Mol Biol Rep (2013) 40:7083–7091 DOI 10.1007/s11033-013-2831-9
Cloning and expression characterization of the chicken Piwil1 gene Rong Chen • Guobin Chang • Aiqin Dai • Teng Ma Fei Zhai • Mingxiu Xia • Lu Liu • Jianchao Li • Dengke Hua • Guohong Chen
•
Received: 24 December 2012 / Accepted: 26 October 2013 / Published online: 7 November 2013 Ó Springer Science+Business Media Dordrecht 2013
Abstract Piwi gene involves in the germline stem cells self-renewal, transposon silencing and post-transcriptional gene regulation in the majority of organisms; however, the biological function of Piwi gene in poultry remains unclear. Here we cloned the Piwi-like 1 (Piwil1) gene and characterized its expression in the Langshan chickens during the development. The results showed that the PIWIL1 protein was the homolog of mice MIWI and human HIWI proteins (100 % identity), and encoded a cytoplasmic protein including the two conserved domains PAZ and PIWI. In males, the expression of Piwil1 gene showed a bimodal distribution in the gonads during embryogenesis with peaks at embryonic 14.5 and 17.5–18.5 days respectively. After puberty, the expression of Piwil1 gene increased sharply and reached a high level at the sexual maturity. The mRNA expression of Piwil1 gene at 27 weeks of age is 35–40 times that of 0 week of age, indicating that the high expression of Piwil1 gene was essential to maintain the spermatogenesis. In females, the expression of Piwil1 gene showed a unimodal distribution in the embryonic gonads. A strong peak appeared at E16.5–17.5d when the primary oocytes have entered the prophase I of meiosis. Subsequently, the expression of Piwil1 gene decreased gradually and kept at the low level during the embryogenesis. So Piwil1 gene was likely to play an important role during the meiosis I. This report filled in partly the gap of the Piwi
Rong Chen and Guobin Chang have contributed equally to this study. R. Chen G. Chang (&) A. Dai T. Ma F. Zhai M. Xia L. Liu J. Li D. Hua G. Chen (&) College of Animal Science and Technology, Yangzhou University, Yangzhou 225009, China e-mail: [email protected]; [email protected]
gene researches in poultry and defined our research directions in future. Keywords Piwil1 PIWI Spermatogenesis Meiosis Chicken Embryo
Background Piwi gene was first detected in Drosophila germline stem cells (GSCs) playing an important role in the GSCs selfrenewal [1]. Subsequently, Cox et al. [2] cloned the Piwi homologous genes from Caenorhabditis elegans, humans and Arabidopsis, respectively . In Drosophila ovaries, the Piwi gene was expressed both in stem and somatic cells and performed the dual functions of endogenous and exogenous regulation. In Piwi mutants, a normal number of GSCs are present at the onset of oogenesis and spermatogenesis, but follow to fail the self-renewal and unable to produce the normal gametes in both sexes. The Drosophila Piwi gene encodes a nucleoplasmic protein [3], which is a member of PIWI subfamily of Argonaute family proteins. The two other PIWI subfamily members are AUB and AGO3. The PIWI subfamily proteins contain a PAZ domain, which is the single strand nucleic acid binding motif, and a PIWI domain implementing the slicing activity of RNase H [4, 5]. In the germline, the AGO subfamily involves in RNA silencing guided by siRNAs or miRNAs [6], while PIWI subfamily participates in the ‘‘ping-pong’’ mechanism of piRNAs and suppresses the activity of transposable elements in Drosophila [7–9]. In mice, three Piwi subfamily genes, Piwil1/Miwi, Piwil2/Mili and Piwil4/Miwi2, are largely restricted to the testis. After knock-out of three genes respectively, the male individuals were infertility due to the arrest of
123
7084
spermatogenesis and the apoptosis of germ cells [10–12]. However, the female mutants still produced the normal eggs. The Miwi gene is expressed from the pachytene stage of spermatocytes to the haploid round spermatid stage. The Mili gene is expressed during meiosis and earlier in development, while the Miwi2 gene is only expressed earlier in development [13]. In the male germline, the PIWI subfamily proteins interacted with piRNAs [14–17] and silenced transposons and other genomic selfish genetic elements at the epigenetic and post-transcriptional level to maintain the stability and integrity of the genome [12, 13, 18]. In humans, the PIWI subfamily includes the four members PIWIL1/HIWI, PIWIL2/HILI, PIWIL3 and PIWIL4/HIWI2 [19]. In addition to what is required in the spermatogenesis, the PIWI subfamily proteins are also associated with the formation and development of tumors [20, 21]. To date, little information about the PIWI protein and PIWI binding to small RNAs has been reported in poultry. By constructing small RNA cDNA library and sequencing, we firstly obtained parts of piRNA-like RNAs from the testes of adult quails and chickens, respectively, and detected their expression in different tissues during the development by real-time PCR [22–24]. Since then, Yang et al. [25] also cloned segments of piRNA-like RNAs from the adult chicken testes and validated them by Northern blot. In addition, we cloned the full-length cDNA sequence of the quail Piwil1 gene [23]. To explore the vital function of the Piwi gene in the chicken spermatogenesis, this study cloned the full-length cDNA sequence of the chicken Piwil1 gene and obtained its expression profile in the gonad during the development of Langshan chickens, which will accumulate the basic data for the further studies of the Piwi gene in poultry.
Mol Biol Rep (2013) 40:7083–7091
every day. For E3.5–5.5d embryos, the genital ridges were collected. Meantime, the segments of embryonic heads were continuously harvested from E3.5d to E11.5d. The embryonic samples were kept in Sample Protector (Cat. No D311A, Takara) and stored at 4 °C. Different tissues, including the testes, brains, hypothalamus, kidneys, adrenal glands, thyroid glands and ovaries, were obtained from the Langshan chickens (3#3$) at 1 day (0 week), 5, 10, 12 and 27 weeks of age, respectively, and finally stored at -70 °C. Genomic DNA and total RNA isolation Genomic DNA was extracted from the embryonic heads using Animal Tissue Genomic DNA Extraction Kit (Cat. No NEP001-1, Dingguo, China) and total RNA was isolated from different tissues using RNAiso Plus (Cat. No D9108A, Takara). The concentration of nucleic acids and the ratio of 260/280 were determined by NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific Inc., USA). Reverse transcription PCR (RT-PCR) and RACE The first stand cDNA was synthesized according to the manufacture’s manual of RevertAidTM First Strand cDNA Synthesis Kit (Cat. No K1621, Fermentas). According to the mRNA sequence of the red jungle fowl [GenBank: NM_001098852], the ORF sequence of Piwil1 gene was amplified from the testes of Langshan chickens at 12 weeks of age (Primers seen in Table 1). Rapid amplification of cDNA ends (RACE) were performed using the SMARTerTM RACE cDNA Amplification Kit (Cat. No 634925, Clontech) with the gene specific primers (seen in Table 1). Antibody generation
Materials and methods Ethics statement All animal experiments were reviewed and approved by the Academic Committee of College of Animal Science and Technology, Yangzhou University according to the Management Measures of Laboratory Animal of Jiangsu Province (Permit Number: 45, Government of Jiangsu Province, China). All surgery was performed according to Recommendations proposed by European Commission (1997), and all efforts were made to minimize suffering.
A peptide corresponding to the amino acid sequence of Piwil1 gene (33–46aa, N-PSHPSEQRQSLQPC-C) was designed and synthesized by Invitrogen Inc. (Shanghai, China) based on the result of epitope analysis. The peptide was conjugated to mcKLH and used to immunize two clean grade New Zealand white rabbits (R01 and R02). After eight immunizations, the antisera (A01 and A02) were collected and purified with the antigen affinity purification column. The antibody quality was evaluated by ELISA and Western blot. ELISA
Sample collection and preservation During the period of embryo incubation, the gonad tissues were collected from six Langshan chick embryos (3#3$)
123
The antigen was diluted to 1 lg/ml with carbonate buffer (pH 9.6) and loaded 100 ll per well. Cover plate and allow antigen to bind at 4 °C overnight. Removed the antigen,
Mol Biol Rep (2013) 40:7083–7091
7085
Table 1 Summary of the primers Name Piwil1
Sequence(50 –30 )
Tm (°C)
Length (bp)
Application
F: ATGACAGGAAGAGCTAGAGCC
58
2,604
RT-PCR
R: GGGATTAGAACCACAGGTCCTACCGTCA
68
1,382
50 RACE
F: ATAAACTGGCTTTCCTTGTGGGTCAGA
68
787
30 RACE
F: CCAGCCATCTTTCTTGGGTA
58
455
RT-PCR
54
374
Sex determination
54
450/600
F: TCACCTGAGCAAAGACAAC R: TCCCGTAAAGGACAGTAAG
60
126
F: GAGAAATTGTGCGTGACATCA
60
152
R: TTAGAGATAGTAAAGTCTG
b-actin
R: AGTCAAGCGCCAAAAGAAAA EE0.6
F: CTATGCCTACCACATTCCTATTTGC R: AGCTGGACTTCAGACCATCTTCT
CHD1
F: GTTACTGATTCGTCTACGAGA R: ATTGAAATGATCCAGTGCTTG
Piwil1 b-actin
Q-PCR
R: CCTGAACCTCTCATTGCCA
200 ll blocking solution (5 % non-fat milk powder) was added and incubated at 37 °C for 1 h. Removed blocking solution, 100 ll of diluted antibody was added and incubated at 37 °C for 1 h. After washed 3 times, 100 ll of HRP-conjugated secondary antibody was added and incubated at 37 °C for 1 h. After washed three times, 100 ll of desired substrate solution was added and incubated at 37 °C for 15 min. Add 50 ll of 2 M H2SO4 to stop the reaction and measure the absorbance of each well at 450 nm.
insert fragment was named pcDNA3.1-Piwil1. NIH-3T3 cells were seeded in 6-well plates at the concentration of 5 9 105 per well and cultured in DEME medium supplemented with 10 % FBS. Cells were grown in a humidified incubator at 37 °C in an atmosphere of 5 % CO2. When the NIH-3T3 cells were 80–90 % confluent, the plasmids combined with LipofectamineTM 2000 (Cat. No 11668-029, Invitrogen) were added. NIH-3T3 cells were transfected with either pcDNA3.1-Piwil1 plasmid or blank plasmid or without plasmid as controls.
Western blot
Immunofluorescent assay
Tissues were homogenized in 3–5 volumes of lysis solution with PMSF (Cat. No WB-0061, Dingguo, China) and centrifuged. The concentration of the supernatant was determined using the BCA method (Cat. No BCA-01, Dingguo, China). The total protein was separated by 10 % SDS-PAGE and electro-transferred to a PVDF membrane. The transferred membrane was incubated with the rabbit anti-chicken PIWIL1 polyclonal antibody at a dilution of 1:200. After rinsing, the membrane was incubated with the anti-rabbit secondary antibody coupled with peroxidase (Cat. No BA1054, Boster, China) at a 1:3,000 dilution. After 10 min incubation with the chemiluminescent substrate, the membrane was exposed to film (Kodak).
The medium was removed 48 h after the start of transfection, and the cells were fixed in 4 % paraformaldehyde for 30 min. Then 0.1 % Triton was added for 20 min and rinsed with phosphate buffer solution. Blocked with 3 % bovine serum albumin for 10 min at room temperature, the cells were incubated with the rabbit anti-chicken PIWIL1 polyclonal antibody overnight at 4 °C. After fully rinsing, the cells were incubated with FITC-conjugated anti-rabbit secondary antibody (Cat. No A11008, Invitrogen). To label the cell nuclei, the cells were counterstained with 300 nM 40 ,6-diamidino-2-phenylindole (DAPI) (Cat. No D01306, Invitrogen). Finally, the cells were mounted with 50 % glycerol and analyzed in a fluorescence microscopy.
Construction of over-expression vector and cell transfection
Real-time PCR
The ORF segment of Piwil1 gene was jointed into the pcDNA3.1(?) vector using T4 DNA Ligase (Cat. No EL0014, Fermentas). By restriction enzyme digestion and sequencing, the recombinant plasmid containing the correct
The first strand cDNA was synthesized according to the manufacture’s manual of PrimerScript RT reagent Kit (Cat. No DRR037A, Takara). Real-time PCR was performed using a standard SYBR Green PCR kit (Cat. No DRR081A, Takara) on the ABI 7500 Real-Time PCR Detection
123
7086
Mol Biol Rep (2013) 40:7083–7091
Fig. 1 The chicken Piwil1 gene. a Electrophoresis analysis of the Piwil1 gene (Lane 1, 3 and 5 were respectively loaded with the products of RT-PCR, 50 RACE and 30 RACE; Adjacent lane 2, 4 and 6 were the corresponding negative groups with no template), b domain prediction of the encoded PIWIL1 protein (orange, PAZ
domain; green, PIWI domain), c a phylogenetic tree of PIWI proteins constructed using the neighbour-joining method, d and e bioinformatics analysis of the 50 UTR region of Piwil1 gene (d PrintScreen of the CpG island predictive analysis; e PrintScreen of the transcription factor binding sites predictive analysis)
System (Primers seen in Table 1). The chicken b-actin gene was used as an internal control and all reactions were run in triplicate. The data were analyzed by the method of 2-DDCt. The relative expression of target gene was indicated by mean ± standard deviation (M ± SD).
100 kD and an isoelectric point of 9.26. The 110-amino acid PAZ domain (285–397aa) and the C-terminal PIWI domain (561–853 aa) were also predicted (Fig. 1b). Homology analysis suggested that each type of PIWI subfamily proteins shared a higher similarity (Fig. 1c). For example, the identity was 100 % among the PIWIL1_CHICK (PIWIL1) [SwissProt: A6N7Y9], PIWIL1_HUMAN (HIWI) [Swiss-Prot: Q96J94], PIWIL1_MOUSE (MIWI) [Swiss-Prot: Q9JMB7] and PIWIL1_DANRE (ZIWI) [Swiss-Prot: Q8UVX0]. The encoded PIWIL1 protein had no signal peptide fragment and located in the mitochondria with a possible percent of 68.75. In this gene, a 489 bp CpG island in the upstream region of 2 kb from the translation initiation site was predicted by MethPrimer with observed/expected ratio [0.6 and percent C?G[60 % (Fig. 1d) [26]. Transcription factor binding sites in the upstream region of 2 kb from the transcription start site were predicted using the TFSEARCH program with a threshold score of 85 and Vertebrate Matrix [27]. As seen in Fig. 1e, the transcription factors NF-Y, C-Rel, p300, CdxA and Oct-1 were detected; however, we could
Results Cloning of the chicken Piwil1 gene To investigate the function of PIWI protein in chickens, we isolated a 3.4 kb cDNA sequence from the testicular tissue containing a 161 bp 50 untranslated region (UTR), a 2.6 kb open reading frame (ORF) and a 660 bp 30 UTR followed by a poly(A) tail and named it Piwi-like 1, or Piwil1 (Fig. 1a). The ORF had a 100 % identity with the NCBI reference sequence [GenBank: NM_001098852] by BLAST. The ORF predicted that the encoded PIWIL1 protein contained 867 amino acid residues with a relative molecular mass of
123
Mol Biol Rep (2013) 40:7083–7091
not found the typical elements TATA box or CAAT box in the Piwil1 promoter. Intracellular location of the chicken PIWIL1 protein To capture the endogenous PIWIL1 protein in vivo, the peptide fragment was used to raise the rabbit anti-chicken PIWIL1 polyclonal antibody. The result of ELISA showed that the titer of both A01 and A02 antibodies was greater than 128,000. But only the A02 antibody specifically recognized an endogenous protein from the testicular lysate of
7087
Langshan chickens at 12 weeks of age, whose size was consistent with our previous expectation (Fig. 2a). So the A02 antibody was used for the next experiment in this study. The recombinant plasmid containing the ORF fragment of Piwil1 gene was constructed and transfected the NIH3T3 cells. The results of immunofluorescent assay showed that the green fluorescence was detected in the experimental group and spread over the cytoplasm (Fig. 2b). There was no green fluorescence in the control groups with blank plasmid or without plasmid. By DAPI staining, the
Fig. 2 The chicken PIWIL1 protein. a Western blot analysis of the endogenous PIWIL1 protein extracted from the Langshan chicken testis and brain at 12 weeks pf age, with b-actin as the loading control. b Immunofluorescent assay of NIH-3T3 cells (green, 1st Ab: a polyclonal rabbit anti-chicken PIWIL1 at 1:200, 2nd Ab: goat anti-rabbit IgG-FITC at 1:2,000; blue, 300 nM DAPI; A1–A3: the experimental group with recombinant plasmid, 9400; B1–B3: the control group with blank plasmid, 9200; C1–C3: the control group without plasmid, 9200)
123
7088
bright and blue fluorescence was observed in the nucleus of all three groups. The Piwil1 gene was expressed in the Langshan chickens at different stages To investigate the expression pattern of Piwil1 gene in chicken tissues, RT-PCR and real-time PCR were performed with cDNAs prepared from six tissues of male Langshan chickens at 12 weeks of age. Based on RT-PCR, the Piwil1 transcript was detected in testes and kidneys but very weakly in other tissues (Fig. 3a). Based on a real-time PCR analysis by relative quantification with the chicken b-actin transcript, the expression level of Piwil1 transcript in the testes was significantly higher than that of the kidneys (Fig. 3b). To explore the role of the Piwil1 gene in the spermatogenesis, we investigated the expression of Piwil1 gene in the
Fig. 3 The expression of Piwil1 gene in the Langshan chickens. a The amplification of Piwil1 ORF sequence from different tissues with b-actin as the loading control (positive, the Piwil1 ORF recombinant plasmid as a template; negative, no template). b The relative expression of Piwil1 gene in different tissues from male Langshan chickens at 12 weeks of age with the testes as the
123
Mol Biol Rep (2013) 40:7083–7091
testes of the Langshan chickens at different stages by realtime PCR. As shown in Fig. 3c, the expression of Piwil1 gene gradually increased in the testes and kidneys with age but had no change in other tissues. At 0 week of age, the expression of Piwil1 gene was close to background level in all tissues. In the testes, the expression of Piwil1 gene had no change at early stage but significantly increased after 10 weeks of age. The expression of testicular Piwil1 gene at 27 weeks of age was 35–40 times of that at 0 week of age. In the kidneys, the expression of Piwil1 gene significantly increased at early stage but remain stable after 10 weeks of age, which was different from that of the testes. Simultaneously, we investigated the expression of ovarian Piwil1 gene in the Langshan chickens at different stages (Fig. 3d). The expression of ovarian Piwil1 gene gradually decreased with age. At 0 week of age, the expression of ovarian Piwil1 gene was highest.
calibrator. c The relative expression of Piwil1 gene in different tissues from male Langshan chickens at different stages with the testes at 0 week of age as the calibrator. d The relative expression of Piwil1 gene in ovaries from the Langshan chickens at different stages with 0 week of age as the calibrator
Mol Biol Rep (2013) 40:7083–7091
The Piwil1 gene was expressed in the chick embryonic gonads To ensure the accuracy of sex determination of chick embryos, two specific fragments from EE0.6 and CDH1 gene were amplified with genomic DNA as the template (Primers seen in Table 1). The sequence of EE0.6 uniquely locates in chromosome W. The CDH1 gene exists both in chromosome Z and W. In females, the PCR product of EE0.6 was a band of 374 bp and that of CDH1 gene was two bands of 600 and 450 bp (Fig. 4a). In males, there was no PCR product for EE0.6 and only a band of 600 bp for CDH1 gene. Only the results of PCR amplification for EE0.6 and CDH1 gene were both male, the individual was determined as a male. Based on the result of sex determination, we respectively investigated the expression of Piwil1 gene in the male and female chick embryos by real-time PCR (Fig. 4b). In both sexes, the lower expression of Piwil1 gene was in the early embryonic gonad and the higher was in the later. In female chick embryonic gonads, the
Fig. 4 The expression of Piwil1 gene in chick embryonic gonads. a Sex determination of the early chick embryos (Lane 1 and 2 were loaded with the PCR products of EE0.6 sequence; lane 3 was the corresponding negative control without EE0.6; lane 4 and 5 were loaded with the PCR products of CDH1gene; lane 6 was the corresponding negative control without CDH1). b The relative expression of Piwil1 gene in the chick embryonic gonads from embryonic 3.5 days (E3.5d) to postnatal 2 days (P2) with the female gonads at E3.5d as the calibrator
7089
expression of Piwil1 gene reached a peak at E16.5–17.5d which was about 30 times of that at E3.5d. In males, the expression of Piwil1 gene showed a bimodal distribution in the embryonic gonads at E14.5d and E17.5–18.5.
Discussion PIWI proteins are mostly restricted to the germline. Different PIWI proteins exist and have function in different stages of the germline cycle among different organisms. In this study, we successfully obtained the cDNA sequence of Piwil1 gene from the Langshan chicken testes. The encoded PIWIL1 protein was highly homologous with MIWI and HIWI, hinting that the function of PIWI protein was conserved among species. And the adult- and testis-specific expression of chicken PIWIL1 protein was confirmed. In the Drosophila germline, both PIWI and AUB proteins are the components of polar granule and involve in the formation of primordial germ cells [28, 29]. In mice, MIWI is a cytoplasmic protein that is first detectable at 14 dpp, a stage that corresponds to the appearance of pachytene stage spermatocytes. In our experiments, the exogenous Piwil1 gene encoding protein located in the cytoplasm, which was consistent with that of MIWI protein. In mice, PIWI protein is largely restricted to the testis and contributes to spermatogenesis [10–12]. Given that the function of homologous protein is conserved, we speculated that the chicken PIWIL1 protein was likely to be involved in spermatogenesis. In chickens, the spermatogonia have been in the epithelium of seminiferous tubules at birth. Since the spermatogonia grow up and proliferate, they differentiate into the primary spermatocytes at 5 or 6 weeks of age. At about 10 weeks of age, the primary spermatocytes undergo the meiosis and produce the secondary spermatocytes. Then the secondary spermatocytes enter the phase of mitosis and the spermatids generate at 12 weeks of age, followed by the formation of sperms. Usually, the mature sperms are in the lumen at 20 weeks of age. To explore the role of Piwil1 gene in the spermatogenesis, we investigated the expression of Piwil1 gene in the testes in Langshan chickens at 0, 5, 10, 12 and 27 weeks of age. The Piwil1 transcript was detected both in testes and kidneys, which was consistent with the previous research result [30]. Deng and Lin [10] confirmed that Miwi gene was specifically expressed in the testes of adult mice by Northern blot and Western blot. We thought that it was due to the sensitivity of PCR was higher than that of Northern blot and Western blot. In our study, the expression of Piwil1 gene significantly increased in the testes with age. The expression of testicular Piwil1 gene at 27 weeks of age was 35–40 times of that at 0 week of age. In practice, the Langshan chickens have reached the sexual
123
7090
maturity and been at a peak of reproduction at 27 weeks of age. The continuous wave of spermatogenesis occurs in the epithelium of the testicular seminiferous tubules. What is the relationship between the abundant expression of Piwil1 gene and spermatogenesis? A possible explanation is that the accumulation of Piwil1 gene is essential to maintain the spermatogenesis. On the contrary, the expression of Piwil1 gene gradually decreased in the ovaries with age. In Drosophila, PIWI proteins play an important role in the formation of primordial germ cells and maintaining the germ stem cells [1]. In Piwi mutants, the number of germ stem cells significantly decreased. In mice, Mili gene was expressed both in the early embryonic testes and ovaries while Miwi2 was only expressed in the embryonic testes [13]. In this study, we investigated the expression of Piwil1 gene in the male and female chick embryonic gonads. The expression of Piwil1 gene in male gonads was higher than that in female gonads during the earlier period. Whether the relatively high expression of Piwil1 gene in undifferentiated gonads did indicate their testicular potentiality or not? With the sex differentiation, the expression of Piwil1 gene gradually increased both in male and female embryonic gonads. Piwil1 gene was expressed highly in ovaries at E16.5–17.5d when various growing follicles were in the ovarian germinal epithelium [31] and the primary oocytes had entered the prophase of meiosis I [32], suggesting that Piwil1 gene was likely to play an important role during the meiosis I. Subsequently, the expression of Piwil1 gene in ovaries decreased and maintained at a higher level after hatching. Meiosis in higher vertebrates shows a dramatic sexual dimorphism: germ cells enter meiosis and arrest at prophase I during embryogenesis in females, whereas in males they enter mitotic arrest during embryogenesis and enter meiosis only after birth [32]. It is more important that DNA re-methylation occurs in male germ cells during embryogenesis [33]. In our experiments, the expression of Piwil1 gene showed a bimodal distribution in the male gonads with two peaks at E14.5d and E17.5–18.5d, respectively. The more evidence of Piwil1 gene involving in the self-renewal of spermatogonial stem cells and the process of DNA re-methylation is required. In mice, Aravin et al. [13] had reported that the PIWI-piRNAs pathway primed by individual transposons was linked to de novo DNA methylation. After hatching, the expression of Piwil1 gene in testes maintained at a lower level until the sexual maturity. In mice, Miwi gene is expressed from the pachytene stage of spermatocytes to the haploid round spermatid stage. Hou et al. [34] confirmed that the temporal and spatial expression pattern of Miwi gene was regulated by an epigenetic mechanism. In chickens, which type of the testicular cells will the Piwil1 gene be expressed in and whether its expression pattern is regulated by an epigenetic mechanism or not? To elucidate these issues is our next work.
123
Mol Biol Rep (2013) 40:7083–7091 Acknowledgments The skillful technical assistance to the antibody generation by Invitrogen Inc. (Shanghai, China) is gratefully acknowledged. This study was supported by the National Key Technology R&D Program (2011BAD28B03), National Natural Science Fund (31172199 & 31372297) and the Key Technology R&D Program of Jiangsu Province, China (BE2013392).
References 1. Lin H, Spradling AC (1997) A novel group of pumilio mutations affects the asymmetric division of germline stem cells in the Drosophila ovary. Development 124:2463–2476 2. Cox DN, Chao A, Baker J, Chang L, Qiao D, Lin H (1998) A novel class of evolutionarily conserved genes defined by piwi are essential for stem cell self-renewal. Genes Dev 12:3715–3727 3. Cox DN, Chao A, Lin H (2000) Piwi encodes a nucleoplasmic factor whose activity modulates the number and division rate of germline stem cells. Development 127:503–514 4. Tolia NH, Joshua-Tor L (2007) Slicer and the argonautes. Nat Chem Biol 3:36–43 5. Seto AG, Kingston RE, Lau NC (2007) The coming of age for Piwi proteins. Mol Cell 26:603–609 6. Peters L, Meister G (2007) Argonaute proteins: mediators of RNA silencing. Mol Cell 26:611–623 7. Aravin AA, Naumova NM, Tulin AV, Vagin VV, Rozovsky YM, Gvozdev VA (2001) Double-stranded RNA-mediated silencing of genomic tandem repeats and transposable elements in the D. melanogaster germline. Curr Biol 11:1017–1027 8. Brennecke J, Aravin AA, Stark A, Dus M, Kellis M, Sachidanandam R, Hannon GJ (2007) Discrete small RNA-generating loci as master regulators of transposon activity in Drosophila. Cell 128:1089–1103 9. Aravin AA, Hannon GJ, Brennecke J (2007) The Piwi-piRNA pathway provides an adaptive defense in the transposon arms race. Science 318:761–764 10. Deng W, Lin H (2002) Miwi, a murine homolog of piwi, encodes a cytoplasmic protein essential for spermatogenesis. Dev Cell 2:819–830 11. Kuramochi-Miyagawa S, Kimura T, Ijiri TW, Isobe T, Asada N, Fujita Y, Ikawa M, Iwai N, Okabe M, Deng W, Lin H, Matsuda Y, Nakano T (2004) Mili, a mammalian member of piwi family gene, is essential for spermatogenesis. Development 131:839–849 12. Carmell MA, Girard A, van de Kant HJ, Bourc’his D, Bestor TH, de Rooij DG, Hannon GJ (2007) MIWI2 is essential for spermatogenesis and repression of transposons in the mouse male germline. Dev Cell 12:503–514 13. Aravin AA, Sachidanandam R, Bourc’his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ (2008) A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice. Mol Cell 31:785–799 14. Aravin A, Gaidatzis D, Pfeffer S, Lagos-Quintana M, Landgraf P, Lonino N, Morris P, Brownstein MJ, Kuramochi-Miyagawa S, Nakano T, Chien M, Russo JJ, Ju JY, Sheridan R, Sander C, Zavolan M, Tuschl T (2006) A novel class of small RNAs bind to MILI protein in mouse testes. Nature 442:203–207 15. Girard A, Sachidanandam R, Hannon GJ, Carmell MA (2006) A germline-specific class of small RNAs binds mammalian Piwi proteins. Nature 442:199–202 16. Grivna ST, Beyret E, Wang Z, Lin HF (2006) A novel class of small RNAs in mouse spermatogenic cells. Genes Dev 20:1709–1714 17. Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE (2006) Characterization of the piRNA complex from rat testes. Science 313:363–367
Mol Biol Rep (2013) 40:7083–7091 18. Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Totoki Y, Toyoda A, Ikawa M, Asada N, Kojima K, Yamaguchi Y, Ijiri TW, Hata K, Li E, Matsuda Y, Kimura T, Okabe M, Sakaki Y, Sasaki H, Nakano T (2008) DNA methylation of retrotransposon genes is regulated by Piwi family members MILI and MIWI2 in murine fetal testes. Genes Dev 22:970–975 19. Sasaki T, Shiohama A, Minoshima S, Shimizu N (2003) Identification of eight members of the argonaute family in the human genome. Genomics 82:323–330 20. Liu X, Sun Y, Guo J, Ma H, Li J, Dong B, Jin G, Zhang J, Wu J, Meng L, Shou C (2006) Expression of hiwi gene in human gastric cancer was associated with proliferation of cancer cells. Int J Cancer 118:1922–1929 21. Lee JH, Schu¨tte D, Wulf G, Fu¨zesi L, Radzun HJ, Schweyer S, Engel W, Nayernia K (2006) Stem-cell protein Piwil2 is widely expressed in tumors and inhibits apoptosis through activation of Stat3/Bcl2XL pathway. Hum Mol Genet 15:201–211 22. Chang GB, Chen R, Zhang Y, Dai AQ, Ma T, Chen GH (2011) Cloning and analysis of piRNAs from testes of three species. Thai J Vet Med 41:193–197 23. Chen R, Chang GB, Zhang Y, Chen GH, Hu GS, Luan DQ, Liu Y, Dai AQ (2011) Cloning and expression analysis of piRNAs and Piwill gene in quail. Sci Agric Sin 44:1727–1735 (in Chinese) 24. Zhang Y, Chang GB, Chen R, Dai AQ, Luan DQ, Li JC, Ma T, Hua DK, Chen GH (2012) Cloning and expression profiling of piRNA-like RNAs in chicken. Acta Vet Zootech Sin 43:857–866 (in Chinese) 25. Yang H, Wang XB, Liu XJ, Liu XF, Li LX, Hu XX, Li N (2012) Cloning and expression analysis of piRNA-like RNAs: adult
7091
26. 27.
28.
29.
30.
31.
32.
33. 34.
testis-specific small RNAs in chicken. Mol Cell Biochem 360:347–352 Li LC, Dahiya R (2002) MethPrimer: designing primers for methylation PCRs. Bioinformatics 18:1427–1431 Heinemeyer T, Wingender E, Reuter I, Hermjakob H, Kel AE, Kel OV, Ignatieva EV, Ananko EA, Podkolodnaya OA, Kolpakov FA, Podkolodny NL, Kolchanov NA (1998) Databases on transcriptional regulation: TRANSFAC, TRRD, and COMPEL. Nucleic Acids Res 26:364–370 Megosh HB, Cox DN, Campbell C, Lin H (2006) The role of PIWI and the miRNA machinery in Drosophila germline determination. Curr Biol 16:1884–1894 Harris AN, Macdonald PM (2001) Aubergine encodes a Drosophila polar granule component required for pole cell formation and related to eIF2C. Development 128:2823–2832 Kim TH, Yun TW, Rengaraj D, Lee SI, Lim SM, Seo HW, Park TS, Han JY (2012) Conserved functional characteristics of the PIWI family members in chicken germ cell lineage. Theriogenology 78:1948–1959 Li BC, Chen GH, Wang KH, Qian JF (2001) Study on the origin and development of the chicken embryonic gonad. China Poult 23:58–61 (in Chinese) Smith CA, Roeszler KN, Bowles J, Koopman P, Sinclair AH (2008) Onset of meiosis in the chicken embryo; evidence of a role for retinoic acid. BMC Dev Biol 8:85 Castan˜eda J, Genzor P, Bortvin A (2011) piRNAs, transposon silencing, and germline genome integrity. Mutat Res 714:95–104 Hou Y, Yuan J, Zhou X, Fu X, Cheng H, Zhou R (2012) DNA demethylation and USF regulate the meiosis-specific expression of the mouse Miwi. PLoS Genet 8:e1002716
123
Cloning and expression characterization of the chicken Piwil1 gene Rong Chen • Guobin Chang • Aiqin Dai • Teng Ma Fei Zhai • Mingxiu Xia • Lu Liu • Jianchao Li • Dengke Hua • Guohong Chen
•
Received: 24 December 2012 / Accepted: 26 October 2013 / Published online: 7 November 2013 Ó Springer Science+Business Media Dordrecht 2013
Abstract Piwi gene involves in the germline stem cells self-renewal, transposon silencing and post-transcriptional gene regulation in the majority of organisms; however, the biological function of Piwi gene in poultry remains unclear. Here we cloned the Piwi-like 1 (Piwil1) gene and characterized its expression in the Langshan chickens during the development. The results showed that the PIWIL1 protein was the homolog of mice MIWI and human HIWI proteins (100 % identity), and encoded a cytoplasmic protein including the two conserved domains PAZ and PIWI. In males, the expression of Piwil1 gene showed a bimodal distribution in the gonads during embryogenesis with peaks at embryonic 14.5 and 17.5–18.5 days respectively. After puberty, the expression of Piwil1 gene increased sharply and reached a high level at the sexual maturity. The mRNA expression of Piwil1 gene at 27 weeks of age is 35–40 times that of 0 week of age, indicating that the high expression of Piwil1 gene was essential to maintain the spermatogenesis. In females, the expression of Piwil1 gene showed a unimodal distribution in the embryonic gonads. A strong peak appeared at E16.5–17.5d when the primary oocytes have entered the prophase I of meiosis. Subsequently, the expression of Piwil1 gene decreased gradually and kept at the low level during the embryogenesis. So Piwil1 gene was likely to play an important role during the meiosis I. This report filled in partly the gap of the Piwi
Rong Chen and Guobin Chang have contributed equally to this study. R. Chen G. Chang (&) A. Dai T. Ma F. Zhai M. Xia L. Liu J. Li D. Hua G. Chen (&) College of Animal Science and Technology, Yangzhou University, Yangzhou 225009, China e-mail: [email protected]; [email protected]
gene researches in poultry and defined our research directions in future. Keywords Piwil1 PIWI Spermatogenesis Meiosis Chicken Embryo
Background Piwi gene was first detected in Drosophila germline stem cells (GSCs) playing an important role in the GSCs selfrenewal [1]. Subsequently, Cox et al. [2] cloned the Piwi homologous genes from Caenorhabditis elegans, humans and Arabidopsis, respectively . In Drosophila ovaries, the Piwi gene was expressed both in stem and somatic cells and performed the dual functions of endogenous and exogenous regulation. In Piwi mutants, a normal number of GSCs are present at the onset of oogenesis and spermatogenesis, but follow to fail the self-renewal and unable to produce the normal gametes in both sexes. The Drosophila Piwi gene encodes a nucleoplasmic protein [3], which is a member of PIWI subfamily of Argonaute family proteins. The two other PIWI subfamily members are AUB and AGO3. The PIWI subfamily proteins contain a PAZ domain, which is the single strand nucleic acid binding motif, and a PIWI domain implementing the slicing activity of RNase H [4, 5]. In the germline, the AGO subfamily involves in RNA silencing guided by siRNAs or miRNAs [6], while PIWI subfamily participates in the ‘‘ping-pong’’ mechanism of piRNAs and suppresses the activity of transposable elements in Drosophila [7–9]. In mice, three Piwi subfamily genes, Piwil1/Miwi, Piwil2/Mili and Piwil4/Miwi2, are largely restricted to the testis. After knock-out of three genes respectively, the male individuals were infertility due to the arrest of
123
7084
spermatogenesis and the apoptosis of germ cells [10–12]. However, the female mutants still produced the normal eggs. The Miwi gene is expressed from the pachytene stage of spermatocytes to the haploid round spermatid stage. The Mili gene is expressed during meiosis and earlier in development, while the Miwi2 gene is only expressed earlier in development [13]. In the male germline, the PIWI subfamily proteins interacted with piRNAs [14–17] and silenced transposons and other genomic selfish genetic elements at the epigenetic and post-transcriptional level to maintain the stability and integrity of the genome [12, 13, 18]. In humans, the PIWI subfamily includes the four members PIWIL1/HIWI, PIWIL2/HILI, PIWIL3 and PIWIL4/HIWI2 [19]. In addition to what is required in the spermatogenesis, the PIWI subfamily proteins are also associated with the formation and development of tumors [20, 21]. To date, little information about the PIWI protein and PIWI binding to small RNAs has been reported in poultry. By constructing small RNA cDNA library and sequencing, we firstly obtained parts of piRNA-like RNAs from the testes of adult quails and chickens, respectively, and detected their expression in different tissues during the development by real-time PCR [22–24]. Since then, Yang et al. [25] also cloned segments of piRNA-like RNAs from the adult chicken testes and validated them by Northern blot. In addition, we cloned the full-length cDNA sequence of the quail Piwil1 gene [23]. To explore the vital function of the Piwi gene in the chicken spermatogenesis, this study cloned the full-length cDNA sequence of the chicken Piwil1 gene and obtained its expression profile in the gonad during the development of Langshan chickens, which will accumulate the basic data for the further studies of the Piwi gene in poultry.
Mol Biol Rep (2013) 40:7083–7091
every day. For E3.5–5.5d embryos, the genital ridges were collected. Meantime, the segments of embryonic heads were continuously harvested from E3.5d to E11.5d. The embryonic samples were kept in Sample Protector (Cat. No D311A, Takara) and stored at 4 °C. Different tissues, including the testes, brains, hypothalamus, kidneys, adrenal glands, thyroid glands and ovaries, were obtained from the Langshan chickens (3#3$) at 1 day (0 week), 5, 10, 12 and 27 weeks of age, respectively, and finally stored at -70 °C. Genomic DNA and total RNA isolation Genomic DNA was extracted from the embryonic heads using Animal Tissue Genomic DNA Extraction Kit (Cat. No NEP001-1, Dingguo, China) and total RNA was isolated from different tissues using RNAiso Plus (Cat. No D9108A, Takara). The concentration of nucleic acids and the ratio of 260/280 were determined by NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific Inc., USA). Reverse transcription PCR (RT-PCR) and RACE The first stand cDNA was synthesized according to the manufacture’s manual of RevertAidTM First Strand cDNA Synthesis Kit (Cat. No K1621, Fermentas). According to the mRNA sequence of the red jungle fowl [GenBank: NM_001098852], the ORF sequence of Piwil1 gene was amplified from the testes of Langshan chickens at 12 weeks of age (Primers seen in Table 1). Rapid amplification of cDNA ends (RACE) were performed using the SMARTerTM RACE cDNA Amplification Kit (Cat. No 634925, Clontech) with the gene specific primers (seen in Table 1). Antibody generation
Materials and methods Ethics statement All animal experiments were reviewed and approved by the Academic Committee of College of Animal Science and Technology, Yangzhou University according to the Management Measures of Laboratory Animal of Jiangsu Province (Permit Number: 45, Government of Jiangsu Province, China). All surgery was performed according to Recommendations proposed by European Commission (1997), and all efforts were made to minimize suffering.
A peptide corresponding to the amino acid sequence of Piwil1 gene (33–46aa, N-PSHPSEQRQSLQPC-C) was designed and synthesized by Invitrogen Inc. (Shanghai, China) based on the result of epitope analysis. The peptide was conjugated to mcKLH and used to immunize two clean grade New Zealand white rabbits (R01 and R02). After eight immunizations, the antisera (A01 and A02) were collected and purified with the antigen affinity purification column. The antibody quality was evaluated by ELISA and Western blot. ELISA
Sample collection and preservation During the period of embryo incubation, the gonad tissues were collected from six Langshan chick embryos (3#3$)
123
The antigen was diluted to 1 lg/ml with carbonate buffer (pH 9.6) and loaded 100 ll per well. Cover plate and allow antigen to bind at 4 °C overnight. Removed the antigen,
Mol Biol Rep (2013) 40:7083–7091
7085
Table 1 Summary of the primers Name Piwil1
Sequence(50 –30 )
Tm (°C)
Length (bp)
Application
F: ATGACAGGAAGAGCTAGAGCC
58
2,604
RT-PCR
R: GGGATTAGAACCACAGGTCCTACCGTCA
68
1,382
50 RACE
F: ATAAACTGGCTTTCCTTGTGGGTCAGA
68
787
30 RACE
F: CCAGCCATCTTTCTTGGGTA
58
455
RT-PCR
54
374
Sex determination
54
450/600
F: TCACCTGAGCAAAGACAAC R: TCCCGTAAAGGACAGTAAG
60
126
F: GAGAAATTGTGCGTGACATCA
60
152
R: TTAGAGATAGTAAAGTCTG
b-actin
R: AGTCAAGCGCCAAAAGAAAA EE0.6
F: CTATGCCTACCACATTCCTATTTGC R: AGCTGGACTTCAGACCATCTTCT
CHD1
F: GTTACTGATTCGTCTACGAGA R: ATTGAAATGATCCAGTGCTTG
Piwil1 b-actin
Q-PCR
R: CCTGAACCTCTCATTGCCA
200 ll blocking solution (5 % non-fat milk powder) was added and incubated at 37 °C for 1 h. Removed blocking solution, 100 ll of diluted antibody was added and incubated at 37 °C for 1 h. After washed 3 times, 100 ll of HRP-conjugated secondary antibody was added and incubated at 37 °C for 1 h. After washed three times, 100 ll of desired substrate solution was added and incubated at 37 °C for 15 min. Add 50 ll of 2 M H2SO4 to stop the reaction and measure the absorbance of each well at 450 nm.
insert fragment was named pcDNA3.1-Piwil1. NIH-3T3 cells were seeded in 6-well plates at the concentration of 5 9 105 per well and cultured in DEME medium supplemented with 10 % FBS. Cells were grown in a humidified incubator at 37 °C in an atmosphere of 5 % CO2. When the NIH-3T3 cells were 80–90 % confluent, the plasmids combined with LipofectamineTM 2000 (Cat. No 11668-029, Invitrogen) were added. NIH-3T3 cells were transfected with either pcDNA3.1-Piwil1 plasmid or blank plasmid or without plasmid as controls.
Western blot
Immunofluorescent assay
Tissues were homogenized in 3–5 volumes of lysis solution with PMSF (Cat. No WB-0061, Dingguo, China) and centrifuged. The concentration of the supernatant was determined using the BCA method (Cat. No BCA-01, Dingguo, China). The total protein was separated by 10 % SDS-PAGE and electro-transferred to a PVDF membrane. The transferred membrane was incubated with the rabbit anti-chicken PIWIL1 polyclonal antibody at a dilution of 1:200. After rinsing, the membrane was incubated with the anti-rabbit secondary antibody coupled with peroxidase (Cat. No BA1054, Boster, China) at a 1:3,000 dilution. After 10 min incubation with the chemiluminescent substrate, the membrane was exposed to film (Kodak).
The medium was removed 48 h after the start of transfection, and the cells were fixed in 4 % paraformaldehyde for 30 min. Then 0.1 % Triton was added for 20 min and rinsed with phosphate buffer solution. Blocked with 3 % bovine serum albumin for 10 min at room temperature, the cells were incubated with the rabbit anti-chicken PIWIL1 polyclonal antibody overnight at 4 °C. After fully rinsing, the cells were incubated with FITC-conjugated anti-rabbit secondary antibody (Cat. No A11008, Invitrogen). To label the cell nuclei, the cells were counterstained with 300 nM 40 ,6-diamidino-2-phenylindole (DAPI) (Cat. No D01306, Invitrogen). Finally, the cells were mounted with 50 % glycerol and analyzed in a fluorescence microscopy.
Construction of over-expression vector and cell transfection
Real-time PCR
The ORF segment of Piwil1 gene was jointed into the pcDNA3.1(?) vector using T4 DNA Ligase (Cat. No EL0014, Fermentas). By restriction enzyme digestion and sequencing, the recombinant plasmid containing the correct
The first strand cDNA was synthesized according to the manufacture’s manual of PrimerScript RT reagent Kit (Cat. No DRR037A, Takara). Real-time PCR was performed using a standard SYBR Green PCR kit (Cat. No DRR081A, Takara) on the ABI 7500 Real-Time PCR Detection
123
7086
Mol Biol Rep (2013) 40:7083–7091
Fig. 1 The chicken Piwil1 gene. a Electrophoresis analysis of the Piwil1 gene (Lane 1, 3 and 5 were respectively loaded with the products of RT-PCR, 50 RACE and 30 RACE; Adjacent lane 2, 4 and 6 were the corresponding negative groups with no template), b domain prediction of the encoded PIWIL1 protein (orange, PAZ
domain; green, PIWI domain), c a phylogenetic tree of PIWI proteins constructed using the neighbour-joining method, d and e bioinformatics analysis of the 50 UTR region of Piwil1 gene (d PrintScreen of the CpG island predictive analysis; e PrintScreen of the transcription factor binding sites predictive analysis)
System (Primers seen in Table 1). The chicken b-actin gene was used as an internal control and all reactions were run in triplicate. The data were analyzed by the method of 2-DDCt. The relative expression of target gene was indicated by mean ± standard deviation (M ± SD).
100 kD and an isoelectric point of 9.26. The 110-amino acid PAZ domain (285–397aa) and the C-terminal PIWI domain (561–853 aa) were also predicted (Fig. 1b). Homology analysis suggested that each type of PIWI subfamily proteins shared a higher similarity (Fig. 1c). For example, the identity was 100 % among the PIWIL1_CHICK (PIWIL1) [SwissProt: A6N7Y9], PIWIL1_HUMAN (HIWI) [Swiss-Prot: Q96J94], PIWIL1_MOUSE (MIWI) [Swiss-Prot: Q9JMB7] and PIWIL1_DANRE (ZIWI) [Swiss-Prot: Q8UVX0]. The encoded PIWIL1 protein had no signal peptide fragment and located in the mitochondria with a possible percent of 68.75. In this gene, a 489 bp CpG island in the upstream region of 2 kb from the translation initiation site was predicted by MethPrimer with observed/expected ratio [0.6 and percent C?G[60 % (Fig. 1d) [26]. Transcription factor binding sites in the upstream region of 2 kb from the transcription start site were predicted using the TFSEARCH program with a threshold score of 85 and Vertebrate Matrix [27]. As seen in Fig. 1e, the transcription factors NF-Y, C-Rel, p300, CdxA and Oct-1 were detected; however, we could
Results Cloning of the chicken Piwil1 gene To investigate the function of PIWI protein in chickens, we isolated a 3.4 kb cDNA sequence from the testicular tissue containing a 161 bp 50 untranslated region (UTR), a 2.6 kb open reading frame (ORF) and a 660 bp 30 UTR followed by a poly(A) tail and named it Piwi-like 1, or Piwil1 (Fig. 1a). The ORF had a 100 % identity with the NCBI reference sequence [GenBank: NM_001098852] by BLAST. The ORF predicted that the encoded PIWIL1 protein contained 867 amino acid residues with a relative molecular mass of
123
Mol Biol Rep (2013) 40:7083–7091
not found the typical elements TATA box or CAAT box in the Piwil1 promoter. Intracellular location of the chicken PIWIL1 protein To capture the endogenous PIWIL1 protein in vivo, the peptide fragment was used to raise the rabbit anti-chicken PIWIL1 polyclonal antibody. The result of ELISA showed that the titer of both A01 and A02 antibodies was greater than 128,000. But only the A02 antibody specifically recognized an endogenous protein from the testicular lysate of
7087
Langshan chickens at 12 weeks of age, whose size was consistent with our previous expectation (Fig. 2a). So the A02 antibody was used for the next experiment in this study. The recombinant plasmid containing the ORF fragment of Piwil1 gene was constructed and transfected the NIH3T3 cells. The results of immunofluorescent assay showed that the green fluorescence was detected in the experimental group and spread over the cytoplasm (Fig. 2b). There was no green fluorescence in the control groups with blank plasmid or without plasmid. By DAPI staining, the
Fig. 2 The chicken PIWIL1 protein. a Western blot analysis of the endogenous PIWIL1 protein extracted from the Langshan chicken testis and brain at 12 weeks pf age, with b-actin as the loading control. b Immunofluorescent assay of NIH-3T3 cells (green, 1st Ab: a polyclonal rabbit anti-chicken PIWIL1 at 1:200, 2nd Ab: goat anti-rabbit IgG-FITC at 1:2,000; blue, 300 nM DAPI; A1–A3: the experimental group with recombinant plasmid, 9400; B1–B3: the control group with blank plasmid, 9200; C1–C3: the control group without plasmid, 9200)
123
7088
bright and blue fluorescence was observed in the nucleus of all three groups. The Piwil1 gene was expressed in the Langshan chickens at different stages To investigate the expression pattern of Piwil1 gene in chicken tissues, RT-PCR and real-time PCR were performed with cDNAs prepared from six tissues of male Langshan chickens at 12 weeks of age. Based on RT-PCR, the Piwil1 transcript was detected in testes and kidneys but very weakly in other tissues (Fig. 3a). Based on a real-time PCR analysis by relative quantification with the chicken b-actin transcript, the expression level of Piwil1 transcript in the testes was significantly higher than that of the kidneys (Fig. 3b). To explore the role of the Piwil1 gene in the spermatogenesis, we investigated the expression of Piwil1 gene in the
Fig. 3 The expression of Piwil1 gene in the Langshan chickens. a The amplification of Piwil1 ORF sequence from different tissues with b-actin as the loading control (positive, the Piwil1 ORF recombinant plasmid as a template; negative, no template). b The relative expression of Piwil1 gene in different tissues from male Langshan chickens at 12 weeks of age with the testes as the
123
Mol Biol Rep (2013) 40:7083–7091
testes of the Langshan chickens at different stages by realtime PCR. As shown in Fig. 3c, the expression of Piwil1 gene gradually increased in the testes and kidneys with age but had no change in other tissues. At 0 week of age, the expression of Piwil1 gene was close to background level in all tissues. In the testes, the expression of Piwil1 gene had no change at early stage but significantly increased after 10 weeks of age. The expression of testicular Piwil1 gene at 27 weeks of age was 35–40 times of that at 0 week of age. In the kidneys, the expression of Piwil1 gene significantly increased at early stage but remain stable after 10 weeks of age, which was different from that of the testes. Simultaneously, we investigated the expression of ovarian Piwil1 gene in the Langshan chickens at different stages (Fig. 3d). The expression of ovarian Piwil1 gene gradually decreased with age. At 0 week of age, the expression of ovarian Piwil1 gene was highest.
calibrator. c The relative expression of Piwil1 gene in different tissues from male Langshan chickens at different stages with the testes at 0 week of age as the calibrator. d The relative expression of Piwil1 gene in ovaries from the Langshan chickens at different stages with 0 week of age as the calibrator
Mol Biol Rep (2013) 40:7083–7091
The Piwil1 gene was expressed in the chick embryonic gonads To ensure the accuracy of sex determination of chick embryos, two specific fragments from EE0.6 and CDH1 gene were amplified with genomic DNA as the template (Primers seen in Table 1). The sequence of EE0.6 uniquely locates in chromosome W. The CDH1 gene exists both in chromosome Z and W. In females, the PCR product of EE0.6 was a band of 374 bp and that of CDH1 gene was two bands of 600 and 450 bp (Fig. 4a). In males, there was no PCR product for EE0.6 and only a band of 600 bp for CDH1 gene. Only the results of PCR amplification for EE0.6 and CDH1 gene were both male, the individual was determined as a male. Based on the result of sex determination, we respectively investigated the expression of Piwil1 gene in the male and female chick embryos by real-time PCR (Fig. 4b). In both sexes, the lower expression of Piwil1 gene was in the early embryonic gonad and the higher was in the later. In female chick embryonic gonads, the
Fig. 4 The expression of Piwil1 gene in chick embryonic gonads. a Sex determination of the early chick embryos (Lane 1 and 2 were loaded with the PCR products of EE0.6 sequence; lane 3 was the corresponding negative control without EE0.6; lane 4 and 5 were loaded with the PCR products of CDH1gene; lane 6 was the corresponding negative control without CDH1). b The relative expression of Piwil1 gene in the chick embryonic gonads from embryonic 3.5 days (E3.5d) to postnatal 2 days (P2) with the female gonads at E3.5d as the calibrator
7089
expression of Piwil1 gene reached a peak at E16.5–17.5d which was about 30 times of that at E3.5d. In males, the expression of Piwil1 gene showed a bimodal distribution in the embryonic gonads at E14.5d and E17.5–18.5.
Discussion PIWI proteins are mostly restricted to the germline. Different PIWI proteins exist and have function in different stages of the germline cycle among different organisms. In this study, we successfully obtained the cDNA sequence of Piwil1 gene from the Langshan chicken testes. The encoded PIWIL1 protein was highly homologous with MIWI and HIWI, hinting that the function of PIWI protein was conserved among species. And the adult- and testis-specific expression of chicken PIWIL1 protein was confirmed. In the Drosophila germline, both PIWI and AUB proteins are the components of polar granule and involve in the formation of primordial germ cells [28, 29]. In mice, MIWI is a cytoplasmic protein that is first detectable at 14 dpp, a stage that corresponds to the appearance of pachytene stage spermatocytes. In our experiments, the exogenous Piwil1 gene encoding protein located in the cytoplasm, which was consistent with that of MIWI protein. In mice, PIWI protein is largely restricted to the testis and contributes to spermatogenesis [10–12]. Given that the function of homologous protein is conserved, we speculated that the chicken PIWIL1 protein was likely to be involved in spermatogenesis. In chickens, the spermatogonia have been in the epithelium of seminiferous tubules at birth. Since the spermatogonia grow up and proliferate, they differentiate into the primary spermatocytes at 5 or 6 weeks of age. At about 10 weeks of age, the primary spermatocytes undergo the meiosis and produce the secondary spermatocytes. Then the secondary spermatocytes enter the phase of mitosis and the spermatids generate at 12 weeks of age, followed by the formation of sperms. Usually, the mature sperms are in the lumen at 20 weeks of age. To explore the role of Piwil1 gene in the spermatogenesis, we investigated the expression of Piwil1 gene in the testes in Langshan chickens at 0, 5, 10, 12 and 27 weeks of age. The Piwil1 transcript was detected both in testes and kidneys, which was consistent with the previous research result [30]. Deng and Lin [10] confirmed that Miwi gene was specifically expressed in the testes of adult mice by Northern blot and Western blot. We thought that it was due to the sensitivity of PCR was higher than that of Northern blot and Western blot. In our study, the expression of Piwil1 gene significantly increased in the testes with age. The expression of testicular Piwil1 gene at 27 weeks of age was 35–40 times of that at 0 week of age. In practice, the Langshan chickens have reached the sexual
123
7090
maturity and been at a peak of reproduction at 27 weeks of age. The continuous wave of spermatogenesis occurs in the epithelium of the testicular seminiferous tubules. What is the relationship between the abundant expression of Piwil1 gene and spermatogenesis? A possible explanation is that the accumulation of Piwil1 gene is essential to maintain the spermatogenesis. On the contrary, the expression of Piwil1 gene gradually decreased in the ovaries with age. In Drosophila, PIWI proteins play an important role in the formation of primordial germ cells and maintaining the germ stem cells [1]. In Piwi mutants, the number of germ stem cells significantly decreased. In mice, Mili gene was expressed both in the early embryonic testes and ovaries while Miwi2 was only expressed in the embryonic testes [13]. In this study, we investigated the expression of Piwil1 gene in the male and female chick embryonic gonads. The expression of Piwil1 gene in male gonads was higher than that in female gonads during the earlier period. Whether the relatively high expression of Piwil1 gene in undifferentiated gonads did indicate their testicular potentiality or not? With the sex differentiation, the expression of Piwil1 gene gradually increased both in male and female embryonic gonads. Piwil1 gene was expressed highly in ovaries at E16.5–17.5d when various growing follicles were in the ovarian germinal epithelium [31] and the primary oocytes had entered the prophase of meiosis I [32], suggesting that Piwil1 gene was likely to play an important role during the meiosis I. Subsequently, the expression of Piwil1 gene in ovaries decreased and maintained at a higher level after hatching. Meiosis in higher vertebrates shows a dramatic sexual dimorphism: germ cells enter meiosis and arrest at prophase I during embryogenesis in females, whereas in males they enter mitotic arrest during embryogenesis and enter meiosis only after birth [32]. It is more important that DNA re-methylation occurs in male germ cells during embryogenesis [33]. In our experiments, the expression of Piwil1 gene showed a bimodal distribution in the male gonads with two peaks at E14.5d and E17.5–18.5d, respectively. The more evidence of Piwil1 gene involving in the self-renewal of spermatogonial stem cells and the process of DNA re-methylation is required. In mice, Aravin et al. [13] had reported that the PIWI-piRNAs pathway primed by individual transposons was linked to de novo DNA methylation. After hatching, the expression of Piwil1 gene in testes maintained at a lower level until the sexual maturity. In mice, Miwi gene is expressed from the pachytene stage of spermatocytes to the haploid round spermatid stage. Hou et al. [34] confirmed that the temporal and spatial expression pattern of Miwi gene was regulated by an epigenetic mechanism. In chickens, which type of the testicular cells will the Piwil1 gene be expressed in and whether its expression pattern is regulated by an epigenetic mechanism or not? To elucidate these issues is our next work.
123
Mol Biol Rep (2013) 40:7083–7091 Acknowledgments The skillful technical assistance to the antibody generation by Invitrogen Inc. (Shanghai, China) is gratefully acknowledged. This study was supported by the National Key Technology R&D Program (2011BAD28B03), National Natural Science Fund (31172199 & 31372297) and the Key Technology R&D Program of Jiangsu Province, China (BE2013392).
References 1. Lin H, Spradling AC (1997) A novel group of pumilio mutations affects the asymmetric division of germline stem cells in the Drosophila ovary. Development 124:2463–2476 2. Cox DN, Chao A, Baker J, Chang L, Qiao D, Lin H (1998) A novel class of evolutionarily conserved genes defined by piwi are essential for stem cell self-renewal. Genes Dev 12:3715–3727 3. Cox DN, Chao A, Lin H (2000) Piwi encodes a nucleoplasmic factor whose activity modulates the number and division rate of germline stem cells. Development 127:503–514 4. Tolia NH, Joshua-Tor L (2007) Slicer and the argonautes. Nat Chem Biol 3:36–43 5. Seto AG, Kingston RE, Lau NC (2007) The coming of age for Piwi proteins. Mol Cell 26:603–609 6. Peters L, Meister G (2007) Argonaute proteins: mediators of RNA silencing. Mol Cell 26:611–623 7. Aravin AA, Naumova NM, Tulin AV, Vagin VV, Rozovsky YM, Gvozdev VA (2001) Double-stranded RNA-mediated silencing of genomic tandem repeats and transposable elements in the D. melanogaster germline. Curr Biol 11:1017–1027 8. Brennecke J, Aravin AA, Stark A, Dus M, Kellis M, Sachidanandam R, Hannon GJ (2007) Discrete small RNA-generating loci as master regulators of transposon activity in Drosophila. Cell 128:1089–1103 9. Aravin AA, Hannon GJ, Brennecke J (2007) The Piwi-piRNA pathway provides an adaptive defense in the transposon arms race. Science 318:761–764 10. Deng W, Lin H (2002) Miwi, a murine homolog of piwi, encodes a cytoplasmic protein essential for spermatogenesis. Dev Cell 2:819–830 11. Kuramochi-Miyagawa S, Kimura T, Ijiri TW, Isobe T, Asada N, Fujita Y, Ikawa M, Iwai N, Okabe M, Deng W, Lin H, Matsuda Y, Nakano T (2004) Mili, a mammalian member of piwi family gene, is essential for spermatogenesis. Development 131:839–849 12. Carmell MA, Girard A, van de Kant HJ, Bourc’his D, Bestor TH, de Rooij DG, Hannon GJ (2007) MIWI2 is essential for spermatogenesis and repression of transposons in the mouse male germline. Dev Cell 12:503–514 13. Aravin AA, Sachidanandam R, Bourc’his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ (2008) A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice. Mol Cell 31:785–799 14. Aravin A, Gaidatzis D, Pfeffer S, Lagos-Quintana M, Landgraf P, Lonino N, Morris P, Brownstein MJ, Kuramochi-Miyagawa S, Nakano T, Chien M, Russo JJ, Ju JY, Sheridan R, Sander C, Zavolan M, Tuschl T (2006) A novel class of small RNAs bind to MILI protein in mouse testes. Nature 442:203–207 15. Girard A, Sachidanandam R, Hannon GJ, Carmell MA (2006) A germline-specific class of small RNAs binds mammalian Piwi proteins. Nature 442:199–202 16. Grivna ST, Beyret E, Wang Z, Lin HF (2006) A novel class of small RNAs in mouse spermatogenic cells. Genes Dev 20:1709–1714 17. Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE (2006) Characterization of the piRNA complex from rat testes. Science 313:363–367
Mol Biol Rep (2013) 40:7083–7091 18. Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Totoki Y, Toyoda A, Ikawa M, Asada N, Kojima K, Yamaguchi Y, Ijiri TW, Hata K, Li E, Matsuda Y, Kimura T, Okabe M, Sakaki Y, Sasaki H, Nakano T (2008) DNA methylation of retrotransposon genes is regulated by Piwi family members MILI and MIWI2 in murine fetal testes. Genes Dev 22:970–975 19. Sasaki T, Shiohama A, Minoshima S, Shimizu N (2003) Identification of eight members of the argonaute family in the human genome. Genomics 82:323–330 20. Liu X, Sun Y, Guo J, Ma H, Li J, Dong B, Jin G, Zhang J, Wu J, Meng L, Shou C (2006) Expression of hiwi gene in human gastric cancer was associated with proliferation of cancer cells. Int J Cancer 118:1922–1929 21. Lee JH, Schu¨tte D, Wulf G, Fu¨zesi L, Radzun HJ, Schweyer S, Engel W, Nayernia K (2006) Stem-cell protein Piwil2 is widely expressed in tumors and inhibits apoptosis through activation of Stat3/Bcl2XL pathway. Hum Mol Genet 15:201–211 22. Chang GB, Chen R, Zhang Y, Dai AQ, Ma T, Chen GH (2011) Cloning and analysis of piRNAs from testes of three species. Thai J Vet Med 41:193–197 23. Chen R, Chang GB, Zhang Y, Chen GH, Hu GS, Luan DQ, Liu Y, Dai AQ (2011) Cloning and expression analysis of piRNAs and Piwill gene in quail. Sci Agric Sin 44:1727–1735 (in Chinese) 24. Zhang Y, Chang GB, Chen R, Dai AQ, Luan DQ, Li JC, Ma T, Hua DK, Chen GH (2012) Cloning and expression profiling of piRNA-like RNAs in chicken. Acta Vet Zootech Sin 43:857–866 (in Chinese) 25. Yang H, Wang XB, Liu XJ, Liu XF, Li LX, Hu XX, Li N (2012) Cloning and expression analysis of piRNA-like RNAs: adult
7091
26. 27.
28.
29.
30.
31.
32.
33. 34.
testis-specific small RNAs in chicken. Mol Cell Biochem 360:347–352 Li LC, Dahiya R (2002) MethPrimer: designing primers for methylation PCRs. Bioinformatics 18:1427–1431 Heinemeyer T, Wingender E, Reuter I, Hermjakob H, Kel AE, Kel OV, Ignatieva EV, Ananko EA, Podkolodnaya OA, Kolpakov FA, Podkolodny NL, Kolchanov NA (1998) Databases on transcriptional regulation: TRANSFAC, TRRD, and COMPEL. Nucleic Acids Res 26:364–370 Megosh HB, Cox DN, Campbell C, Lin H (2006) The role of PIWI and the miRNA machinery in Drosophila germline determination. Curr Biol 16:1884–1894 Harris AN, Macdonald PM (2001) Aubergine encodes a Drosophila polar granule component required for pole cell formation and related to eIF2C. Development 128:2823–2832 Kim TH, Yun TW, Rengaraj D, Lee SI, Lim SM, Seo HW, Park TS, Han JY (2012) Conserved functional characteristics of the PIWI family members in chicken germ cell lineage. Theriogenology 78:1948–1959 Li BC, Chen GH, Wang KH, Qian JF (2001) Study on the origin and development of the chicken embryonic gonad. China Poult 23:58–61 (in Chinese) Smith CA, Roeszler KN, Bowles J, Koopman P, Sinclair AH (2008) Onset of meiosis in the chicken embryo; evidence of a role for retinoic acid. BMC Dev Biol 8:85 Castan˜eda J, Genzor P, Bortvin A (2011) piRNAs, transposon silencing, and germline genome integrity. Mutat Res 714:95–104 Hou Y, Yuan J, Zhou X, Fu X, Cheng H, Zhou R (2012) DNA demethylation and USF regulate the meiosis-specific expression of the mouse Miwi. PLoS Genet 8:e1002716
123
