Cloning and expression analysis of a Toll-like receptor 22 (tlr22) gene from turbot, Scophthalmus maximus.

Fish & Shellfish Immunology 44 (2015) 399e409

Contents lists available at ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Short communication

Cloning and expression analysis of a Toll-like receptor 22 (tlr22) gene from turbot, Scophthalmus maximus Guo-Bin Hu a, b, *, Shou-Feng Zhang a, Xi Yang a, Da-Hai Liu c, Qiu-Ming Liu a, Shi-Cui Zhang a, b a b c

College of Marine Life Sciences, Ocean University of China, Qingdao 266003, China Institute of Evolution & Marine Biodiversity, Ocean University of China, Qingdao 266003, China First Institute of Oceanography, State Oceanic Administration of China, Qingdao 266061, China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 9 June 2014 Received in revised form 21 February 2015 Accepted 1 March 2015 Available online 11 March 2015

Toll-like receptor 22 (TLR22) exists exclusively in aquatic animals and recognizes double stranded RNA (dsRNA). In the present study, a tlr22 gene and its 50 -flanking sequence were cloned from turbot, Scophthalmus maximus, its immune responsive expression was subsequently studied in vivo. The turbot (sm)tlr22 gene spans over 5.6 kb with a structure of 4 exon-3 intron and encodes 962 amino acids. The deduced protein shows the highest sequence identity (76.7%) to Japanese flounder Tlr22 and possesses a signal peptide sequence, a leucine-rich repeat (LRR) domain composed of 27 LRR motifs, a transmembrane region and a Toll/interleukin-1 receptor (TIR) domain. Phylogenetic analysis grouped it with other teleost Tlr22s. The interferon-stimulated response element (ISRE) and signal transducer and activator of transcription (STAT) binding site important for the basal transcriptional activity of TLR3 were predicted in the 50 -flanking sequence of smtlr22 gene. Quantitative real-time PCR (qPCR) analysis demonstrated the constitutive expression of smtlr22 mRNA in all examined tissues with higher levels in the head kidney, kidney and spleen. Further, smtlr22 expression was significantly up-regulated following challenge with polyinosinic: polycytidylic acid (poly I:C), lipopolysaccharide (LPS) or turbot reddish body iridovirus (TRBIV) in the gills, head kidney, spleen and muscle, with maximum increases ranging from 2.56 to 6.24 fold upon different immunostimulants and organs. These findings suggest a possible role of Smtlr22 in the immune responses to the infections of a broad range of pathogens that include DNA and RNA viruses and Gram-negative bacteria. © 2015 Elsevier Ltd. All rights reserved.

Keywords: Scophthalmus maximus Tlr22 Structural characteristics Gene expression PAMPs

1. Introduction The innate immune system provides the host's first line of defense against invading microbial pathogens, acting before the adaptive immune system is fully functional. The pattern recognition receptors (PRRs) expressing on cellular/endosomal membrane or in cytoplasm of host cells recognize the specific conserved microbial features called pathogen-associated molecular patterns (PAMPs), such as lipopolysaccharide (LPS) and peptidoglycan (PG) from bacteria, single- and double-stranded RNA (ss-, dsRNA) from viruses, unmethylated CpG DNA found in the genomes of the both pathogens, etc [1,2]. One of important PRR classes is the Toll-like

* Corresponding author. College of Marine Life Sciences, Ocean University of China, Yushan Road, 5#, Qingdao 266003, China. Tel./fax: þ86 532 82032583. E-mail address: [email protected] (G.-B. Hu). http://dx.doi.org/10.1016/j.fsi.2015.03.001 1050-4648/© 2015 Elsevier Ltd. All rights reserved.

receptors (TLRs) that belong to the type Ⅰ transmembrane proteins and characterized by two conserved structures, an extracellular leucine-rich repeat (LRR) domain responsible for recognizing and binding PAMPs and a cytoplasmic Toll/interleukin (IL)-1 receptor (TIR) domain for downstream signaling [3,4]. To date, thirteen TLRs (TLR1-13) have been found in mammals since the first TLR, TLR4, was identified in humans in 1997 [5]. In fish, at least 18 Tlrs have been identified, including eight mammalian TLR orthologs, Tlr1-5 and Tlr7-9, and ten non-mammalian Tlrs, soluble Tlr5, Tlr14, Tlr18-23, Tlr25 and Tlr26 [6,7]. TLR-mediated signaling pathways have been well studied in mammals. They are triggered upon the binding of PAMPs to TLRs and arise from intracytoplasmic TIR domain that recruits correlative adaptor proteins and transfers stimulatory signals to the cytosol. Myeloid differentiation factor 88 (MyD88) and TIR domaincontaining adaptor inducing interferon-b (TRIF) are the two key adaptors mediating two individual TLR signaling cascades, the

400

G.-B. Hu et al. / Fish & Shellfish Immunology 44 (2015) 399e409

MyD88-dependent pathway and TRIF-dependent pathway, respectively [8,9]. Both lead to the activation of nuclear factor kappa B (NF-kB) and mitogen-activated protein kinase (MAPK), thereby stimulate expression of proinflammatory cytokines and interferons (IFNs) that eventually result in the clearance of microbial infection from hosts. The signaling pathways mediated by fish Tlrs are studied less, but considered to be similar to those by their mammalian orthologs [6,10,11]. Tlr22 is an important member of the TLRs that is found exclusively in aquatic animals [12,13]. To date, it has been cloned and studied in a number of fish species, including goldfish [14], zebrafish [15], Japanese flounder [16], rainbow trout [17], fugu [18], large yellow croaker [19], grass carp [20,21], orange-spotted grouper [8], Atlantic cod [22], channel catfish [7], rohhu [23], catla [24] and gilthead seabream [25]. In rainbow trout [17] and Atlantic salmon (GenBank accession numbers: AM233509, FM206383 and BT045774), two and three copies of tlr22 gene were found, respectively, and in Atlantic cod [22], it is highly expanded, up to twelve copies (tlr22a～l). Synteny analysis revealed that Atlantic cod tlr22b is an equivalent of the tlr22 found as a single copy in other teleosts [22]. The expression of tlr22 was up-regulated by various PAMPs, such as LPS, PG, long (greater than 1000 bp) dsRNA and polyinosinic: polycytidylic acid (poly I:C) [8,16,18,19,21,23,25,26]. Studies in mammals have shown that most TLR members utilize the MyD88-dependent pathway, while TLR3 and TLR4 utilize the TRIF-dependent pathway [27]. In contrast, Tlr22 employs both MyD88-and TRIF-dependent pathways to trigger anti-pathogen responses [8,18]. The Tlr22 signaling stimulates expression of interferon regulatory factor (IRF) 3 and tumor necrosis factor-a, two cytokines reported to induce an IFN output or phagocytosis and, thus, activates host innate immunologic surveillance to eliminate pathogen infection [8,18,28,29]. Turbot, Scophthalmus maximus, is an important marine fish species cultured widely in the world and vulnerable to infection of various microbial pathogens. Since Tlr22 plays an important role in host's anti-pathogen responses, its study in turbot will be beneficial to the development of strategies of disease control for this commercially important species. Here, we report the structure, mRNA tissue distribution and gene expression of turbot (Sm) tlr22. The gene expression study was performed by stimulation of turbots with poly I:C, a known IFN-inducer, LPS, a major component of cellular wall of Gram-negative bacteria, or turbot reddish body iridovirus (TRBIV), a DNA virus prevailing in farmed turbots in China [30]. 2. Materials and methods 2.1. Fish and challenge experiments Turbot (S. maximus) juveniles (68.4 ± 4.5 g, n ¼ 170) were purchased from a local mariculture farm and acclimatized in aerated seawater tanks at 16 C for one week before use. TRBIV was isolated from cultured turbots with TRBIV disease as previously described [31]. The viral titers were measured by a 50% tissue culture infective dose (TCID50) assay according to the method of Reed and Muench [32]. Three groups of turbots were injected intraperitoneally (i.p.) with poly I:C (Sigma, St Louis, MO, USA) (10 mg/ml, 100 ul per fish), LPS (L2880, Escherichia coli 055:B5, Sigma) (2.5 mg/ml, 112 ul per fish) and TRBIV (2 106 TCID50/ml, 120 ul per fish), respectively. Control fish were i.p. injected with sterilized phosphate-buffered saline (PBS, pH 7.4) with a volume same to the corresponding treatment. The gills, head kidney, spleen and muscle were collected at different time points post-injection for gene expression assay, while the untreated healthy fish were used for tissue distribution analysis.

2.2. Extraction of RNA and genomic DNA Total RNA was extracted from different organs of healthy turbots using an Isogen reagent (Nippon Gene, Tokyo, Japan) according to the manufacturer's instructions. RNA samples were treated with RNase-free DNase Ⅰ to remove genomic DNA contamination using the Turbo DNA-free Kit (Ambion, Austin, TX, USA). The RNA concentration was determined by measuring the absorbance at 260 nm, and its quality was monitored by A260nm/A280nm ratios >1.8. The genomic DNA was extracted from the muscle by a standard phenol/chloroform extraction procedure [33]. 2.3. Cloning of smtlr22 gene and promoter From 1 mg of total RNA extracted from the spleen of a turbot, a double strand cDNA pool was synthesized using an SMART cDNA Library Construction Kit (Clontech, Palo Alto, CA, USA). Primers were designed based on Japanese flounder Tlr22 sequence and used to amplify smtlr22 from the cDNA pool. A 2493-bp fragment was obtained and identified as a partial cDNA sequence of smtlr22 by a BLAST search of GenBank database. The 30 -end fragment was obtained by a rapid amplification of cDNA ends (RACE) method. Subsequently, a partial genomic sequence corresponding to the known cDNAs was obtained by a routine PCR procedure and a second genomic fragment of 1479 bp covering the 50 -end and 50 flanking region of the gene was obtained with a Genome Walking Kit (TaKaRa, Dalian, Liaoning, China). The transcription start site (TSS) was predicted by the Nature Network Promoter Prediction program (http://www.fruitfly.org/seq_tools/promoter.html). The cDNA sequence harbored in the second genomic fragment was identified by a PCR amplification for the cDNA pool. The full-length cDNA and gene sequences were then compiled and used to determine the exon/intron structure by an alignment using Genetyx 7.0 software (GENETYX Corporation, Tokyo, Japan). Primers used in this group are listed in Table 1. 2.4. Sequence analysis The sequence result of smtlr22 was compared with the GenBank/EMBL database by using the BLASTX and BLASTP search programs (http://blast.genome.ad.Jp). The nucleotide sequence was

Table 1 Primer sequences used in this study. Primer name

Sequence (50 /30 )

Target gene

Application

tlr22-cF

CACTGAAGACTTGCCGAATCAG

tlr22

Core fragment cloning

tlr22-cR tlr22-30 F1

CGTCCTTCTGCTCATCAAACAG GAGGGAGAACAGGGCTGGAGATTGT

tlr22-30 F2

ACAGAGACTTCGAGCCAGGTAAACCC

tlr22-gF1

AACACTCATGACGAAGCCTGG

tlr22-gR1 tlr22-gF2

CTTGTTCGGCAGTTTCCTCA ACCCGCCAGACAATAGATTC

tlr22-gR2 tlr22-SP1

AAGTCTTCAGCGCAAATCCC CTCGAGGGAAATCAGATTGGCAAAG

tlr22-SP2 tlr22-SP3 tlr22-qF tlr22-qR 18S-F 18S-R

TTGTCTATCCCCGAAATCCTATTGCG TCACTGTTGAGGGAATATCTTGAGG ACAGAGACTTCGAGCCAGGTAAACCC CTTGTTCGGCAGTTTCCTCA CACAGTGCCCATCTATGAG CCATCTCCTGCTCGAAGTC

First round 30 -RACE PCR Nested 30 -RACE PCR Second and third intron cloning First intron cloning Genome walking PCR

qPCR 18S rRNA


401

Table 2 Accession numbers of teleost Tlrs used in this study. Protein Atlantic cod (Gadus morhua) TLR3 TLR7 TLR8-1 TLR8-2 TLR8-3 TLR9-1 TLR9-2 TLR9-3 TLR9-4 TLR9-5 TLR18 TLR21 TLR22a TLR22b TLR22c TLR22d TLR22e TLR22f TLR22g TLR22h TLR22i TLR22j TLR22k TLR22l TLR23a TLR23b Channel catfish (Ictalurus punctatus) TLR1 TLR2 TLR3 TLR4-1 TLR4-2 TLR5S TLR5-1 TLR5-2 TLR7 TLR8-1 TLR8-2 TLR9

Accession no. ENSGMOP00000000792 ENSGMOP00000001755 ENSGMOP00000001741 ENSGMOP00000001810 ENSGMOP00000012342 ENSGMOP00000003336 ENSGMOP00000003402 ENSGMOP00000003470 ENSGMOP00000012018 ENSGMOP00000012030 ENSGMOP00000004019 AFK76484 AFK76485 AFK76486 AFK76487 AFK76488 AFK76489 AFK76490 AFK76491 AFK76492 AFK76493 AFK76494 AFK76495 AFK76496 AFK76497 AFK76498 AEI59662 AEI59663 AEI59664 AEI59665 AEI59666 AEI59667 AEI59668 AEI59669 AEI59670 AEI59671 AEI59672 AEI59673

Protein

Accession no.

Protein

TLR18 TLR19 TLR20-1 TLR20-2 TLR21 TLR22 TLR25 TLR26 Fugu (Takifugu rubripes) TLR1 TLR2 TLR3 TLR5 TLR5S TLR7 TLR8 TLR9 TLR14 TLR21 TLR22 TLR23 Zebrafish (Danio rerio) TLR1 TLR2 TLR3 TLR4a TLR4b-a TLR4b-b TLR5a TLR5b TLR7 TLR8a TLR8b TLR9 TLR18 TLR19 TLR20a TLR20f TLR21 TLR22

AEI59674 AEI59675 AEI59676 AEI59677 AEI59678 AEI59679 AEI59680 AEI59681

Turbot (Scophthalmus maximus) TLR3 TLR22 Atlantic salmon (Salmo salar) TLR22a1 TLR22a2 TLR22b Catla (Catla catla) TLR22 Common carp (Cyprinus carpio) TLR22 Gilthead seabream (Sparus aurata) TLR22 Goldfish (Carassius auratus) TLR22 Grass carp (Ctenopharyngodon idella) TLR22 Japanese flounder (Paralichthys olivaceus) TLR22 Large yellow croaker (Larimichthys crocea) TLR22 Mandarin fish (Siniperca chuatsi) TLR22 Medaka (Oryzias latipes) TLR22 Nile tilapia (Oreochromis niloticus) TLR22 Rainbow trout (Oncorhynchus mykiss) TLR22a1 TLR22a2 Rohu (Labeo rohita) TLR22 Stickleback (Gasterosteus aculeatus) TLR22 Tetraodon (Tetraodon nigroviridis) TLR22

AAW69368 AAW69370 AAW69373 AAW69374 AAW69378 AAW69375 AAW69376 AAW69377 AAW69369 NP_001027751 AAW69372 AAW70378 NP_001124065 NP_997977 NP_001013287 XP_001919699 NP_001124523 NP_997978 XP_001919052 NP_001124067 XP_002665957 XP_001920594 XP_003199440 NP_001124066 NP_001082819 XP_002664892 AAI63785 XP_003199280 NP_001186264 NP_001122147

Accession no. AHW76803 KJ606344 CAJ80696 CAR62394 ACI34036 AGW43269 ADR66025 CDK37745 AAO19474 ADX97523 BAD01045 ADK77870 AFC95889 ENSORLP00000025294 AHK13950 CAF31506 CAI48084 AGW43270 ENSGACP00000007198 ENSTNIP00000016626

translated into protein sequence using the ExPASy Translate Tool (http://www.expasy.org/tools/dna.html). The signal peptide sequence was predicted by SignalP 4.1 server (http://www.cbs.dtu. dk/services/SignalP). The LRRs were identified according to the method described by Matsushima et al. [34]. The TM region and TIR domains were predicted by the Simple Modular Architecture Reach Tool (SMART) (http://smart.embl-heidelberg.de/). The multiple alignment of protein sequences was generated by the Clustal W program (http://www.ddbj.nig.ac.jp/E-mail/clustalw-e.html). The phylogenetic tree was depicted on the overall protein sequences using the unweighted pair group method of arithmetic means (UPGMA) method within MEGA version 5.0. The transcription factor binding sites in the 50 -flanking region were predicted by the TFSEARCH ver1.3 (http://www.cbrc.jp/research/db/TFSEARCH. html) and the AliBaba ver2.1 (http://www.gene-regulation.com/ pub/programs/alibaba2/index.html) programs with default parameters.

USA). Primer pair tlr22-qF/tlr22-qR (Table 1), with one of them designed to span the exon-intron junction, was used for amplification of smtlr22. qPCR was conducted in 20 ml volume containing 1 SYBR Green Real time PCR Mast Mix (Toyobo, Osaka, Japan), 0.2 mM each of specific forward and reverse primers and 1.0 ml diluted cDNA (50 ng/ml) in an ABI Prism 7900HT Sequence Detection System (PE Applied Biosystems, Foster City, CA). PCR conditions were 94 C for 4 min, followed by 40 cycles of 94 C for 30 s, 55 C for 30 s, 72 C for 30 s. Turbot 18S rRNA (GenBank accession no.: EF126038) was used as an internal control. All samples were amplified in triplicates. Fluorescent detection was performed after each extension step. A dissociation protocol was performed after thermocycling to verify that a single amplicon of expected size was amplified. Expression levels of smtlr22 were normalized to 18S rRNA, and further expressed as fold change relative to the expression level in control according to the 2DDCT method [35] in the gene expression assay.

2.5. Quantitative real-time polymerase chain reaction (qPCR)

2.6. Statistical analysis

qPCR analysis was employed to investigate smtlr22 mRNA tissue distribution and immune responsive expression in specific organs. 1.0 mg of total RNA from each tissue (5 individuals for each time point) was reverse-transcribed into cDNA by random primers using Superscript First Strand Synthesis System (Invitrogen, Carlsbad, CA,

Statistical analysis was performed using SPSS13.0 software (SPSS Inc., Chicago, IL, USA). Differences in the data were compared by one-way analysis of variance (ANOVA) followed by Duncan's post hoc test for multiple comparisons. Differences were considered significant at P < 0.05.

402


Fig. 1. A. smtlr22 gene and its 5′-flanking region. Exons are shown in uppercase, while 50 -flanking sequence and introns in lowercase. The deduced amino acid sequences are shown by single letter code of amino acids below the CDS. A bent arrow indicates the transcriptional start site. TATA-like and CCAAT-like boxes are indicated in frames. The putative transcription factor binding sites are shown with bars. The predicted signal peptide (residues 1e39) is shown with a bold underline. The 27 LRRs and two flanking LRRNT and LRRCT modules in the extracellular LRR domain (residues 40e751) are highlighted with gray underlay. The conserved cysteines in the N and C termini of the LRR domain are shown with square boxes. The transmembrane (TM) region (residues 752e774) is shown with a dashed underline. The TIR domain (residues 802e945) is boxed, in which three conserved motifs are noted with gray underlay. Two polyadenylation signals (AATAAA, ATTAAA) are underlined with wavy lines, while five mRNA instability signals (ATTTA) with bold lines. B. Schematic representation of Smtlr22 domains. The LRRs are predicted by the method described by Matsushima et al. (2007), while the TM region and TIR domains by the SMART program.


403

Fig. 1. (continued).

3. Results

zebrafish and channel catfish, respectively, and 51.0% to Atlantic cod Tlr22b.

3.1. Molecular characterization of Smtlr22 3.2. Phylogenetic analysis of Tlrs in fish species The full-length cDNA of smtlr22 (GenBank accession no.: KJ606344) is 4183 bp, containing a 260-bp 50 -untranslated region (UTR), a 2889-bp coding region and a 1034-bp 30 -UTR. Two polyadenylation signals (AATAAA and ATTAAA) and five mRNA instability signals (ATTTA) were found in the 30 -UTR (Fig. 1A). The putative protein consists of 962 amino acids (aa) and possesses a signal peptide (residues 1e39), an extracellular LRR domain architecture (residues 40e751), a transmembrane region (residues 752e774) and a cytoplasmic TIR domain (residues 802e945) (Fig. 1A, B). The LRR domain architecture is made up of 27 LRR motifs, flanked by a LRRNT (LRR N-terminal) module and a LRRCT (LRR C-terminal) module in the N and C termini where two and four conserved cysteines were found, respectively (Figs. 1 and 2). The TIR domain harbors three conserved boxes, i.e., box1 (YDAFISY), box 2 (LC-RD-PG), and box3 (a conserved W surrounded by basic residues) (Fig. 2). The homology search showed that Smtlr22 shares an identity of 76.7%, 65.9%, 59.0%, 40.5% and 40.0% to the Tlr22 sequences from Japanese flounder, large yellow croaker, fugu,

To reveal the evolutionary relationships between Smtlr22 and other teleost Tlrs, an unrooted phylogenetic tree was constructed using 96 Tlr protein sequences covering the Tlr repertoires of Atlantic cod, channel catfish, fugu and zebrafish and the Tlr22s so far known from other teleosts (Fig. 3). As shown in the tree, teleost Tlrs were organized in six major families: TLR1, TLR3, TLR4, TLR5, TLR7 and TLR11; all teleost Tlr22 members were clustered into an independent clade in the TLR11 family that also includes other two aquatic animal specific Tlr clades, Tlr21 and Tlr23, and a comprehensive clade of Tlr19, Tlr20 and Tlr26. The Tlr22 subfamily consists of four distinct groups, ostariophysi (cyprinidae and ictaluridae), protacanthopterygii (salmonidae), paracanthopterygii (gadidae) and acanthopterygii (adrianichthyidae, gasterosteidae, perciformes, tetraodontidae and pleuronectiformes) Tlr22s. The Smtlr22 is located in the acanthopterygii group with the closest phylogenetic distance to the Tlr22 from another pleuronectiformes fish, Japanese flounder, followed by those from perciformes and

404


Fig. 2. Multiple alignment of Smtlr22 amino acid sequence with Tlr22 proteins from other teleosts. The signal peptide, 27 LRR motifs along with a LRRNT and a LRRCT, TM region and TIR domain are shown by overbars. The cysteine clusters in the LRRNT and LRRCT cysteine motifs are shaded in gray. The three active motifs, box1, box2 and box3, in the TIR domain are boxed. The accession numbers of the sequences are shown in Table 2.


405

tetraodonae species, and a far phylogenetic distance to those from cyprinidae species in the ostariophysi group. 3.3. Genomic structure of smtlr22 The smtlr22 gene (GenBank accession no.: KJ606345) is 5672 bp in length and comprises 4 exons and 3 introns with an intron in the 50 -UTR. The four exons are 174-, 2613-, 118- and 1247-bp long, respectively (Fig. 4A). All exon/intron junctions conform to the consensus ‘GT/AG’ rule [36]. The genomic organization of smtlr22 is same with that of Japanese flounder tlr22 and those in other percomorpha fishes (two pufferfishes, large yellow croaker, Nile tilapia and stickleback) in coding sequence (CDS) (Fig. 4A). The tlr22 CDS are also interrupted in another acanthopterygii fish medaka as well as in paracanthopterygii (Atlantic cod) (Fig. 4B and C), but intronless in basal teleosts, protacanthopterygii (Atlantic salmon) and ostariophysi (channel catfish, grass carp, rohu and catla) (Fig. 4D). The four Atlantic cod tlr22 paralogues with full-length sequence available are different in exon/intron structure from each other, out of which the tlr22d has an genomic organization same with smtlr22 in the CDS (Fig. 4C). 3.4. Features of 50 -flanking region of smtlr22 gene An 858-bp 50 -flanking region (from 858 to 1) was simultaneously obtained in the process of cloning 50 -terminal fragment of smtlr22 gene by genome walking. The predicted transcription start site (TSS) situates 410-bpupstream of the start codon ATG. smtlr22 promoter lacks canonical TATA and CCAATboxes within 100 bp of the TSS, but has a variant TATA box (TTAAA) at positions 32 to 27 and two CCAAT-like motifs (one of which inverted) at 101 to 96 and 71 to 67, respectively. The transcription factor binding sites for GC box/specificity protein 1 (Sp1),signal transducer and activator of transcription (STAT), IRF1, p300, NF-kB and activator protein 1 (AP1) and an interferon stimulated response element (ISRE) could be predicted in the promoter using the TFSEARCH ver1.3 and the AliBaba ver2.1 programs with default parameters (Fig. 1A). 3.5. Tissue distribution of smtlr22 mRNA The tissue distribution of smtlr22 mRNA was analyzed by qPCR in twelve organs, brain, gills, stomach, intestine, heart, head kidney, kidney, liver, spleen, gonad, muscle and skin, of healthy turbots (Fig. 5). The constitutive expression of smtlr22 was observed in all tissues examined. Higher levels were detected in the immune organs including the head kidney, kidney and spleen. Moderate levels were observed in the digestion organs, heart, brain, liver and muscle. Low levels were observed in the gills, gonad and skin. 3.6. Gene expression of smtlr22 upon poly I:C, LPS and TRBIV challenges

Fig. 3. Phylogenetic tree illustrating the relationship between Smtlr22 and other teleost Tlrs. The tree was depicted on the overall sequences by UPGMA method with MEGA 5.0 software. The Smtlr22 (turbot Tlr22) is highlighted with gray underlay. The accession numbers of the Tlr sequences are presented in Table 2.

The gene expression of smtlr22 in response to poly I:C, LPS or TRBIV challenge was studied by qPCR in a 5-day time course in the gills, head kidney, spleen and muscle. Upon poly I:C challenge, the expression peak of smtlr22 arose at hour 6 post-injection in the gills, head kidney and spleen and day 1 in the muscle, with an approximate 2.68-, 5.53-, 3.72- and 5.71-fold increase, respectively (Fig. 6). Upon challenge with LPS, the maximum induction levels of smtlr22 were 2.83-, 2.63-, 3.30- and 2.56-fold and arose at hour 6, 6, 6 and day 1 post-injection in the gills, head kidney, spleen and muscle, respectively (Fig. 6). In TRBIV challenge case, smtlr22 expression was also up-regulated, with a maximum increase of 2.68-, 3.08- and 6.24- fold arising all at day 1 in the gills, head

406


Fig. 4. Comparison of genomic organization of tlr22 genes in species of percomorpa (A), atherinomorpha/adrianichthyidae (B), paracanthopterygii (C) and protacanthopterygii and ostariophysi (D). Exons are indicated with boxes (untranslated regions with white boxes) and introns with horizontal lines. The numbers showing the length of exons and introns are marked above and below the corresponding elements, respectively. GenBank accession numbers or references: turbot, KJ606345; Japanese flounder, AB109396; large yellow croaker, GU576983/Xiao et al., 2011; fugu, AC156434; tetraodon, ENSTNIG00000013627; stickleback, ENSGACG00000005449; Nile tilapia, KJ010825; medaka, ENSORLG00000020413; Atlantic cod-b/d/g/i, Sundaram et al., 2012; Atlantic salmon-a1/a2, AM233509/FM206383; channel catfish, HQ677725; grass carp, Su et al., 2012; rohu, Panda et al., 2014; catla, Panda et al., 2014.

kidney and muscle, respectively, and 3.12-fold arising at hour 6 in the spleen (Fig. 7). 4. Discussion In the present study, we report the structure and expression profile of a Tlr22 homologue from turbot (Smtlr22). The full-length

smtlr22 cDNA comprises a 2889-bp open reading frame (ORF) that encodes a 962-aa protein. Five mRNA instability motifs (ATTTA) were found in the 1034-bp 30 -UTR (Fig. 1A), suggesting that smtlr22 may be transiently expressed. The putative protein possesses the four typical structures of the TLR families, a signal peptide, an extracellular LRR domain, a transmembrane region and an intracellular TIR domain (Fig. 1A and B). The LRR domain, responsible for


407

Fig. 5. qPCR analysis of smtlr22 expression in various tissues of healthy turbots. The values are expressed as relative value to the 18S rRNA levels. Values are means ± standard error (S.E.), n ¼ 5. Values marked by different letters are significantly different from each other.

binding to specific PAMPs, comprises 27 LRRs in Tlr22 and shows a characteristic horseshoe-shape structure [7,22,23,26]. The canonical consensus of LRR motif is LxxLxLxxN(Cx)xL, but it is flexible as more and more LRR sequences available in an expanding range of species [34]. Further, studies have demonstrated positive selection at some sites within LRR motifs of Tlr22s from zebrafish and Atlantic cod [22,26]. This suggests adaptation of the response of Tlr22s to evolving pathogens and may contribute to their functional diversification. The study by Matsushima et al. [34] revealed a universal conservation of LRR numbers in each TLR type across vertebrates. Our study also showed that Smtlr22 shares a same number of LRR like structures as all other fishes (Fig. 2). This finding suggests that the LRR number has an important impact on the way of ligand binding to TLRs that is probably hardly affected by species. In human TLR3, the LRR12 and LRR20 have been identified as ligand-binding sites [37]. Study demonstrated that the LRR11 and LRR22 in Tlr22 are equal to human LRR12 and LRR20, respectively [22], thus these two LRRs in Smtlr22 may be involved in the recognition and binding of PAMPs. Flanking the LRRs in Smtlr22 are the LRRNT and LRRCT modules in the N and C termini, each containing a cysteine cluster that is in line with the characteristic LRRNT and LRRCT cysteine motifs of teleost Tlr22, Cx8-16C and CxCx24Cx18C, respectively. The cysteine residues form disulfide bridges within modules that stabilize the TLR proteins by capping the otherwise exposed hydrophobic core at the end of LRR superhelices [38,39]. Noteworthily, the LRRNT module of Tlr22 is variable among fishes, whereas the LRRCT module is completely conserved which is known to play a crucial role in TLR signaling [22]. The TIR domain, comprised of three active motifs, box 1, box2, and box 3, is highly conserved across species (Fig. 2) and functionally critical for TLR signaling. It has been proved that the first two boxes are involved in the coupling of receptor molecules, while the box 3 is related to the localization of receptors [8,40]. Taken together, the structural features Smtlr22 exhibits indicate that the cloned molecule here is a functional homologue of Tlr22 in turbot. The phylogenetic analysis clustered Smtlr22 into the acanthopterygii Tlr22 group within the Tlr22 subfamily, with a phylogenetic distance closest to Tlr22 from its close relative, Japanese flounder, followed by perciformes and tetraodonae species, and less close to Tlr22s from gasterosteidae and adrianichthyidae. A farther distance was seen to Tlr22s from paracanthopterygii and protacanthopterygii and the farthest distance to ostariophysi. This result matches well the evolutionary relationship among various teleosts, but not in agreement with the view that the hierarchy of Tlr22 in telesots depends on habitats (marine- and freshwater) [24] since Tlr22s from three freshwater fishes mandarin fish, Nile tilapia and medaka were also encompassed in the acanthopterygii group (Fig. 3).

Fig. 6. qPCR analysis of smtlr22 expression profile in turbots challenged with 1.0 mg poly I:C or 0.28 mg LPS per fish during a 5-day time course. AeD show fold changes of smtlr22 expression in the gills, head kidney, spleen and muscle, respectively. Each data point is expressed as the mean of five replicates ± standard error. (S.E.). The level of significance of the comparison to the control is indicated by *P ＜ 0.05 and **P ＜ 0.01.

The smtlr22 gene consists of four exons and three introns, with the intron 1 locating in the 50 -UTR. Such an exon/intron organization is also observed for Japanese flounder tlr22. In deed, the genomic structure of tlr22 CDS is extremely conserved in all examined percomorpha fishes, i.e., turbot, Japanese flounder, fugu, tetraodon, large yellow croaker, Nile tilapia and stickleback, as a 3 exon-2 intron structure, with the size of each extron being comparable, is observed for it among these species (Fig. 4A). The tlr22s in medaka and Atlantic cod are also interrupted (Fig. 4B and C).

408


Fig. 7. qPCR analysis of smtlr22 expression profile in turbots challenged with 2.4 £ 105 TCID50 per fish during a 5-day time course. AeD show fold changes of smtlr22 expression in the gills, head kidney, spleen and muscle, respectively. Each data point is expressed as the mean of five replicates ± standard error. (S.E.). The level of significance of the comparison to the control is indicated by *P ＜ 0.05 and **P ＜ 0.01.

Thus, the acanthopterygii and paracanthopterygii fishes possess split tlr22 gene, whereas protacanthopterygii fish Atlantic salmon and ostariophysi fishes channel catfish, grass carp, rohu and catla possess intronless tlr22 gene (CDS) (Fig. 4D). The appearance of the introns exclusively in higher teleosts (neoteleostei) suggests that the ancestral tlr22 is intronless and acquired them with the emergence of neoteleosts about 190 ～ 170 m years ago. Atlantic cod tlr22 expanded to twelve paralogues through tandem duplications with diversified characteristics including gene structures, perhaps

to compensate for the absence of other cell surface Tlrs, but also perhaps represents a transitional case during evolution of the gene structure. The diversity of tlr22 gene structure always puzzles researchers. Our finding indicates that its change quite conforms to a rule that reflects the evolutionary relationship among teleost species. Online software analysis showed that the 50 -flanking sequence of smtlr22 gene has an ISRE element and numerous STAT, IRF1, AP1, NF-kB and p300 binding sites (Fig. 1A). The necessary of ISRE element and STAT binding site for the basal promoter activity has been proved in murine and human TLR3s [41]. These two elements predicted here may suggest their involvement in the basal transcriptional activity of smtlr22 gene. Constitutive expression of smtlr22 mRNA was detectable in all tested tissues, but the levels obviously varied among different tissues. The higher levels were observed in the immune organs and low levels in the gills, gonad and skin (Fig. 5). Such a tissue expression pattern is similar to the reports for channel catfish, Japanese flounder, rainbow trout and large yellow croaker tlr22s which were highly expressed in immune-related tissues such as head kidney, spleen and PBLs [7,16,17,19]. However, it was reported that the tlr22 transcripts were mainly expressed in liver, digestive organ and gonads in fugu [42] and most strongly in gills and weakly in spleen in grass carp [21]. These results suggest that the tissue expression pattern of tlr22 is different among fish species. Previous studies have demonstrated that fish tlr22 was modulated at transcriptional level by various PAMPs such as poly I:C and those from RNA viruses and Gram-negative and -positive bacteria [8,16e21,26]. In this study, we investigated whether smtlr22 mRNA levels were modulated by poly I:C, LPS or TRBIV treatments. We selected the gills, head kidney and spleen to perform the study due to their immune importance; we also performed the study in the muscle in order to determine whether smtlr22 expression was altered in this non-immune organ. The data showed that the mRNA levels of smtlr22 was up-regulated by all three stimulants, with the induction by poly I:C and LPS more rapid than by TRBIV in the four tested organs (Figs. 6 and 7). LPS treatment caused an induced expression kinetics of smtlr22 similar to poly I:C, but exhibited a lower magnitude of induction. TRBIV also showed a weaker induction ability than poly I:C. Poly I:C and LPS are two known tlr22 inducers [8,14e16,18,19,21]. The rapid induction of smtlr22 by poly I:C and LPS indicate that they each directly triggered host's immune responses as a highly concentrated pure PAMP. In contrast, TRBIV is an enveloped dsDNA virus with multiple PAMP types. Therefore, it is not strange that TRBIV has a different induction kinetics. Although the unmethylated CpG genomic DNA, recognized by TLR9, is a major PAMP type from TRBIV [43], it can generate dsRNA intermediates from the long viral mRNAs during replication. Further, aquatic animal-specific Tlrs were reported to respond to a wide variety of PAMPs even including those from parasites [11,24]. Therefore, one of viral envelope or capsid components might serve as a ligand for Smtlr22. In short, TRBIV possibly carries a PAMP type capable of triggering the Tlr22 signaling. Considering that Tlr22 is a cell-surface PRR [18], the latter possibility is more likely. Since Tlr22 shows a similar function as well as action mode with TLR3 [18,44], they may sense a similar range of PAMPs. Intriguingly, another study by our team has demonstrated an induction of turbot Tlr3 by TRBIV [45], supporting the smltr22-inducing capacity of this virus. In addition, the up-regulation could be mediated independently of Smtlr22 activation, i.e., a PAMP for one TLR can modulate the expression of other TLRs as confirmed by Sepulcre et al. [46]. The up-regulation of smltr22 was also detected in the muscle in all three challenge cases, revealing a role for Smtlr22 in non-immune tissues. Collectively, our findings provide a possibility that Smtlr22 plays an important role in the immune responses of turbots to the


infections of a broad range of pathogens including DNA and RNA viruses and Gram-negative bacteria. Acknowledgements Great thanks should be given to Ms. Jing-Yun Lin in our lab for her assistance during this study. This work was supported by grants from the National Basic Research Program of China (2012CB114404), National Natural Science Foundation of China (30671604), Fundamental Research Funds for the Central Universities (201362024), Program for New Century Excellent Talents in University of Ministry of Education of China (NCET-11-0467) and Shandong Provincial Natural Science Foundation (ZR2013CM045). References [1] R. Medzhitov, Toll-like receptors and innate immunity, Nat Rev Immunol 1 (2001) 135e145. [2] S. Subramaniam, C. Stansberg, C. Cunningham, The interleukin 1 receptor family, Dev Comp Immunol 28 (2004) 415e428. [3] S. Akira, S. Uematsu, O. Takeuchi, Pathogen recognition and innate immunity, Cell 124 (2006) 783e801. [4] H. Hacker, V. Redecke, B. Blagoev, I. Kratchmarova, L.C. Hsu, G.G. Wang, et al., Specificity in Toll-like receptor signalling through distinct effector functions of TRAF3 and TRAF6, Nature 439 (2006) 204e207. [5] S. Akira, K. Takeda, Toll-like receptor signaling, Nat Rev Immunol 4 (2004) 499e511. [6] Y. Palti, Toll-like receptors in bony fish: from genomics to function, Dev Comp Immunol 35 (2011) 1263e1272. n, Comprehensive survey and genomic [7] S.M.A. Quiniou, P. Boudinot, E. Bengte characterization of Toll-like receptors (TLRs) in channel catfish, Ictalurus punctatus: identification of novel fish TLRs, Immunogenetics 65 (2013) 511e530. [8] X. Ding, D.Q. Lu, Q.H. Hou, S.S. Li, X.C. Liu, Y. Zhang, et al., Orange-spotted grouper (Epinephelus coioides) toll-like receptor 22: molecular characterization, expression pattern and pertinent signaling pathways, Fish Shellfish Immunol 33 (2012) 494e503. [9] K.A. Fitzgerald, E.M. Palsson-McDermott, A.G. Bowie, C.A. Jefferies, A.S. Mansell, G. Brady, et al., Mal (MyD88-adapter-like) is required for Toll-like receptor-4 signal transduction, Nature 413 (2001) 78e83. [10] M.K. Purcell, K.D. Smith, L. Hood, J.R. Winton, J.C. Roach, Conservation of Tolllike receptor signaling pathways in teleost fish, Comp Biochem Physiol Part D Genomics Proteomics 1 (2006) 77e88. [11] A. Rebl, T. Goldammer, H.M. Seyfert, Toll-like receptor signaling in bony fish, Vet Immunol Immunopathol 134 (2010) 139e150. [12] J.C. Roach, G. Glusman, L. Rowen, A. Kaur, M.K. Purcell, K.D. Smith, et al., The evolution of vertebrate Toll-like receptors, Proc Natl Acad Sci U S A 102 (2005) 9577e9582. [13] T. Aoki, T. Takano, M.D. Santos, H. Kondo, I. Hirono, Molecular innate immunity in teleost fish: review and future perspectives, in: Fisheries for global welfare and environment, 5th world fisheries congress, 2008, pp. 263e276. [14] J.L. Stafford, K.K. Ellestad, K.E. Magor, M. Belosevic, B.G. Magor, A Toll-like receptor (TLR) gene that is up-regulated in activated goldfish macrophages, Dev Comp Immunol 27 (2003) 685e698. [15] C. Jault, L. Pichon, J. Chluba, Toll-like receptor gene family and TIR-domain adapters in Danio rerio, Mol Immunol 40 (2004) 759e771. [16] I. Hirono, M. Takami, M. Miyata, T. Miyazaki, H.J. Han, T. Takano, et al., Characterization of gene structure and expression of two Toll-like receptors from Japanese flounder, Paralichthys olivaceus, Immunogenetics 56 (2004) 38e46. €llner, U. Fischer, H.-M. Seyfert, Characterization of twin [17] A. Rebl, E. Siegl, B. Ko Toll-like receptors from rainbow trout (Oncorhynchus mykiss): evolutionary relationship and induced expression by Aeromonas salmonicida salmonicida, Dev Comp Immunol 31 (2007) 499e510. [18] A. Matsuo, H. Oshiumi, T. Tsujita, H. Mitani, H. Kasai, M. Yoshimizu, et al., Teleost TLR22 recognizes RNA duplex to induce IFN and protect cells from birnaviruses, J Immunol 181 (2008) 3474e3485. [19] X.Q. Xiao, Q.W. Qin, X.H. Chen, Molecular characterization of a Toll-like receptor 22 homologue in large yellow croaker (Pseudosciaena crocea) and promoter activity analysis of its 5’-flanking sequence, Fish Shellfish Immunol 30 (2011) 224e233. [20] J.J. Lv, R. Huang, H.Y. Li, D.J. Luo, L.J. Liao, Z.Y. Zhu, et al., Cloning and characterization of the grass carp (Ctenopharyngodo n idella) Toll-like receptor 22 gene, a fish-specific gene, Fish Shellfish Immunol 32 (2012) 1022e1031. [21] J. Su, J. Heng, T. Huang, L. Peng, C. Yang, Q. Li, Identification, mRNA expression and genomic structure of TLR22 and its association with GCRV susceptibility/ resistance in grass carp (Ctenopharyngodon idella), Dev Comp Immunol 36 (2012) 450e462.

409

[22] A.Y. Sundaram, V. Kiron, J. Dopazo, J.M. Fernandes, Diversification of the expanded teleost-specific toll-like receptor family in Atlantic cod, Gadus morhua, BMC Evol Biol 12 (2012) 256. [23] M. Samanta, B. Swain, M. Basu, G. Mahapatra, B.R. Sahoo, M. Paichha, et al., Toll-Like Receptor 22 in Labeo rohita: molecular cloning, characterization, 3D modeling, and expression analysis following ligands stimulation and bacterial infection, Appl Biochem Biotechnol 174 (2014) 309e327. [24] R.P. Panda, V. Chakrapani, S.K. Patra, J.N. Saha, P. Jayasankar, B. Kar, et al., First evidence of comparative responses of Toll-like receptor 22 (TLR22) to relatively resistant and susceptible Indian farmed carps to Argulus siamensis infection, Dev Comp Immunol 47 (2014) 25e35. ~ oz, M.P. Sepulcre, J. Meseguer, V. Mulero, Toll-like receptor 22 of gilt[25] I. Mun head seabream, Sparus aurata: molecular cloning, expression profiles and post-transcriptional regulation, Dev Comp Immunol 44 (2014) 173e179. [26] A.Y.M. Sundaram, S. Consuegra, V. Kiron, J.M.O. Fernandes, Positive selection pressure within teleost toll-like receptors tlr21 and tlr22 subfamilies and their response to temperature stress and microbial components in zebrafish, Mol Biol Rep 39 (2012) 8965e8975. [27] T. Takano, S.D. Hwang, H. Kondo, I. Hirono, T. Aoki, M. Sano, et al., Evidence of molecular Toll-like receptor mechanisms in teleosts, Fish Pathol 45 (2010) 1e16. [28] K.O. Kisich, M. Higgins, G. Diamond, L. Heifets, Tumor necrosis factor alpha stimulates killing of Mycobacterium tuberculosis by human neutrophils, Infect Immun 70 (2002) 4591e4599. [29] F.W. Lam, S.Y. Wu, S.J. Lin, C.C. Lin, Y.M. Chen, H.C. Wang, et al., The expression of two novel orange-spotted grouper (Epinephelus coioides) TNF genes in peripheral blood leukocytes, various organs, and fish larvae, Fish Shellfish Immunol 30 (2011) 618e629. [30] Q. Zhang, C. Shi, J. Huang, K. Jia, X. Chen, H. Liu, Rapid diagnosis of turbot reddish body iridovirus in turbot using the loop-mediated isothermal amplification method, J Virol Methods 158 (2009) 18e23. [31] C.Y. Shi, Y.G. Wang, S.L. Yang, J. Huang, Q.Y. Wang, The first report of an iridovirus-like agent infection in farmed turbot, Scophthalmus maximus, in China, Aquaculture 236 (2004) 11e25. [32] R.J. Reed, H.A. Muench, simple method of estimating fifty percent endpoints, Am J Hyg 27 (1938) 493e503. [33] S. Palumbi, R.A. Martin, S. Romano, W.O. McMillan, L. Stice, G. Grabowski, The simple fools guide to PCR, Version 2, University of Hawaii Zoology Department, Honolulu, HI, USA, 1991, p. 46. [34] N. Matsushima, T. Tanaka, P. Enkhbayar, T. Mikami, M. Taga, K. Yamada, et al., Comparative sequence analysis of leucine-rich repeats (LRRs) within vertebrate toll-like receptors, BMC Genomics 8 (2007) 124. [35] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real-time quantitative PCR and the 2-DDCT method, Methods 25 (2001) 402e408. [36] R. Breathnach, P. Chambon, Organization and expression of eukaryotic split genes coding for proteins, Annu Rev Biochem 50 (1981) 349e383. [37] J.K. Bell, I. Botos, P.R. Hall, J. Askins, J. Shiloach, D.M. Segal, et al., The molecular structure of the toll-like receptor 3 ligand-binding domain, Proc Natl Acad Sci U S A 102 (2005) 10976e10980. [38] M. Gangloff, P.L. Ludidi, N.J. Gay, Structures and motifs involved in Toll signaling, in: T. Rich (Ed.), Toll and toll-like receptors: an immunologic perspective, Landes Biosciences/Kluwer Academic/Plenum, Georgetown, 2005, pp. 56e75. [39] N. Matsushima, H. Miyashita, T. Mikami, Y. Kuroki, A nested leucine rich repeat (LRR) domain: the precursor of LRRs is a ten or eleven residue motif, BMC Microbiol 10 (2010) 235. [40] J.L. Slack, K. Schooley, T.P. Bonnert, J.L. Mitcham, E.E. Qwarnstrom, J.E. Sims, et al., Identification of two major sites in the type Ⅰ interleukin-1 receptor cytoplasmic region responsible for coupling to pro-inflammatory signaling pathways, J Biol Chem 275 (2000) 4670e4678. [41] S. Heinz, V. Haehnel, M. Karaghiosoff, L. Schwarzfischer, M. Müller, S.W. Krause, et al., Species-specific regulation of Toll-like receptor 3 genes in men and mice, J Biol Chem 278 (2003) 21502e21509. [42] H. Oshiumi, T. Tsujita, K. Shida, M. Matsumoto, K. Ikeo, T. Seya, Prediction of the prototype of the human Toll-like receptor gene family from the pufferfish, Fugu rubripes, genome, Immunogenetics 54 (2003) 791e800. [43] W.X. He, Q. Yu, Z.Y. Zhou, P. Wang, CpG oligonucleotides induce an immune response of odontoblasts through the TLR9, MyD88 and NF-kB pathways, Biochem Biophys Res Commun 399 (2010) 274e278. [44] T. Seya, M. Matsumoto, T. Ebihara, H. Oshiumi, Functional evolution of the TICAM 1 pathway for extrinsic RNA sensing, Immunol Rev 227 (2009) 44e53. [45] G.B. Hu, X.P. Li, D.H. Liu, Q.M. Liu, S.C. Zhang, A Toll-like receptor 3 homolog that is up-regulated by poly I: C and DNA virus in turbot, Scophthalmus maximus, J Fish Biol (2015), http://dx.doi.org/10.1111/jfb.12559 [Epub ahead of print]. pez-Castejo n, J. Meseguer, V. Mulero, The activation of [46] M. Sepulcre, G. Lo gilthead seabream professional phagocytes by different PAMPs underlines the behavioural diversity of the main innate immune cells of bony fish, Mol Immunol 44 (2007) 2009e2016.

Molecular cloning, characterization, and expression analysis of luteinizing hormone receptor gene in turbot (Scophthalmus maximus).

Differential gene expression and SNP association between fast- and slow-growing turbot (Scophthalmus maximus).

Molecular characterization of the cathepsin B of turbot (Scophthalmus maximus).

Regional environmental pressure influences population differentiation in turbot (Scophthalmus maximus).

Molecular cloning and expression studies of the adapter molecule myeloid differentiation factor 88 (MyD88) in turbot (Scophthalmus maximus).

Molecular characterization and quantification of the follicle-stimulating hormone receptor in turbot (Scophthalmus maximus).

The shelf life of farmed turbot (Scophthalmus maximus).

RNA-seq analysis reveals significant transcriptome changes in turbot (Scophthalmus maximus) suffering severe enteromyxosis.

Biochemical composition and quality of turbot (Scophthalmus maximus) eggs throughout the reproductive season.

Draft Genome Sequence of Edwardsiellapiscicida Strain ACC35.1 Isolated from Diseased Turbot (Scophthalmus maximus) in Europe.

Effects of Enteromyxum scophthalmi experimental infection on the neuroendocrine system of turbot, Scophthalmus maximus (L.).

Immunolocalization of tumor necrosis factor alpha in turbot (Scophthalmus maximus, L.) tissues.

A toll-like receptor 3 homologue that is up-regulated by poly I:C and DNA virus in turbot Scophthalmus maximus.

A sex-associated sequence identified by RAPD screening in gynogenetic individuals of turbot (Scophthalmus maximus).

A genome scan for candidate genes involved in the adaptation of turbot (Scophthalmus maximus).

Trophic transfer of (110m)Ag in the turbot Scophthalmus maximus through natural prey and compounded feed.

Fine mapping and evolution of the major sex determining region in turbot (Scophthalmus maximus).

Studies on the nutrition of marine flatfish. The thiamin requirement of turbot (Scophthalmus maximus).

Turbot (Scophthalmus maximus) vs. VHSV (Viral Hemorrhagic Septicemia Virus): A Review.

Electrophysiological and behavioural responses of turbot (Scophthalmus maximus) cooled in ice water.

The physiological performance and immune response of juvenile turbot (Scophthalmus maximus) to nitrite exposure.

Increased survival of juvenile turbot Scophthalmus maximus by using bacteria associated with cultured oysters.

Effects of dietary glucose and dextrin on activity and gene expression of glucokinase and fructose-1,6-bisphosphatase in liver of turbot Scophthalmus maximus.

Tissue Localization of Lymphocystis Disease Virus (LCDV) Receptor-27.8 kDa and Its Expression Kinetics Induced by the Viral Infection in Turbot (Scophthalmus maximus).