts of ABA and are more resistant to abiotic stress [13, 26, 27]. Although apple (Malus) is one of the most economically important fruits worldwide, very limited information is currently available on characteristics of NCED in apple (Malus). To gain novel insights into the role of NCED in biosynthesis of ABA in fruit and in response to stress conditions, in this study two NCED genes, named MpNCED1 and MpNCED2, have been isolated from Malus prunifolia and characterized the expression patterns during fruit development and under stress conditions. Results from the present study would provide useful information on biosynthesis of ABA in apple (Malus).

Mol Biol Rep (2014) 41:6795–6802 Table 1 Primers and their sequences used in these experiments Prime

Sequence

Usage

NCED1S

F:CCTTTCTCCCCAAACCTCTC

NCED1A

R:TAACCCACCACCAACAACAA

Cloning for cDNA of MpNCED1

NCED2S

F:GAGGCACCGTTCTCTGCTAC

NCED2A

R:CCCCAAAACCTCTCACTCAA

NCED1Sreal

F:AGAAAATGTACGGCGGTGAG

NCED1Areal

R:TGAAGCTCCGACTTCCAGTT

NCED2Sreal

F:CTGAAACAGGGGACCTCAAA

NCED2Areal

R:CGTAGCTAAGCGCGAAGAGT

Actins

F:GGACAGCGAGGACATTCAGC

Actina

R:CTGACCCATTCCAACCATAACA

EFs

F:ATTCAAGTATGCCTGGGTGC

EFa

R:CAGTCAGCCTGTGATGTTCC

Cloning for cDNA of MpNCED2 Real-time RTPCR for MpNCED1 Real-time RTPCR for MpNCED2 Real-time RTPCR for reference gene Real-time RTPCR for reference gene

temperature treatments, plants were exposed in a growth chamber to 40 and 4 °C respectively, and leaves were sampled after 0, 1, 2, 4, 8 and 12 h.

Materials and methods

Cloning of MpNCEDs and sequence analysis

Plant material and treatments

Total RNA was extracted from frozen leaves samples of two-year-old potted seedlings of M. prunifolia according to the cetyl trimethyl ammonium bromide (CTAB) method [28]. RNase-free DNase I (Takara, Japan) was used according to the manufacturer’s instructions to remove any DNA contamination from total RNA. Then first strand cDNA was synthesized with a RevertAidTM First Strand cDNA Synthesis Kit (Fermentas) for full-length NCEDs cloning. We first used conserved NCED sequences of other plants as queries to perform BLASTP in apple genome database (http://www.genomics.research.iasma.it/) to search possible apple NCED genes. Then we run blastn in apple EST database and try to align sequences as long as possible. According to above aligned sequences, we designed primers as Table 1 to use for RT-PCR. The PCR product was purified with an Axygen Gel Extraction Kit (Axygen, California, USA), and was ligated into a pMD-18T Vector (Takara, Japan), from which single clones were sequenced. DNA sequence similarities were analyzed using the programs provide by NCBI BLAST (http://www.ncbi.nlm. nih.gov/blast/). The protein conserved domain was

Leaves from two-year-old potted seedlings of M. prunifolia were collected for RNA extraction and gene cloning. Fruit samples at different developmental and maturation stages were periodically harvested from ten-year-old ‘Gala’ apple trees grafted onto rootstock M. prunifolia were trained as a central leader system and grown at a density of 2 9 4 m in an experimental orchard at the Horticultural Experimental Station of Northwest A & F University, Yangling, China (lat. 34°200 N, long. 108°240 E). Young fruits picked on April 14, 2012 samples were designed as 0 day after full-flower (70 % petal falled-off). After that fruit samples were harvested at 15 day intervals at 15, 30, 45, 90 and 120 days Two-year-old potted M. prunifolia tree were used for drought, high temperature and low temperature treatment. Standard horticultural practices were followed for disease and pest control. For drought treatment, irrigation was withheld for up to 12 day from 1.0-m-tall plants. Their middle leaves (seven to nine per plant) were sampled after 0, 2, 4, 8, and 12 days of treatment. For high and cold

123

Mol Biol Rep (2014) 41:6795–6802

predicted using SMART (http://smart.emblheidelberg.de/ smart/change_mode.pl) network services. The deduced amino acid sequences were aligned by CLUSTALX, and adjusted manually when necessary. A phylogenetic tree was then constructed by the Maximum Likelihood method, with 1,000 bootstrap replicates, according to the MEGA 5.0 program. Prediction of transit peptide of apple NCEDs proteins were carried out using ChloroP (www.cbs.dtu.dk/ services/ChloroP/) and PSORT (http://psort.ims.u-tokyo. ac.jp/form.html). The presence of regulatory elements in 1,500-bp of sequence upstream of each translational start codon was determined using the PlantCARE database (http://www.bioinformatics.psb.ugent.be/webtools/plant care/html/). Quantitative real-time PCR analysis for MpNCEDs The expression of NCEDs during fruit development and under various abiotic stresses was examined using realtime RT-PCR. First-strand cDNA was synthesized with a SYBR PrimeScriptTM RT-PCR Kit II (TaKaRa) plus random hexamers and oligo(dT) primers. After reverse transcription, the reaction product was diluted tenfold with sterile water. Real-time PCR was performed on an iQ5.0 instrument (Bio-Rad, USA), using a SYBR Premix Ex Taq kit (TaKaRa) according to the manufacturer’s instructions. Actin transcripts and EF-1a were used to standardize the cDNA samples for different genes. The specific primer sequences for gene expression are shown in Table 1. These qRT-PCR experiments were repeated three times, based on three separate RNA extracts from three samples. Values for mean expression and standard deviation (SD) were calculated from the results of three independent replicates.

Results Isolation and sequence analysis of two NCED genes from Malus prunifolia After electric alignment we obtained full-length sequence from databases, a reverse transcription polymerase chain reaction (RT-PCR)-based strategy was adopted to isolate NCED genes from leave of M. prunifolia. Based on cDNA of leaves and degenerated primers designed in conserved regions of NCEDs, two full-length NCED genes were isolated, and designed as MpNCED1 (KJ719310) and MpNCED2 (KJ719311). MpNCED1 is totally 2,012 bp long, including 125 bp 50 -untranslated region, 1,824 bp ORF and 63 bp 30 untranslated region. MpNCED2 contained an ORF of 1,845 bp with a 56 bp 50 -UTR and a 264 bp 30 -UTR. The ORF of the MpNCED1 and MpNCED2 encode 607 and 614 amino acids, respectively. The

6797

deduced amino acid sequence analysis showed these two peptides belong to carotenoid dioxygenase family. The deduced amino acid sequence of MpNCED1 and MpNCED2 are 67.86 % identical, with bigger difference in N terminal and highly conserved in other parts. Both proteins have a putative chloroplast signal peptide at the amino terminus and immediately downstream a predicted amphipathic a-helix involved in protein membrane binding (Fig. 1) [14, 29]. Similar to other plant NCEDs, MpNCED1 and MpNCED2 contain four conserved his residues required for iron sequestration, for catalytic activity (Fig. 1) [12, 30]. We compared the predicted amino acid sequences of MpNCED1 and MpNCED2 with known GenBank sequences through BLASTP and PSI-BLAST. The MpNCED1 protein sequence showed high identity to Malus hupehensis (99.0 %, ACH85193.1), Pyrus pyrifolia (98 %, AEK07906.1), Fragaria x ananassa (78.0 %, ADU85829.1), Citrus clementine (75.0 %, ABC26010.1), Vitis vinifera (75.0 %, CAN74478.1), Nicotiana tabacum (74 %, AFP57678.1). The MpNCED2 protein sequence showed high identity to Prunus avium (92 %, ADN65136.1), F. ananassa (81.0 %, AFU61915.1), V. vinifera (77.0 %, CAN81383.1), Citrus sinensis (75.0 %, AER70359.1), Solanum tuberosum (74 %, AAT75152.1), M. hupehensis (73.0 %, ACH85193.1). These revealed that MpNCED1 and MpNCED2 amino acid sequence were very similar to other plant NCEDs. In order to investigate the evolutionary relationships of MpNCEDs protein among plant NCED, we constructed a phylogenetic tree (Fig. 2) that enabled us to group all of them into three main groups. Group 1 included PaNCED1, PpNCED1, PbNCED1, MpNCED2, AtNCED3, CsNCED1 and AtNCED9. Group 2 included AtNCED5, AtNCED2, CsNCED2, VvNCED2, PpNCED2, MhNCED and MpNCED1. Group 3 included AtNCED6. The phylogenetic tree shows that MpNCED1 and MpNCED2 were highly homologous to other NCEDs, and most closely related to MhNCED and PbNCED1, relatively (Fig. 2). Changes in mRNA expression of MpNCED1 and MpNCED2 during apple fruit development qRT-PCR was used to investigate the degree of mRNA expression by MpNCED1 and MpNCED2 during fruit development. The relative expression levels for MpNCED1 peaked in 0-DAFB fruits, and then clearly declined to a steady low level after 30 DAFB; in 15-DAFB fruits, expression decreased by about 50 %, compared with 0-DAFB fruits (Fig. 3). Transcript level for MpNCED2 was highly in 0-DAFB fruits, and drop strikingly until 30-DAFB fruits, but then a more dramatic increase from 45-DAFB to 120-DAFB (Fig. 3). Expression level in 120-DAFB fruits was 1.5 times that of 0-DAFB fruits.

123

6798

Mol Biol Rep (2014) 41:6795–6802

Fig. 1 Alignment of the deduced amino acid sequences of MpNCED1 and MpNCED2 The putative chloroplast transit polypeptide and putative a-helix are underlined and four conserved histidines required for activity are marked with a black dot

Fig. 2 Phylogenetic analysis of NCED in Malus prunifolia with others plant NCEDs

Compared the relative expression levels for MpNCED1 and MpNCED2, it can be concluded that MpNCED2 had higher expression level in mid-late fruit growth period than that of MpNCED1. Differential expression patterns of MpNCED1 and MpNCED2 in response to different abiotic stress We used real-time RT-PCR analyses to examine the expression of MpNCEDs in response to drought, low temperature and high temperature. Under drought treatment, the transcription level of MpNCED2 were gradually up-regulated with time and peaked the maximum at Day 4 after irrigation withheld, which was about 40 times higher than that at the beginning,

123

Fig. 3 Change in MpNCED1 and MpNCED2 expression at different developmental stages of apple fruits. The value for each sample is means of three replicates ±SD. Vertical bars indicate standard deviation

then followed by a slight decrease. In contrast to this strong up-regulation of the expression for MpNCED2, the expression for MpNCED1 showed no significant change in transcription or was even slightly down-regulated (Fig. 4a). In response to high or low temperature treatment, relative expression levels of MpNCED1 and MpNCED2 showed the similarly patterns. When seedlings exposed to 40 °C, transcripts of two MpNCED genes showed little increase before 8 h, then increased gradually and peaked in 12 h, by up to 11–13 fold over that of the 0 day (Fig. 4b). When seedlings were subjected to 4 °C for up to 12 h, transcripts in the leaves were increased during the first 8 h,

Mol Biol Rep (2014) 41:6795–6802

6799 Table 2 Regulatory elements involved in stress-, pathogen- and embryogenesis-responsiveness in MpNCED1 and MpNCED2 promoter regions Cis-element

Number of cis-elements

Function

MpNCED1

MpNCED2

ABRE

3

4

Abscisic acid responsiveness

ARE

3

1

Anaerobic induction

GCN4_motif

3

0

Endosperm expression

MBS

1

0

MYB binding site involved in droughtinducibility

RY-element

1

0

Seed-specific regulation

Skn-1_motif

3

3

Endosperm expression

TC-rich repeats

2

1

Defense and stress responsiveness

TCAelement

1

1

Salicylic acid responsiveness

Box-W1

0

2

Fungal elicitor responsive element

CGTCAmotif

0

2

MeJA-responsiveness

HSE

0

1

Heat stress responsiveness

TGACGmotif

0

2

MeJA-responsiveness

Intron/exon structures were determined by aligning the cDNA to genomic sequences. This analysis revealed there are not intron in the coding sequences of MpNCED1 and MpNCED2. Comparison of cis-regulatory elements in the promoter region of MpNCED genes

Fig. 4 Expression patterns of MpNCED1 and MpNCED2 under drought a high temperature b and low temperature c The value for each sample is means of three replicates ±SD. Vertical bars indicate standard deviation

by up to 15–20 fold over that of the control (0 h), then decreased in 12 h (Fig. 4c). The locations of MpNCED genes on chromosome and intron analysis As Blastn queries, the ORF region of MpNCED1 and MpNCED2 were used to conduct an extensive search of the public genomics databases for apple (http://www.genomics. research.iasma.it/local), We found MpNCED1 was located on chromosomes 5, while MpNCED2 in chromosomes 8.

To elucidate whether the differential expression patterns of the two MpNCED genes correlate with transcriptional regulation via their promoters, upstream regions of each genes were scanned for putative cis-regulatory elements using the PlantCARE database (http://bioinformatics.psb.ugent.be/ webtools/plantcare/html/). The promoters (including 1,500bp of sequence upstream of the translational start codon) were downloaded from the public apple genomics databases. The cis-regulatory elements in promoter of MpNCED1 and MpNCED2 were classified into three groups according to their potential responsive functions: abiotic stress-related elements, biotic stress-related elements, and seed development-related elements (Table 2). Abiotic stress related elements comprised ABA-responsive elements (ABRE), anaerobic induction elements (DRE), MYB binding site involved in drought-inducibility elements (MBS), heat shock- responsive elements (HSE), and defense and stress responsiveness elements (TC-rich

123

6800

Mol Biol Rep (2014) 41:6795–6802

Fig. 5 Location of putative regulatory elements in the promoter regions of MpNCED1 and MpNCED2 Promoter regions comprising 1,500 bp of sequence upstream from the translational start sites were

obtained from the published apple genome sequence. Putative cisregulatory elements were predicted using the PlantCARE website and were mapped

repeats). Biotic stress-related elements included MeJAresponsive elements (CGTCA-motif and TGACG- motif), salicylic acid-responsive elements (TCA-element), as well as fungal elicitor responsive element (Box-W1). Seed development-related elements comprised endosperm expression elements (Skn-1 motif and GCN4_motif) and RY-element (seed-specific regulation). Some cis-regulatory elements were found both in the MpNCED1 and MpNCED2 promoter region, such as ABRE, ARE, Skn-1_motif, TC-rich repeats and TCA-element (Table 2). However, there were obvious differences in the promoters of MpNCED1 and MpNCED2. In the case of the MpNCED1 promoters, HSE, Box-W1, CGTCAmotif and TGACG-motif elements were lacking when compared to MpNCED2, while GCN4_motif, MBS and RY-element were exist only in the promoter of MpNCED1. The composition and distribution of putative regulatory elements in promoters of MpNCED1 and MpNCED2 are shown in Table 2 and Fig. 5.

chromosome, respectively. Results also suggest that M. prunifolia NCEDs are encoded by a small gene family as has been reported for other plant species [10, 12, 14, 15, 20]. Also, it is noteworthy that MpNCED1 and MpNCED2 do not cluster together in the phylogenetic tree (Fig. 2) in spite of the high sequence identity. Abscisic acid plays important roles during fruit ripening. In this study, we found that two NCEDs have different expression pattern during fruit development. Although MpNCED1 and MpNCED2 has comparatively expression level at initial stage (0 DAFB), then both declined rapidly to 20 % level of that at 30 DAFB. Afterward, MpNCED1 showed very different expression pattern from MpNCED2, MpNCED1 kept the low expression level consistently till fruit ripen; while the expression of MpNCED2 peaked at 1.5 fold of 0 DAFB when maturation after long time low level expression (Fig. 3). In previous researches, levels of ABA in the fruit flesh of apples were higher in young fruit than that in older fruit and then increased sharply when the ripening process commenced [31, 32]. The present results suggest that MpNCED2 gene expression is consistent with the ABA accumulation in the fruit of apple and MpNCED2 may mainly regulate the ABA biosynthesis in apple fruit. In addition, ABA plays a crucial role in the adaptation of plants to different environmental stresses and in several physiological processes such as drought, low and high temperature and salinity. In higher plants, NCEDs is encoded by a small gene family. These gene members usually have undergone functional changes after a duplication event. In Arabidopsis thaliana, among 5 NCED members, AtNCED3 is the major stress-induced gene [14]. In avocado fruits also, PaNCED1 and PaNCED3, are upregulated in the mesocarp during ripening, but only PaNCED1 is induced in water-stressed leaves [10]. In Citrus, CsNCED1 expression is increased in the epicarp during natural and ethylene-induced fruit maturation, and

Discussion Biochemical and genetic studies have demonstrated that NCEDs can catalyze the cleavage reaction of cis-epoxycarotenoids into xanthoxin, is the main regulatory step in ABA biosynthesis in higher plants. In the present work two novel cDNAs encoding NCED, named MpNCED1 and MpNCED2, have been isolated from M. prunifolia. The predicted MpNCED1 and MpNCED2 proteins share high sequence identity to other plant NCEDs and both contain structural features conserved in all NCEDs, including a putative chloroplast transit peptide, amphipathic a-helix, and four conserved His residues. Genomic analysis suggests that MpNCED1 and MpNCED2 have not intron in genomic structure and located in No.5 or No.8

123

Mol Biol Rep (2014) 41:6795–6802

in water-stressed leaves, in a pattern consistent with the accumulation of ABA [16]. In our study, expression of MpNCED2 is up-regulated distinctly by various stress, including drought, low temperature and high temperature; while expression of MpNCED1 is up-regulated by low temperature and high temperature, but not by drought. In the phylogenetic tree (Fig. 2), MpNCED2 is more closely related to AtNCED3 and CsNCED1, which play a major role in water stress-induced ABA synthesis in Arabidopsis and orange leaves [13, 16]. These results suggest that MpNCED1 and MpNCED2 may play a different role in the biosynthesis of ABA in drought stress. The quantity and location of regulatory elements in the promoter could also have an effect on the expression of NCEDs in M. prunifolia. The MpNCED1 and MpNCED2 exhibited distinct differently expression patterns during the fruit development and drought stress. By in silico characterization analysis, we can find some differences in the promoter sequences of MpNCED1 and MpNCED2 (Fig. 5). Some Seed development-related elements (such as Skn-1 motif, GCN4_motif and RY-element) were only in the promoter region of MpNCED1, but not in that of MpNCED2, which may be related to the expression patterns of these two MpNCED genes in the developing fruit. The same goes for the differently expression patterns of MpNCED1 and MpNCED2 in response to drought stress, because the stress-related elements (such as HSE, Box-W1, CGTCA-motif and TGACG-motif) were only in the promoter region of MpNCED2, but not in that of MpNCED1. These hypotheses may need further experiments to confirm definitively. Acknowledgments This work was supported by the National High Technology Research and Development Program of China (863 Program) (2011AA100201) and by the earmarked fund for China Agriculture Research System.

References 1. Santner A, Calderon-Villalobos LI, Estelle M (2009) Plant hormones are versatile chemical regulators of plant growth. Nat Chem Biol 5:301–307 2. Cutler SR, Rodriguez PL, Finkelstein RR, Abrams SR (2010) Abscisic acid: emergence of a core signaling network. Annu Rev Plant Biol 61:651–679 3. Ye NH, Jia LG, Zhang JH (2012) ABA signal in rice under stress conditions. Rice 5:1–9 4. Agrawal GK, Yamazaki M, Kobayashi M, Hirochika R, Miyao A, Hirochika H (2001) Screening of the rice viviparous mutants generated by endogenous retrotransposon Tos17 insertion. tagging of a zeaxanthin epoxidase gene and a novel OsTATC gene. Plant Physiol 125:1248–1257 5. North HM, De Almeida A, Boutin JP, Frey A, To A, Botran L, Sotta B, Marion-Poll A (2007) The Arabidopsis ABA deficient mutant aba4 demonstrates that the major route for stress-induced ABA accumulation is via neoxanthin isomers. Plant J 50:810–824

6801 6. Cutler A, Krochko JE (1999) Formation and breakdown of ABA. Trends Plant Sci 4:472–478 7. Liotenberg S, North H, Marion-Poll A (1999) Molecular biology and regulation of abscisic acid biosynthesis in plants. Plant Physiol Biochem 37:341–350 8. Taylor IB, Burbidge A, Thompson AJ (2000) Control of abscisic acid synthesis. J Exp Bot 51:1563–1574 9. Schwartz SH, Qin X, Zeevaart JAD (2003) Elucidation of the indirect pathway of abscisic acid biosynthesis by mutants, genes, and enzymes. Plant Physiol 131:1591–1601 10. Chernys JT, Zeevaart JAD (2000) Characterization of the 9-cisepoxycarotenoid dioxygenase gene family and the regulation of abcisic acid biosynthesis in avocado. Plant Physiol 124:343–353 11. Ren HB, Geo ZH, Chen L (2007) Dynamic analysis of ABA accumulation in relation to the rate of ABA catabolism in maize tissues under water deficit. J Exp Bot 58:211–219 12. Tan BC, Schwartz SH, Zeevaart JA, McCarty DR (1997) Genetic control of abscisic acid biosynthesis in maize. Proc Natl Acad Sci USA 94:12235–12240 13. Iuchi S, Kobayashi M, Taji T, Naramoto M, Seki M, Kato T, Tabata S, Kakubari Y, Yamaguchi-Shinozaki K, Shinozaki K (2001) Regulation of drought tolerance by gene manipulation of 9-cis-epoxycarotenoid dioxygenase, a key enzyme in abscisic acid biosynthesis in Arabidopsis. Plant J 27:325–333 14. Tan BC, Joseph LM, Deng WT, Liu L, Cline K, McCarty DR (2003) Molecular characterization of the Arabidopsis 9-cis epoxycarotenoid dioxygenase gene family. Plant J 35:44–56 15. Burbidge A (1999) Characterization of the ABA-deficient tomato mutant notabilis and its relationship with maize. Plant J 17:427–431 16. Rodrigo MJ, Alquezar B, Zacarı´as L (2006) Cloning and characterization of two 9-cis-epoxyearotenoid dioxygenase genes, differentially regulated during fruit maturation and under stress conditions, from orange(Citrus sinensis L. Osbeck). J Exp Bot 57:633–643 17. Leng P, Zhang GL, Li XX, Wang LH, Zheng ZM (2009) Cloning of 9-cis-epoxycarotenoid dioxygenase (NCED) gene encoding a key enzyme during abscisic acid (ABA) biosynthesis and ABAregulated ethylene production in detached young persimmon calyx. Chin Sci Bull 54:2830–2838 18. Ren J, Sun L, Wu JF, Zhao SL, Wang CL, Wang YP, Ji K, Leng P (2010) Cloning and expression analysis of cDNAs for ABA 80 hydroxylase during sweet cherry fruit maturation and under stress conditions. J Plant Physiol 167:1486–1493 19. Zhang M, Leng P, Zhang G, Li X (2009) Cloning and functional analysis of 9-cis-epoxycarotenoid dioxygenase (NCED) genes encoding a key enzyme during abscisic acid biosynthesis from peach and grape fruits. J Plant Physiol 166:1241–1252 20. Iuchi S, Kobayashi M, Yamaguchi-Shinozaki K, Shinozaki K (2000) A stress-inducible gene for 9-cis- epoxycarotenoid dioxygenase involved in abscisic acid biosynthesis under water stress in drought-tolerant cowpea. Plant Physiol 123:553–562 21. Xiong L, Zhu J (2003) Regulation of abscisic acid biosynthesis. Plant Physiol 133:29–36 22. Nambara E, Marion-Poll A (2005) Abscisic acid biosynthesis and catabolism. Annu Rev Plant Biol 56:165–185 23. Yang JF, Guo ZF (2007) Cloning of a 9-cis-epoxycarotenoid dioxygenase gene (SgNCED1) from Stylosanthes guianensis and its expression in response to abiotic stresses. Plant Cell Rep 26:1383–1390 24. Wang XM, Wang Z, Dong J, Wang MZ, Gao HW (2009) Cloning of a 9-cis-epoxycarotenoid dioxygenase gene and the responses of Caragana Korshinskii to a variety of abiotic stresses. Genes Genet Syst 84:397–405 25. Qin X, Zeevaart JAD (1999) The 9-cis-epoxycarotenoid cleavage reaction is the key regulatory step of abscisic acid biosynthesis in water-stressed bean. Proc Natl Acad Sci USA 96:15361–153542

123

6802 26. Thompson AJ, Jackson AC, Symonds RC, Mulholland BJ, Dadswell AR, Blake PS, Burbidge A, Taylor IB (2000) Ectopic expression of a tomato 9-cis-epoxycarotenoid dioxygenase gene causes over-production of abscisic acid. Plant J 23:363–374 27. Qin X, Zeevaart JAD (2002) Over expression of a 9-cis-epoxycarotenoid dioxygenase gene in Nicotiana plumbaginifolia increases abscisic acid and phaseic acid levels and enhances drought tolerance. Plant Physiol 12:544–551 28. Chang S, Puryear J, Cairney J (1993) Simple and efficient method for isolating RNA from pine trees. Plant Mol Biol Rep 11:113–116

123

Mol Biol Rep (2014) 41:6795–6802 29. Tan BC, Cline K, McCarty DR (2001) Localization and targeting of the VP14 epoxy-carotenoid dioxygenase to chloroplast membranes. Plant J 27:373–382 30. Schwartz SH, Tan BC, Gage D, Zeevaart JAD, McCarty DR (1997) Specific oxidative cleavage of carotenoids by VP14 of maize. Science 276:1872–1874 31. Beru¨ter J (1982) Effect of abscisic acid on sorbitol uptake in growing apple fruits. J Exp Bot 34:737–743 32. Peng YB, Lu YF, Zhang DP (2003) Abscisic acid activates ATPase in developing apple fruit especially in fruit phloem cells. Plant Cell Environ 26:1329–1342