CSIRO PUBLISHING

Reproduction, Fertility and Development, 2015, 27, 1029–1037 http://dx.doi.org/10.1071/RD13308

Cloning and expression of progesterone receptor isoforms A and B in bovine corpus luteum Robert Rekawiecki A,B, Magdalena Karolina Kowalik A and Jan Kotwica A A

Institute of Animal Reproduction and Food Research of the Polish Academy of Sciences, Tuwima 10, 10-748 Olsztyn, Poland. B Corresponding author. Email: [email protected]

Abstract. Progesterone (P4) affects a cell through its nuclear receptor (PGR), which has two main isoforms: A (PGRA) and B (PGRB). A partial section of previously unknown PGRB cDNA from cattle was cloned. Next, mRNA and protein levels for these two isoforms in corpora lutea (CL) collected during different stages of the oestrous cycle and pregnancy were determined. The PGRB mRNA level was highest on Days 2–5 of the oestrous cycle, decreased over the next few days (P , 0.01) and increased again slightly on Days 17–20 (P , 0.05). During pregnancy, PGRB mRNA was at its lowest level during Weeks 3–5 (P , 0.01) and highest during Weeks 6–12 (P , 0.01). The profile of PGRA mRNA levels was similar to that of PGRB throughout the oestrous cycle. The PGRA protein level was highest on Days 2–10 of the oestrous cycle, decreased continuously to its lowest concentration on Days 17–20 (P , 0.01) and during Weeks 3–5 of pregnancy (P . 0.05) and increased during Weeks 6–12 (P , 0.05). PGRB protein concentration followed a similar pattern but at a markedly lower level. Both PGRA and PGRB isoforms are involved in the regulation of P4 action, especially in the newly formed CL and developed CL in the first trimester of pregnancy. These data suggest that the variable expression of these isoforms during the oestrous cycle may depend on the influence of P4. Additional keywords: nuclear receptors, PGRA, PGRB.

Received 16 September 2013, accepted 20 February 2014, published online 27 March 2014 Introduction Progesterone (P4) is a steroid hormone produced by the follicle, corpus luteum (CL) and placenta and plays a crucial role in regulating the length of the oestrous cycle, implantation of the blastocyst and maintenance of pregnancy (Niswender et al. 2000). Physiological effects of progesterone on target cells are achieved by binding to a specific nuclear progesterone receptor (PGR), the mechanism referred to as genomic pathway, or by binding to membrane non-genomic receptors (PGRMC and mPR). In the genomic pathway, cellular response occurs after a few hours, while the non-genomic pathway elicits a cell response after minutes or even seconds (Wehling and Lo¨sel 2006; Kowalik et al. 2013). The nuclear progesterone receptor has two main isoforms, PGRA and PGRB. The same gene encodes both isoforms, but with two different promoters. Protein isoform PGRB has additional amino acids at the N-terminus. The length of this section varies from 128 amino acids in chickens (Conneely et al. 1989) to 164 amino acids in humans (Mulac-Jericevic and Conneely 2004). Each isoform performs a different action. PGRB acts as a potent activator of genes that are dependent on progesterone, whereas PGRA is a weak activator of such genes. When both isoforms are expressed in a cell, PGRA acts as a potent inhibitor of PGRB, thereby reducing the effects of P4 (Pieber et al. 2001).

Journal compilation Ó CSIRO 2015

Thus, PGRA was shown to inhibit oestrogen, glucocorticoid and mineralocorticoid receptor-dependent gene activation, presumably through competition for common limiting coactivators (Wen et al. 1994; Conneely and Lydon 2000). The mRNA concentration of PGRB in human CL is 1000-fold lower than the entire pool of the progesterone receptor (Ottander et al. 2000), and the mRNA level of both PGR isoforms is regulated by P4 (Misao et al. 1998). A high concentration of P4 within human luteal cells increases the expression of PGRA mRNA, leading to reduction of PGRB mRNA, ultimately causing suppression of the effects of P4. Conversely, a low P4 concentration might suppress the expression of PGRA mRNA, followed by an increase in PGRB mRNA transcription, which, in turn, would induce PGR function and the effects of P4 within a target cell (Misao et al. 1998; Rekawiecki et al. 2008). Thus, an appropriate ratio of PGR isoforms in PGR-expressing cells is one of the conditions for the maintenance of tissue homeostasis. Therefore, the aim of these studies was to: (1) evaluate a partial sequence of cDNA that is characteristic of PGRB, (2) determine the mRNA and protein levels for PGRA and PGRB during the oestrous cycle and first trimester of pregnancy in bovine CL and (3) determine P4 and oestradiol (E2) levels in CL tissue to assess their potential impact on PGRA and PGRB mRNA and protein levels.

www.publish.csiro.au/journals/rfd

1030

Reproduction, Fertility and Development

Materials and methods Tissue collection Corpora lutea from non-gravid cows and mature heifers were harvested from a commercial slaughterhouse within 20 min of death. Immediately after collection, slices of CL were frozen in liquid nitrogen, transported to the laboratory and stored at
808C until further use. Stages of the oestrous cycle and pregnancy were estimated as previously described by Ireland et al. (1980) and Jainudeen and Hafez (1980), respectively. Corpora lutea from the first stage of the oestrous cycle (Days 2–5) were collected for molecular cloning and PGRB cDNA sequence determination based on results generated by Ottander et al. (2000), who reported the highest PGRB mRNA level in human CL. Corpora lutea from the four stages of the oestrous cycle (Days 2–5, 6–10, 11–16 and 17–20) and three stages of early pregnancy (3–5, 6–8 and 9–12 weeks) were collected for the determination of mRNA and protein levels for PGRA and PGRB isoforms. Frozen tissues were homogenised with a Retsch MM-2 vibratory mill (Retsch GmbH, Haan, Germany). Tissue powder was divided into individual portions for isolation of RNA and protein and determination of P4 and E2 concentrations. RNA isolation and reverse transcription Total RNA was extracted from homogenised tissue as previously described by Chomczynski and Sacchi (1987) using a Total RNA Kit (A&A Biotechnology, Gdynia, Poland) following the manufacturer’s instructions. Isolated RNA was stored at
808C until further analysis. The purity and concentration of the RNA were determined by measuring the absorbance at 260 nm and 280 nm wavelengths using a NanoDrop 1000 spectrophotometer (Thermo Scientific, Wilmington, DE, USA). One microgram of RNA was treated with DNase and reverse transcribed for 60 min at 428C in 20 mL reaction mixture containing RT buffer (250 mM TRIS-HCl, pH 8.3; 375 mM KCl, 15 mM MgCl2, 50 mM DTT (ditiotreitol; Promega, Madison, WI, USA), 10 mM of each dNTP, 500 ng of anchored oligo (dT)23 primers and 200 U of reverse transcriptase (Promega). The reaction was terminated by heating for 10 min at 708C. Primer design To obtain a partial characteristic sequence of the PGRB isoform, degenerate primers were used. Primers were designed using cDNA sequence comparisons found in The National Center for Biotechnology Information GenBank (NCBI GenBank; http:// www.ncbi.nlm.nih.gov/genbank/). Multiple possible alternative nucleotides among the compared sequences are replaced by degenerate nucleotides in the designed primer sequences. These differences were accounted for according to the International Union for Pure and Applied Chemistry (IUPAC) Code. Thus, each degenerate primer consisted of a mixture of primers corresponding to all permutations (Fig. 1). TaqMan probes and primers for real-time polymerase chain reaction (PCR) were designed based on cDNA sequences from the NCBI GenBank. TATA box-binding protein (TBP) was used as the control because it is one of the most stable housekeeping genes in CL (Rekawiecki et al. 2012). The probe and primers for the PGRA isoform were designed against the sequence common

R. Rekawiecki et al.

(a)

M68915.1 S68284 AY382152 XM_583951 Forward primer

(b)

DQ234979 XM_583951.5 M68915 NM_022847 Reverse primer

(c) Range of amplification primers Forward primer Reverse primer PGRB characteristic sequence

Sequence common for both isoform

Fig. 1. Schematic design of degenerate primers: (a) forward primer, (b) reverse primer. Sequences used to design primers were collected and compared. From the left: NCBI GeneBank accession number of compared sequence, number of the first nucleotide, the sequence, number of the last nucleotide. Below each block is degenerate primer sequence. Highlighted sections in compared sequences indicate places where there are variable nucleotides (grey block), which were replaced in primers with symbols for degenerate bases (grey block; nucleic acid notation table formalised by the International Union of Pure and Applied Chemistry (IUPAC)). (c) Degenerate primers area of amplification. Forward primer was annealed at the beginning of the characteristic sequence of PGRB (grey block) while reverse primer was annealed at the beginning of the common sequence for PGRA and PGRB (white block). Reverse primer sequence is written in reverse order relative to the forward primer; therefore, the shaded letters in the consensus reverse primer do not overlap with the shaded letters in the blocks of compared sequences.

to both isoforms; therefore, the mRNA expression determined was the total mRNA expression for both isoforms A and B (PGRAB). The mRNA level for PGRA was obtained after subtracting the mRNA level of PGRB from the mRNA level of PGRAB. Life Technologies (Custom Plus TaqMan RNA Assay; Life Technologies Poland, Warsaw, Poland) designed the primers and probes based on the sequence obtained for PGRB. Probes for PGRAB and TBP were monitored using the reporter dye fluorescein amidite (FAM) and the quencher tetramethylrhodamine (TAMRA). Probes for PGRB were monitored using the reporter dye FAM and a non-fluorescent quencher (NFQ). Molecular cloning and sequencing of cattle progesterone receptor isoform B Complementary DNA from CL at Days 2–5 of the oestrous cycle was used for PCR amplification with degenerate primers. PCR reactions were performed in a 50-mL reaction volume consisting of the following: 1 Pfu buffer containing 2 mM MgSO4, 0.2 mM dNTP, 0.5 mg cDNA, 0.2 mM of each degenerate primer and 2.5 U of Colour Pfu Plus DNA Polymerase (EURx, Gdansk, Poland). PCR conditions consisted of 35 cycles of denaturation for 30 s at 948C, primer annealing for 1 min at 608C and extension

Progesterone receptor isoforms

Reproduction, Fertility and Development

1031

Table 1. Forward and reverse primers and probe sequences used in real-time PCR Every probe set was designed according to accession number in the NCBI nucleotide database Gene name

Primers and probe

NCBI GeneBank accession number

Amplicon length

–

–

Progesterone receptor isoform B (PGRB)

Custom Plus TaqMan RNA, Assay ID: AJY9X9P

Progesterone receptor isoform A (PGRA)

Forward: GGCAATTGGTTTGAGGCAAA Reverse: TCTTGGGTAACTGTGCAGCAA Probe: TTGTCCCTAGCTCACAGCGTTTCTATCAGC

AJ557823.1

196

TATA box-binding protein (TBP)

Forward: CAGAGAGCTCCGGGATCGT Reverse: ACACCATCTTCCCAGAACTGAATAT Probe: AATCCCAAGCGTTTTGCTGCTGTAATCA

NM_001075742

194

for 1 min at 728C, followed by a final extension for 10 min at 728C. To confirm amplification of a single product, PCR reaction products were electrophoresed in 1% agarose (Maximus, Lodz, Poland) gel with a known standard between 100 and 1000 bp (Fermentas, Vilnius, Lithuania; data not shown). PCR products were purified using a GeneMATRIX PCR/ DNA Clean-Up Purification Kit (EURx), which effectively removes any contaminants remaining after the PCR reaction. DNA was cloned into the pJET1.2 cloning vector using a CloneJET PCR Cloning Kit (Fermentas) according to the manufacturer’s protocol. Escherichia coli strain JM107 (Fermentas) was used for transformations. Bacterial competent cells and their transformation with vector DNA were prepared using a TransformAid Bacterial Transformation Kit (Fermentas) according to the manufacturer’s protocol. Subsequently, the cells were seeded on FastMedia LB Agar Amp IPTG/X-Gal plates with ampicillin (Fermentas) and incubated at 378C overnight. Due to the presence of a lethal restriction enzyme in the pJET1.2 vector, only recombinant clones containing the insert could appear on culture plates. The presence of the insert was additionally checked by the colony PCR method as previously described (Woodman 2008) using sequencing primers from the CloneJET PCR Cloning Kit (data not shown). Positively transformed E. coli cells were grown in flasks with FastMedia LB Liquid Amp (Fermentas) with ampicillin in a shaking incubator at 378C overnight. Vectors with DNA inserts were isolated from bacterial colonies using a GeneJET Plasmid Miniprep Kit (Fermentas) according to the manufacturer’s protocol. Purified plasmids were sequenced using sequencing primers from the CloneJET PCR Cloning Kit. The measurements were made using a plate reader (Multiscan EX; Labsystem, Helsinki, Finland) at 450 nm wavelength. Real-time PCR Real-time PCR was performed using the Applied Biosystems 7900 Real-time PCR System (Applied Biosystems, Foster City, CA, USA) with Power SYBR Green PCR Master Mix (Applied Biosystems). The probes, oligonucleotide primers and expected product sizes used for PCR amplification of PGRA, PGRB and TBP as a housekeeping gene are depicted in Table 1. Real-time PCR (20 mL) included cDNA (100 ng for all TaqMan probes used), 10 mL of Applied Biosystems TaqMan Fast Universal PCR Master Mix, 0.2 mM of probe and both PCR primers

for each gene of interest. The PCR protocol had an initial denaturation step (10 min at 958C), followed by 40 cycles of denaturation (15 s at 958C) and annealing and extension (1 min at 608C). All reactions were performed in duplicate. Relative mRNA quantification data were then analysed with the Realtime PCR Miner algorithm (Zhao and Fernald 2005). Data obtained from the PCR reaction were normalised to TBP to obtain arbitrary units for the relative amount of the PCR product. Western blot analysis Radioimmunoprecipitation assay buffer (RIPA) with protease inhibitors was used for protein sample preparation (25 mM Tris– HCl, pH 7.6; 150 mM NaCl, 1% Triton X-100, 1% sodium deoxycholate and 0.1% sodium dodecyl sulfate (SDS)). Proteins obtained from CL tissue (100 mg) were electrophoresed in 10% polyacrylamide gel electrophoresis with SDS (SDS–PAGE) and transferred to an Immobilon polyvinylidene fluoride (PVDF) membrane (Millipore, Billerica, MA, USA). Thereafter, the membrane was blocked with 5% non-fat dry milk in Tris-buffered saline and Tween 20 (TBST) buffer (100 mM Tris–HCl, 0.9% NaCl and 0.05% Tween 20). The membranes were incubated overnight at 48C with PGR (C-19) antibodies (n ¼ 4), which recognise both progesterone receptor isoform PGRA with molecular mass 94 kDa and PGRB isoform with molecular mass with 120 kDa, at a concentration of 1 mg mL
1 (Santa Cruz Biotechnology, Dallas, TX, USA) and TFIID (TBP; N-12) antibodies (n ¼ 4), as a reference protein, at a concentration of 1 mg mL
1 (Santa Cruz). Membranes were washed three times for 10 min each with TBST buffer and subsequently treated with horseradish peroxidase (HRP)-conjugated anti-rabbit IgG (20 ng mL
1). Immunoreactive bands were detected using the SuperSignal West Dura Extended Duration Substrate (Pierce, Rockford, IL, USA). Band intensity was measured by Quantity One 1-D analysis software (Biorad, Berkeley, CA, USA). Hormone concentrations Progesterone and oestradiol were determined by enzyme immunoassay (EIA) as previously reported by Prakash et al. (1987), using a Multiscan EX reader plate (Labsystem) for the measurement of absorbance at a wavelength of 450 nm. Progesterone was extracted from CL tissue using petroleum ether (Tsang et al. 1990), while E2 was extracted with diethyl ether.

1032

Reproduction, Fertility and Development

Recovery of P4 and E2 averaged 90% and 87%, respectively. Data were corrected for procedural losses. The final dilution was 1 : 60 000 for P4 antiserum (IFP4) and 1 : 40 000 for horseradish peroxidase (HRP)-labelled hormone. E2 antiserum was used at a final dilution of 1 : 100 000, and HRP–hormone was used at 1 : 60 000. The range of the standard curve was 0.1–25 ng mL
1 for P4 and 6.25–1600 pg mL
1 for E2. The values of steroids shown on the graph were calculated per gram of CL tissue. The intra-assay coefficient of variation was 7.7% for P4 and 8.9% for E2. The sensitivity of the procedure was 0.15 ng mL
1 and 10 pg mL
1 for P4 and E2, respectively. Data analysis Hormone concentration values, real-time PCR and western blots were presented as the mean  s.e.m. and compared by one-way analysis of variance (ANOVA) followed by Newman–Keuls test. Relative mRNA quantification data were analysed with the Real-time PCR Miner algorithm (Zhao and Fernald 2005). Data obtained from real-time PCR and western blots were normalised to TBP to obtain arbitrary units of the relative amount of the PCR product. All calculations were carried out using the Graph Pad Prism 5.0 software package (GraphPad Software, Inc., San Diego, CA, USA). Results Molecular cloning and characterisation of a partial cDNA sequence for PGRB The DNA sequence obtained in the cloning process contained 429 nucleotides (Fig. 2). Comparison of the initial section of the progesterone receptor sequence using the BLAST and ClustalW alignment tools revealed 79% identities with the porcine (accession number: NM_001166488.1) and horse (accession number: AF053141.1) sequences. This sequence also demonstrated 75% identity with the human sequence (accession number: M15716.1), 71% identity with the rat sequence (accession number: NM_022847.1) and 68% with the mouse sequence (accession number: M68915.1; Fig. 3). Expression of PGRA and PGRB mRNA during the oestrous cycle and early pregnancy The PGRB mRNA concentration was highest at the beginning of the oestrous cycle. It decreased on Days 6–10 (P , 0.01) and had a minor increase on Days 17–20 (P , 0.05) of the oestrous cycle.

R. Rekawiecki et al.

PGRB mRNA concentration was lowest during Weeks 3–5 (P , 0.01) and highest during Weeks 6–12 (P , 0.01) of early pregnancy (Fig. 4a). The expression PGRAB mRNA was at the highest level on Days 2–5 of the oestrous cycle and decreased on Days 6–16 (P , 0.001) to its lowest level on Days 17–20 (P , 0.05). The lowest level of PGRAB mRNA was detected during Weeks 3–5 (P , 0.05) and the mRNA level increased during Weeks 6–8 (P , 0.05) and 9–12 (P , 0.001) of early pregnancy (Fig. 4b). The approximate level of mRNA for PGRA was obtained after subtracting the mRNA level of PGRB expression from the mRNA level for PGRAB. Due to the low level of mRNA for PGRB, the level of mRNA for PGRA was almost the same as the level of mRNA for PGRAB (Fig. 4c). The PGRA : PGRB mRNA ratio was highest on Days 2–16 and lowest on Days 17–20 (P , 0.01) of the oestrous cycle. The lowest ratio was maintained during Weeks 3–8 (P . 0.05) and the ratio was highest during Weeks 9–12 (P , 0.05) of pregnancy (Fig. 5). Protein levels for PGRA and PGRB during the oestrous cycle and early pregnancy Protein expression for the PGRA isoform was highest (P , 0.05) on Days 2–10 of the oestrous cycle and decreased on Days 11–16 (P , 0.05) to its lowest level (P , 0.01) on Days 17–20. PGRA protein remained at the same level during Weeks 3–5 (P . 0.05) but increased during Weeks 6–12 (P , 0.05) of early pregnancy (Fig. 6b). The profile of PGRB protein expression was similar to PGRA expression but was approximately three times lower during the oestrous cycle and pregnancy (Fig. 6c). Hormone concentrations The luteal concentration of P4 during Days 6–16 was higher than on Days 2–5 (P , 0.01) and 17–20 (P , 0.001) of the oestrous cycle. P4 concentration was increased in pregnancy compared with Days 17–20 (P , 0.001) of the oestrous cycle and remained at the same level throughout the period of pregnancy measured (Fig. 7). The oestradiol level was low on Days 2–16 of the oestrous cycle and increased on Days 17–20 (P , 0.001). In pregnant cows, the concentration of oestradiol decreased (P , 0.001) in pregnancy compared with Days 17–20 of the oestrous cycle and remained at the same level throughout the entire first trimester (Fig. 8).

Fig. 2. Partial bovine sequence of progesterone receptor isoform B; 429-nucleotide sequence obtained as a result of the molecular cloning process of the PCR product obtained from degenerate primers.

Progesterone receptor isoforms

Discussion In the present study, we cloned and sequenced a partial cDNA sequence for the progesterone receptor isoform B from cow with a length of 429 bp. Comparative BLAST analysis for PGRB determined that it was 68–79% similar to other mammalian progesterone receptors, which may indicate structural, functional or evolutionary relationships between these sequences. The PGRB sequence has been submitted to the NCBI GenBank database with the accession number KC433571. Our data demonstrate that the highest amount of mRNA and protein for both isoforms of PGR occur at the beginning of the oestrous cycle in the developing CL, which at this time

Reproduction, Fertility and Development

1033

produces a rather low concentration of P4 (Kotwica and Williams 1982). Research carried out by Berisha et al. (2002) on the bovine ovary does not confirm the highest expression of mRNA at the beginning of the oestrous cycle. They found mRNA expression during the whole life span of the CL in the oestrous cycle and early pregnancy but without any significant change, which could be due to methodological differences in performing the experiment. Formation of CL is associated with intensive vascularisation. Sakumoto et al. (2010) explain that high PGR mRNA and protein appear to be related to the increase in the number of blood vessels that occurs in the CL in the early luteal stage.

Cow Rat Mouse Human Pig Horse Cow Rat Mouse Human Pig Horse Cow Rat Mouse Human Pig Horse Cow Rat Mouse Human Pig Horse Cow Rat Mouse Human Pig Horse Cow Rat Mouse Human Pig Horse Cow Rat Mouse Human Pig Horse Cow Rat Mouse Human Pig Horse

Fig. 3. Partial bovine sequence of progesterone receptor isoform B (KC433571) and its homology with rat (NM_022847.1), mouse (M68915.1), human (M15716.1), pig (NM_001166488.1) and horse (AF053141.1) sequences. Highlighted sections and asterisks indicate that residue at that position is fully conserved. Dash indicates position of gap in the multiple alignment.

Reproduction, Fertility and Development

3000

a

a

a

0.006 a

0.004

c b

a

1000 b

0

b

12

9–

PGRAB expression (arbitrary units)

(b) 10 8

a

6

12

0 –2

5

Week of pregnancy

Fig. 5. Ratio of mRNA level of PGRA : PGRB to determine the contribution of each isoform in the studied phases of the oestrous cycle and first trimester of pregnancy.

4 d b

2

5

2–

b c

c

10

6–

6

–1

11

0

3–

–2

17

Day of the estrous cycle

PGRAB - PGRB expression (arbitrary units)

17

Day of the estrous cycle a

0

(c)

6

0

Week of pregnancy

–1

8

6–

2–

Day of the estrous cycle

5

3–

11

–2

17

10

0

6

–1

11

6–

10

6–

5

5

2–

b

9–

b

2000

8

b

a

6–

0.002

a

3–

PGRB expression (arbitrary units)

(a) 0.008

R. Rekawiecki et al.

PGRA/PGRB ratio

1034

5

8

6–

12

9–

Week of pregnancy

10 8

a

a

6 4 b b

2

b c

c

0

3–

0 5

2–

10

6–

6

–1

11

–2

17

Day of the estrous cycle

5

8

6–

12

9–

Week of pregnancy

Fig. 4. Progesterone receptor isoform mRNA mean ( s.e.m.) level in bovine corpora lutea collected from four stages (Days 2–5, 6–10, 11–16 and 17–21) of oestrous cycle and three of early pregnancy (3–5, 6–8 and 9–12 weeks; n ¼ 4 per stage). (a) PGRB mRNA level, (b) progesterone receptor total mRNA level, (c) PGRA mRNA mean, obtained by subtracting the level of isoform PGRB from the level of total progesterone receptor. Values with different superscripts are significantly different to at least P , 0.05.

Previous studies have shown that an LH surge induces an increase in PGR mRNA expression in granulosa cells of preovulatory follicles in cattle (Cassar et al. 2002), and it is suggested that P4 receptor signalling pathways may help mediate the effects of a preovulatory LH surge during follicle rupture in cattle. Because LH participates in the luteinisation of granulosa cells, this hormone may also alter the level of PGR mRNA expression in newly formed CL. This gonadotrophin surge also increases the oxytocin (OT) level and mRNA expression for the

oxytocin receptor (OTR). OT itself is involved in P4 production (Okuda et al. 1992) in bovine luteal cells, thereby forming a positive feedback loop with P4 and its receptor. A similar relationship was found between the oxytocin gene and endogenous P4 that is essential in regulating the steroid output of bovine granulosa cells (Lioutas et al. 1997). The PGRA : PGRB mRNA concentration ratio also indicates that PGRA predominates over PGRB from the beginning of the oestrous cycle up to Day 16. Thus, PGRA acts as a potent inhibitor of PGRB action and decreases the effect of progesterone on target cells as demonstrated in the studies on human amnion cells (Pieber et al. 2001). This would mean that P4, through its effect on its own receptor isoforms, can significantly affect the activity of CL, both during formation and during full development, and that the higher level of PGRA may regulate P4 action on CL cells. Messenger RNA expression for both isoforms started decreasing at Day 6 of the oestrous cycle in cows. It is possible that increasing concentrations of P4 in CL may cause a decrease in the mRNA concentration of PGRA and PGRB through a negative feedback loop as has been previously suggested (Wei et al. 1988; Misao et al. 1998). Confirmation for this hypothesis is the fact that P4 enhances the activity of 3-b-hydroxysteroid dehydrogenase/D-5-4 isomerase (3b-HSD) (Kotwica et al. 2004) and stimulates an increase in gene expression for 3b-HSD, steroidogenic acute regulatory protein (StAR) and cytochrome P450scc (Rekawiecki et al. 2005) but does not stimulate the level of mRNA for total PGR on Days 6–16 of the oestrous cycle (Rekawiecki and Kotwica 2007, 2008; Rekawiecki et al. 2008). The protein levels for both isoforms decreased starting at Day 11 of the oestrous cycle, which followed the mRNA level decrease. The delay in decrease of PGR protein compared with mRNA may be due to the regulation of protein translation, e.g. by miRNAs (Williams et al. 2012), or could be the result of the longer amount of time required for protein translation. Reduced P4 production in luteolysed CL at the end of the oestrous cycle was followed by a reduction in the mRNA and protein concentrations for both PGR isoforms to their lowest

Progesterone receptor isoforms

Reproduction, Fertility and Development

80 000

(a)

b

PGRA 94 kDa 2–5

6–10 11–16 17–20

3–5

6–8

9–12

TBP 37 kDa

(b) 0.40

a

PGRA protein level (arbitrary units)

40 000

20 000

0.25

5

0.15

0.05 0 6

0

–2

17

Day of the estrous cycle

5

3–

8

6–

Week of pregnancy

12

9–

30

Week of pregnancy

E2 (pg g⫺1 tissue)

(c) 0.30 0.25

a a

0.15

9–

Fig. 7. Mean ( s.e.m.) progesterone (P4) concentrations in bovine corpora lutea collected from four stages (Days 2–5, 6–10, 11–16 and 17–21) of oestrous cycle and three of early pregnancy (3–5, 6–8 and 9–12 weeks; n ¼ 4 per stage). Values with different superscripts are significantly different to at least P , 0.05.

c

–1

17

12

6–

3–

–2

11

8

5

0

–1

6–

Day of the estrous cycle

0.10

11

6

10

2–

c

10

a

b

b

0.20

6–

b

c

b

5

b

b

0

0.30

2–

b

60 000

a

0.35

0.20

P4 (ng g⫺1 tissue)

PGRB 120 kDa

PGRB protein level (arbitrary units)

1035

ad

b

20

10

a

a

a

a

ad

a

a

bd

0.10

0

0.05

c

bc

5

2–

0 5

2–

0

6

0

1 6–

1

1 1–

2 7–

1

Day of the estrous cycle

5

3–

8

6–

2

1 9–

Week of pregnancy

Fig. 6. Mean ( s.e.m.) progesterone receptor isoform protein level in bovine corpora lutea collected from four stages (Days 2–5, 6–10, 11–16 and 17–21) of oestrous cycle and three of early pregnancy (3–5, 6–8 and 9–12 weeks; n ¼ 4 per stage). (a) Representative western blot of PGRA, PGRB and TBP protein, (b) PGRA protein level, (c) PGRB protein level. Values with different superscripts are significantly different to at least P , 0.05.

levels. In luteal cells of the CL, the nuclei change their structure, condense their nuclear chromatin and cut the DNA with endonucleases, leading to apoptosis (Niswender et al. 2000). Thus, nuclear receptors could limit their mRNA and protein concentrations as a consequence. However, we found a small increase in the mRNA expression of PGRB at the end of the oestrous cycle. At this time, when the PGRB isoform was expressed at higher levels, mRNA expression for the PGRA isoform remained unchanged, hence a significant decline of the ratio of PGRA : PGRB was observed. Additionally, a high concentration of E2 at the end of the oestrous cycle may have an indirect effect on the mRNA level of PGRB (Lee and Gorski 1996).

10

6–

6

–1

11

0

–2

17

Day of the estrous cycle

5

3–

8

6–

12

9–

Week of pregnancy

Fig. 8. Mean ( s.e.m.) oestradiol (E2) concentrations in bovine corpora lutea collected from four stages (Days 2–5, 6–10, 11–16 and 17–21) of oestrous cycle and three of early pregnancy (3–5, 6–8 and 9–12 weeks; n ¼ 4 per stage). Values with different superscripts are significantly different to at least P , 0.05.

Our data demonstrate that mRNA and protein expression for both receptor isoforms are very low at the beginning of pregnancy, but increase as pregnancy progresses. This observation may be because the production of P4 in CL is comparable to that in the CL of mid-oestrous cycle and P4 decreases transcription of both PGR isoforms. Progesterone synthesis in early pregnancy by the CL is supported by t interferon secreted by the embryo trophoblast binuclear cells; t interferon blocks arachidonic acid transfer into prostaglandin F2a (PGF2a) and stimulates P4 synthesis in large luteal cells (Tamane et al. 2004). About the third week of pregnancy the formation of the placenta starts and the effect of t interferon on the corpus luteum cells gradually diminishes. At about 45 days of pregnancy, the placenta becomes an additional source of P4 (Laven and Peters 1996). Thus, local communication of the uterus with the ovary (Krzymowski and Stefan´czykKrzymowska 2004) may increase the impact of P4 on CL and as a

1036

Reproduction, Fertility and Development

result of increased impact of P4 on luteal cells can lead to higher mRNA and protein expression levels for each isoform. Additionally, the ratio of PGRA to PGRB may indicate predominance of isoform B over isoform A at the beginning of pregnancy, which is a crucial period for its development. However, secretion of P4 from the placenta may account for the alteration of the PGRA : PGRB ratio and may lead to an alteration of cells’ responsiveness to P4 (Graham et al. 2005). The relationship between mRNA and protein expression of the PGRA and PGRB isoforms changes during the oestrous cycle and is dependent on the hormonal status of the cow. The mRNA concentration of the PGRB isoform in cows was ,500–2000 times lower than the mRNA level for the PGRA isoform, and the protein level was ,2–8 times lower. In human CL, the level of PGRB mRNA was 100–1000-fold lower than PGRA mRNA, and it was lower in the mid-luteal phase than during the early or late luteal phase (Ottander et al. 2000). We obtained similar results in cows, but the mRNA expression level difference between PGRA and PGRB was much higher than that of the level of protein. This proportion of PGR isoform expression in humans may depend on the concentration of P4. A high level of P4 causes an increase in the expression of PGRA mRNA, which indirectly affects the level of PGRB mRNA and consequently the effect of P4 (Misao et al. 1998; Rekawiecki et al. 2008). Changes in the relationship between mRNA and protein expression may depend on many complicated and varied posttranscriptional mechanisms involved in turning mRNA into protein that are not yet sufficiently well defined to be able to compute protein concentrations from mRNA. The newly formed proteins may also differ substantially in their in vivo half-lives and in this way regulate the afore-mentioned relationship. Finally, there is a significant amount of error and noise in both protein and mRNA experiments that limit our ability to obtain clear differences. We believe that an important factor that caused the specified differences was also a difference in the sensitivity of methods: real-time PCR and western blot. All of these factors have meant that over a thousand times difference between the levels of mRNA were reduced to a difference of only several times between the PGRB and PGRA proteins. In contrast to the expression of PGR isoforms in the CL of cows and humans, a different response of P4 action during the oestrous cycle in the CL of monkeys has been reported. In this case, the P4 concentration profile was similar to humans (Auletta et al. 1995), yet the level of PGRB protein expression in the luteal tissue predominated and remained stable over the level of PGRA protein throughout the duration of the oestrous cycle. However, the protein expression of PGRA decreased from its highest level at the early phase of the oestrous cycle to its lowest level at the end of the cycle (Duffy et al. 1997). These mechanisms indicate that PGRA is not the dominant isoform in all species and suggests differential regulation of PGR isoform expression in luteal cells. We found the highest concentration of E2 on Days 17–20. This stage is characterised by low cytochrome P450 aromatase activity, which participates in the synthesis of E2 (Okuda et al. 2001). It is therefore possible that this E2 was produced by developing follicles and was distributed to the ovary and to the CL through the blood vessels.

R. Rekawiecki et al.

We did not observe a significant relationship between E2 concentration in luteal tissue and the expression of mRNA and protein for either PGR isoform. There was no correlation between E2 concentration in luteal tissue and luteal P4 as well as the expression of mRNA and protein for either PGR isoform. The promoter of the PGR gene includes a sequence known as the oestrogen response element (ERE), which binds E2 (Savouret et al. 1989). Lee and Gorski (1996) suggest that in the Rat1þER cell line, E2 regulates some genes by the activation of catalytic intermediary factors that, in turn, modify some components of the transcriptional machinery or chromatin structure. Accumulation of these products over time may then enhance the transcription of PGR. Thus, E2 may be involved in PGRA and PGRB transcription receptor activation, but not in stimulating the expression of PGR. In conclusion, cloning a partial sequence of the PGRB isoform allowed for the determination of the mRNA concentration for PGRB and PGRA isoforms. Both PGRA and PGRB isoforms are involved in the regulation of P4 action, especially in the newly created CL and developed CL in the first trimester of pregnancy. Variable synthesis of these isoforms during the oestrous cycle may suggest their regulation by P4. Acknowledgements We thank Dr S. Okrasa (University of Warmia nad Mazury, Olsztyn, Poland) for the antibodies against progesterone antiserum and Dr G. L. Williams (Texas A&M University, Beeville, TX, USA) for the antibodies against oestradiol antiserum. The study was supported by a grant (N N311 113638) from the Ministry of Science and Higher Education and by The Polish Academy of Sciences. The authors declare that there is no conflict of interest that would prejudice the impartiality of this scientific work.

References Auletta, F. J., Kelm, L. B., and Schofield, M. J. (1995). Responsiveness of the corpus luteum of the rhesus monkey (Macaca mulatta) to gonadotrophin in vitro during spontaneous and prostaglandin F2 alpha-induced luteolysis. J. Reprod. Fertil. 103, 107–113. doi:10.1530/JRF.0.1030107 Berisha, B., Pfaffl, M. W., and Schams, D. (2002). Expression of oestrogen and progesterone receptors in the bovine ovary during oestrous cycle and pregnancy. Endocrine 17(3), 207–214. doi:10.1385/ENDO:17:3:207 Cassar, C. A., Dow, M. P. D., Pursley, J. R., and Smith, G. W. (2002). Effect of the preovulatory LH surge on bovine follicular progesterone receptor mRNA expression. Domest. Anim. Endocrinol. 22, 179–187. doi:10.1016/S0739-7240(02)00124-8 Chomczynski, P., and Sacchi, N. (1987). Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156–159. doi:10.1016/0003-2697(87)90021-2 Conneely, O. M., and Lydon, J. P. (2000). Progesterone receptors in reproduction: functional impact of the A and B isoforms. Steroids 65 (10–11), 571–577. doi:10.1016/S0039-128X(00)00115-X Conneely, O. M., Kettelberger, D. M., Tsai, M. J., Schrader, W. T., and O’Malley, B. W. (1989). The chicken progesterone receptor A and B isoforms are products of an alternate translation initiation event. J. Biol. Chem. 264, 14062–14064. Duffy, D. M., Wells, T. R., Haluska, G. J., and Stouffer, R. L. (1997). The ratio of progesterone receptor isoforms changes in the monkey corpus luteum during the luteal phase of the menstrual cycle. Biol. Reprod. 57, 693–699. doi:10.1095/BIOLREPROD57.4.693 Graham, J. D., Yager, M. L., Hill, H. D., Byth, K., O’Neill, G. M., and Clarke, C. L. (2005). Altered progesterone receptor isoform expression

Progesterone receptor isoforms

Reproduction, Fertility and Development

remodels progestin responsiveness of breast cancer cells. Mol. Endocrinol. 19(11), 2713–2735. doi:10.1210/ME.2005-0126 Ireland, J. J., Murphee, R. L., and Coulson, P. B. (1980). Accuracy of predicting stages of bovine oestrous cycle by gross appearance of the corpus luteum. J. Dairy Sci. 63, 155–160. doi:10.3168/jds.S0022-0302 (80)82901-8 Jainudeen, M. R., and Hafez, E. S. E. (1980). ‘Gestation, prenatal physiology and parturition. In ‘Reproduction in Farm Animals’. (Eds E. Hafez and E. S. E. Havez.) pp. 247–283. (Lea & Febiger: Philadelphia.) Kotwica, J., and Williams, G. L. (1982). Relationship of plasma testosterone concentrations to pituitary–ovarian hormone secretion during the bovine oestrous cycle and the effects of testosterone propionate administered during luteal regression. Biol. Reprod. 27, 790–801. doi:10.1095/BIOL REPROD27.4.790 Kotwica, J., Rekawiecki, R., and Duras, M. (2004). Stimulatory influence of progesterone on its own synthesis in bovine corpus luteum. Bull. Vet. Inst. Pulawy 48, 139–145. Kowalik, M. K., Rekawiecki, R., and Kotwica, J. (2013). The putative roles of nuclear and membrane-bound progesterone receptors in the female reproductive tract. Reprod. Biol. 13(4), 279–289. doi:10.1016/J. REPBIO.2013.09.001 Krzymowski, T., and Stefan´czyk-Krzymowska, S. (2004). The oestrous cycle and early pregnancy – a new concept of local endocrine regulation. Vet. J. 168, 285–296. doi:10.1016/J.TVJL.2003.10.010 Laven, R. A., and Peters, A. R. (1996). Bovine retained placenta: aetiology, pathogenesis and economic loss. Vet. Rec. 139, 465–471. doi:10.1136/ VR.139.19.465 Lee, Y. J., and Gorski, J. (1996). Oestrogen-induced transcription of the progesterone receptor gene does not parallel oestrogen receptor occupancy. Proc. Natl. Acad. Sci. USA 93, 15180–15184. doi:10.1073/ PNAS.93.26.15180 Lioutas, C., Einspanier, A., Kascheike, B., Walther, N., and Ivell, R. (1997). An autocrine progesterone positive feedback loop mediates oxytocin upregulation in bovine granulosa cells during luteinisation. Endocrinology 138, 5059–5062. doi:10.1210/ENDO.138.11.5650 Misao, R., Nakanishi, Y., Iwagaki, S., Fujimoto, J., and Tamaya, T. (1998). Expression of progesterone receptor isoforms in corpora lutea of human subjects: correlation with serum oestrogen and progesterone concentrations. Mol. Hum. Reprod. 4, 1045–1052. doi:10.1093/MOLEHR/4. 11.1045 Mulac-Jericevic, B., and Conneely, O. M. (2004). Reproductive tissue selective actions of progesterone receptors. Reproduction 128, 139–146. doi:10.1530/REP.1.00189 Niswender, G. D., Juengel, J. L., Silva, P. J., Rollyson, M. K., and McIntush, E. W. (2000). Mechanisms controlling the function and life span of the corpus luteum. Physiol. Rev. 80, 1–29. Okuda, K., Miyamoto, A., Sauerwein, H., Schweigert, F. J., and Schams, D. (1992). Evidence for oxytocin receptors in cultured bovine luteal cells. Biol. Reprod. 46, 1001–1006. doi:10.1095/BIOLREPROD46.6.1001 Okuda, K., Uenoyama, Y., Berisha, B., Lange, I. G., Taniguchi, H., Kobayashi, S., Miyamoto, A., and Schams, D. (2001). Oestradiol-17beta is produced in bovine corpus luteum. Biol. Reprod. 65(6), 1634–1639. doi:10.1095/BIOLREPROD65.6.1634 Ottander, U., Hosokawa, K., Liu, K., Bergh, A., Ny, T., and Olofsson, J. I. (2000). A putative stimulatory role of progesterone acting via progesterone receptors in the steroidogenic cells of the human corpus luteum. Biol. Reprod. 62, 655–663. doi:10.1095/BIOLREPROD62.3.655 Pieber, D., Allport, V. C., and Bennett, P. R. (2001). Progesterone receptor isoform A inhibits isoform B-mediated transactivation in human amnion. Eur. J. Pharmacol. 427, 7–11. doi:10.1016/S00142999(01)01189-X

1037

Prakash, B. S., Meyer, H. H., Schallenberger, E., and van de Wiel, D. F. (1987). Development of a sensitive enzyme immunoassay (EIA). for progesterone determination in unextracted bovine plasma using the second-antibody technique. J. Steroid Biochem. Mol. Biol. 28, 623–627. doi:10.1016/0022-4731(87)90389-X Rekawiecki, R., and Kotwica, J. (2007). Molecular regulation of progesterone (P4) synthesis within the bovine corpus luteum (CL). Vet. Med. 52, 405–412. Rekawiecki, R., and Kotwica, J. (2008). Involvement of progesterone, oxytocin and noradrenaline in the molecular regulation of steroidogenesis in the corpus luteum of the cow. Bull. Vet. Inst. Pulawy 52, 573–580. Rekawiecki, R., Nowik, M., and Kotwica, J. (2005). Stimulatory effect of LH, PGE2 and progesterone on StAR protein, cytochrome P450 cholesterol side chain cleavage and 3beta hydroxysteroid dehydrogenase gene expression in bovine luteal cells. Prostaglandins Other Lipid Mediat. 78, 169–184. doi:10.1016/J.PROSTAGLANDINS.2005.06.009 Rekawiecki, R., Kowalik, M. K., Slonina, D., and Kotwica, J. (2008). Regulation of progesterone synthesis and action in bovine corpus luteum. J. Physiol. Pharmacol. 59(Suppl 9), 75–89. Rekawiecki, R., Rutkowska, J., and Kotwica, J. (2012). Identification of optimal housekeeping genes for examination of gene expression in bovine corpus luteum. Reprod. Biol. 12, 362–367. doi:10.1016/J. REPBIO.2012.10.010 Sakumoto, R., Vermehren, M., Kenngott, R. A. M., Okuda, K., and Sinowatz, F. (2010). Changes in the levels of progesterone receptor mRNA and protein in the bovine corpus luteum during the oestrous cycle. J. Reprod. Dev. 56(2), 219–222. doi:10.1262/JRD.09-141T Savouret, J. F., Misrahi, M., Loosfelt, H., Atger, M., Bailly, A., PerrotApplanat, M., Vu Hai, M. T., Guiochon-Mantel, A., Jolivet, A., and Lorenzo, F. (1989). Molecular and cellular biology of mammalian progesterone receptors. Recent Prog. Horm. Res. 45, 65–116, discussion 116–120. Tamane, R., Pilmane, M., Jeme¸ljanovs, A., and Dabuzinskiene, A. (2004). Expression of progesterone receptors in bovine corpus luteum during pregnancy. Medicina (Kaunas) 40(5), 459–466. Tsang, P. C., Walton, J. S., and Hansel, W. (1990). Oxytocin-specific RNA, oxytocin and progesterone concentrations in corpora lutea of heifers treated with oxytocin. J. Reprod. Fertil. 89, 77–84. doi:10.1530/JRF.0. 0890077 Wehling, M., and Lo¨sel, R. (2006). Non-genomic steroid hormone effects: membrane or intracellular receptors? J. Steroid Biochem. Mol. Biol. 102, 180–183. doi:10.1016/J.JSBMB.2006.09.016 Wei, L. L., Krett, N. L., Francis, M. D., Gordon, D. F., Wood, W. M., O’Malley, B. W., and Horwitz, K. B. (1988). Multiple human progesterone receptor messenger ribonucleic acids and their autoregulation by progestin agonists and antagonists in breast cancer cells. Mol. Endocrinol. 2, 62–72. doi:10.1210/MEND-2-1-62 Wen, D. X., Xu, Y. F., Mais, D. E., Goldman, M. E., and McDonnell, D. P. (1994). The A and B isoforms of the human progesterone receptor operate through distinct signalling pathways within target cells. Mol. Cell. Biol. 14(12), 8356–8364. doi:10.1128/MCB.14.12.8356 Williams, K. C., Renthal, N. E., Condon, J. C., Gerard, R. D., and Mendelson, C. R. (2012). MicroRNA-200a serves a key role in the decline of progesterone receptor function leading to term and preterm labour. Proc. Natl. Acad. Sci. USA 109, 7529–7534. doi:10.1073/PNAS. 1200650109 Woodman, M. E. (2008). Direct PCR of intact bacteria (colony PCR). Curr. Protoc. Microbiol. 9, A.3.D.1–A.3.D.6. doi: 10.1002/9780471729259. MCA03DS9 Zhao, S., and Fernald, R. D. (2005). Comprehensive algorithm for quantitative real-time polymerase chain reaction. J. Comput. Biol. 12, 1047–1064. doi:10.1089/CMB.2005.12.1047

www.publish.csiro.au/journals/rfd