Fish & Shellfish Immunology 44 (2015) 525e532
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Short communication
Cloning and characterization of three suppressors of cytokine signaling (SOCS) genes from the Pacific oyster, Crassostrea gigas Jun Li a, Yang Zhang a, Yuehuan Zhang a, Ying Liu a, b, Zhiming Xiang a, Fufa Qu a, b, Ziniu Yu a, * a
Key Laboratory of Tropical Marine Bio-Resources and Ecology, South China Sea Institute of Oceanology, Chinese Academy of Sciences, 164 West Xingang Road, Guangzhou 510301, China University of Chinese Academy of Sciences, 19A Yuquan Road, Beijing 100049, China
b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 8 January 2015 Received in revised form 8 March 2015 Accepted 13 March 2015 Available online 21 March 2015
Members of the suppressor of cytokine signaling (SOCS) family are crucial for the control of a variety of signal transduction pathways that are involved in the immunity, growth and development of organisms. However, in mollusks, the identity and function of SOCS proteins remain largely unclear. In the present study, three SOCS genes, CgSOCS2, CgSOCS5 and CgSOCS7, have been identified by searching and analyzing the Pacific oyster genome. Structural analysis indicated that the CgSOCS share conserved functional domains with their vertebrate counterparts. Phylogenetic analysis showed that the three SOCS genes clustered into two distinct groups, the type I and II subfamilies, indicating that these subfamilies had common ancestors. Tissue-specific expression results showed that the three genes were constitutively expressed in all examined tissues and were highly expressed in immune-related tissues, such as the hemocytes, gills and digestive gland. The expression of CgSOCS can also be induced to varying degrees in hemocytes after challenge with pathogen-associated molecular patterns (PAMPs). Moreover, dualluciferase reporter assays showed that the over-expression of CgSOCS2 and CgSOCS7, but not CgSOC5, can activate an NF-kB reporter gene. Collectively, these results demonstrated that the CgSOCS might play an important role in the innate immune responses of the Pacific oyster. © 2015 Elsevier Ltd. All rights reserved.
Keywords: Suppressor of cytokine signaling PAMP challenge Crassostrea gigas
1. Introduction Cytokines are important secreted proteins that have essential roles in many biological processes, including growth and development, differentiation and immune responses [1]. The suppressor of cytokine signaling (SOCS) proteins are key physiological regulators of the immune system that can be exploited by pathogens to circumvent host responses [2]. They act as negative regulators of cytokine receptor signaling to control excessive cytokine effects, and they inhibit a variety of signal transduction pathways, particularly the Janus kinase/signal transducer and activator of transcription (JAK/STAT) pathway [3]. The mammalian SOCS family consists of eight members: SOCS1-7 and cytokine-inducible SH2containing protein (CISH); they all share a common structure
* Corresponding author. South China Sea Institute of Oceanology, Chinese Academy of Sciences, 164 West Xingang Road, Guangzhou 510301, China. Tel./ fax: þ86 20 8910 2507. E-mail address: [email protected] (Z. Yu). http://dx.doi.org/10.1016/j.fsi.2015.03.022 1050-4648/© 2015 Elsevier Ltd. All rights reserved.
including a central SH2 domain and a conserved C-terminal SOCS box [4,5]. However, they differ in the length and sequence of their N-terminal domains. Additionally, only SOCS1 and 3 possess a kinase inhibitory region (KIR), which is located at the N-terminus, immediately upstream of the central SH2 domain. Although most SOCS proteins act in a classical negative feedback loop to inhibit cytokine signal transduction, they can also be induced by various other stimuli, such as pathogen-associated molecular patterns (PAMPs), bacterial, and viral infections [6]. Previous studies have shown that SOCS proteins are key regulators of immune processes [2,5,7]. Among the SOCS family members, SOCS1, SOCS3 and CISH are well characterized. The first member of the family, CISH, was shown to inhibit erythropoietin (EPO) and IL-3 signaling. It was identified as an immediate early gene induced in hematopoietic cells in response to stimulation by a variety of cytokines, including erythropoietin (EPO), interleukin-2 (IL-2), IL-3, and granulocytemacrophage colony-stimulating factor (GM-CSF) [8]. The second member was initially discovered independently by three groups and termed SOCS1; it can bind to the JAK kinase domain and inhibit
526
J. Li et al. / Fish & Shellfish Immunology 44 (2015) 525e532
kinase activity [9]. SOCS1 mediates the polyubiquitination and degradation of TIRAP to prevent excessive p65/RelA phosphorylation and production of IL-6 and TNFa, without affecting IkB phosphorylation or MAP kinase activation [10,11]. Over-expression of SOCS1 predominantly inhibited type I IFN-dependent, secondarily induced genes, and double knockout of SOCS1 abolished LPS hypersensitivity [12]. SOCS3 was initially identified using a functional screen for inhibitors of cytokine signaling, and it acts in a negative feedback loop to suppress a number of intracellular pathways. Mice with SOCS3-deficient hematopoiesis are highly susceptible to inflammatory joint disease [13]. During wound repair, SOCS3 negatively regulates gp130-dependent signaling in keratinocytes and immune cells, and it prevents excessive neutrophil accumulation and production of macrophage-secreted MIP-1 at wound sites [14]. CISH, SOCS1 and SOCS3 were induced by a variety of immune cytokines, such as IL-2, IL-3, IL-4, IL-6, IFN-g, EPO, prolactin, G-CSF, leukemia inhibitory factor (LIF), growth hormones and lipopolysaccharide (LPS), indicating the existence of functional relationships among these factors [15]. SOCS-deficient mice showed that other SOCS members, such as SOCS2 and SOCS5-7, have effects on growth hormone signaling, glucose homeostasis, and brain development. More recently, SOCS2, SOCS6 and SOCS7 were found to act as a molecular bridge between a ubiquitin-protein isopeptide ligase complex and SOCS proteins, targeting them for proteasomal turnover, and stimulating cytokine signaling [16]. Although the SOCS family is well documented in mammals, there is sparse information about its existence and occurrence in invertebrate species. In Drosophila melanogaster, three SOCS homologs, SOCS-36E, SOCS-44A and SOCS-16D, were identified [17]. In Eriocheir sinensis, SOCS2 was cloned and found to be involved in immune defense responses [18]. Recently, a SOCS2 gene has been characterized in mollusks, including Pinctada fucata, Ruditapes philippinarum, and Haliotis discus discus; its expression pattern in response to infection indicates that SOCS2 is likely to be involved in immune defense in these organisms [19e21]. However, prior evidence indicates that only one SOCS gene exists in arthropods and mollusks; it is not yet known whether additional SOCS genes are present in these species. Therefore, we conducted a homology search for additional SOCS genes in Crassostrea gigas. Surprisingly, we discovered three novel SOCS homologs in the C. gigas genome database. Here, we report the analysis of these SOCS sequences, their expression profiles in response to different PAMP challenges and their transcriptional activity, which will provide insights into the evolution and function of the SOCS family in oysters.
RACE-ready cDNA. The primers for 50 and 30 RACE are listed in Table 1. The amplification reaction and PCR temperature profiles were as described previously [22]. The target PCR products were gel-purified using a Gel Extraction System (Omega, USA) and cloned into the pGEM-T Easy Vector (Promega, USA). The plasmid DNA was sequenced using universal forward and reverse primers with the BigDye Terminator kit and an ABI Prism 3730 DNA sequencer (Perkin Elmer, USA). The full-length cDNA sequences were obtained by combining the 30 - and 50 -end sequences. The CgSOCS sequences were analyzed using BLAST (http:// www.ncbi.nlm.nih.gov/blast) and the Expert Protein Analysis System (http://www.expasy.org/). Protein motifs were predicted with SMART (http://smart.embl-heidelberg.de). A Neighbor-Joining (NJ) phylogenetic tree was constructed using the MEGA5.0 package. The reliability of branching was tested using bootstrap re-sampling with 1000 pseudo-replicates.
2. Materials and methods
Total RNA was extracted from selected Pacific oyster tissues using TRIzol Reagent (Invitrogen, USA) following the manufacturer's protocol. The integrity of the RNA was checked with agarose gel electrophoresis. Reverse transcription reactions were performed on 1000 ng total RNA using PrimeScript RTase (Takara, Japan) with random 6-mers, following the manufacturer's instructions. Real-time PCR analysis was conducted to assess the abundance of CgSOCS mRNA transcripts in a variety of tissues and during PAMP challenge in the Pacific oyster. Three reference genes, EF1a, rpl13, and GAPDH, were used; all primers used for real-time PCR are listed in Table 1. Real-time PCR was performed with 2 Master Mix (Roche) on a LightCycler 480II (Roche). The total reaction volume was 20 ml, and each reaction contained 10 ml of 2 Master Mix, 1 ml each of the forward and reverse primers (10 mM), 1 ml of 1:10 diluted cDNA, and 7 ml of PCR-grade water. The PCR cycling procedure was as follows: 95 C for 10 s, then 40 cycles of 95 C for 5 s, 60 C for 20 s, 72 C for 20 s and 80 C for 20 s. Negative controls without cDNA templates were also included. A melting curve analysis of the amplification products was performed at the end of
2.1. Sequence retrieval, cloning and analysis of the full-length cDNAs of CgSOCS Bioinformatic screening of SOCS genes was conducted using BLASTP (http://blast.ncbi.nlm.nih.gov/Blast.cgi), the Pacific oyster genome database (http://oysterdb.cn) and the amino acid sequence of pearl oyster SOCS2 (JX863900). Based on the SOCS sequences from the genome database, a GeneRacer™ kit (Invitrogen, CA, USA) was used according to the manufacturer's instructions to obtain the 30 and 50 ends of the genes. Briefly, 5 mg of total RNA was isolated from Pacific oyster hemocytes, then treated with calf intestinal phosphatase to remove the 50 -phosphate from truncated RNAs and non-mRNAs, leaving a 50 -OH end. The total RNA was then treated with tobacco acid pyrophosphatase to remove the 50 cap from full-length mRNAs, leaving a 50 -phosphate, to which a GeneRacer™ RNA Oligo was ligated using T4 RNA ligase. Ligated mRNAs were then reverse transcribed using the GeneRacer™ Oligo(dT) Primer to obtain
2.2. Oysters, primary culture of hemocytes, PAMP challenge and sample collection Pacific oysters (two years old, shell height 10.00 cm ± 0.05 cm) were obtained from Qingdao, Shandong Province, China. The oysters were maintained in tanks at 23e25 C with circulating seawater for one week prior to the experiments and were fed twice daily with the marine algae Tetraselmis suecica and Isochrysis galbana. Primary cultured hemocytes were prepared for the PAMP challenge according to our previous work [23]. Mixed primary cultures of hemocytes (3 ml in each plate) were challenged by adding one of the following: phosphate-buffered saline (PBS, pH 7.4), 10 mg/ml Polyinosinic-polycytidylic acid (poly(I:C)), 10 mg/ml lipopolysaccharide (LPS), 10 mg/ml peptidoglycan (PGN), 10 mg/ml 1,3-beta-glucan (InvivoGen), 107 cells/ml heat-killed Listeria monocytogenes (HKLM), or 107 cells/ml heat-killed Vibrio alginolyticus (HKVA). Hemocytes from five replicates were harvested at 3, 6, 12 and 24 h after challenge for RNA isolation. Tissue from the gills, mantle, adductor muscle, digestive gland, gonad, and the hemocytes were carefully collected from three healthy oysters as parallel samples. The samples were combined with TRIzol (Invitrogen, USA), quickly frozen in liquid nitrogen, and then stored at 80 C until RNA isolation. 2.3. Isolation of total RNA and quantitative RT-PCR analysis of three CgSOCS
J. Li et al. / Fish & Shellfish Immunology 44 (2015) 525e532
527
Table 1 Sequences of primers used in this study. Primer
Sequence （5e3）
Comment
CgSOCS2-R1 CgSOCS2-R2 CgSOCS2-F1 CgSOCS2-F2 CgSOCS5-R1 CgSOCS5-R2 CgSOCS5-F1 CgSOCS5-F2 CgSOCS7-R1 CgSOCS7-R2 CgSOCS7-F1 CgSOCS7-F2 GR5P GR5NP GR3P GR3NP CgSOCS2-F3 CgSOCS2-R3 CgSOCS5-F3 CgSOCS5-R3 CgSOCS7-F3 CgSOCS7-R3 CgSOCS2-F4 CgSOCS2-R4 CgSOCS5-F4 CgSOCS5-R4 CgSOCS7-F4 CgSOCS7-R4 GAPDH-F GAPDH-R EF1a-F EF1a-R RPL13-F RPL13-R
AGCAGACTTTTGGCCTCCTGGCTA TCTTACTTTCGCTATTTAATTCACTCG TGGATAGTGACGAGAGAATTAGTGCTA AACCTAAACGAAACTGTGTAGTGGATT GGGCGTAGAGTTACAAACACTTCCTG GATGTCTGAATGAAATCGCTAATGCTG CGGAGGGAACCTTTTTGTTGAGAGAC CGCACAAGAGGAGTACCTGTTTTCAG TCTTTCATGCCCAATTCTGAAAGACT CTATTGCCCCTATTGGCAGTTTCATC TCCACCATACTCGGATAGAGCACCAC TACTTCATTCGCCCCTCTGGTCCTG CGACTGGAGCACGAGGACACTGA GGACACTGACATGGACTGAAGGAGTA GCTGTCAACGATACGCTACGTAACG CGCTACGTAACGGCATGACAGTG ACGTGGATCCATGGTGATGAAGATTTGTAT ACTGGATATCTCAGTGGATATAGGGATATT ACGTGGATCCATGACATCACACCCTCCACT ACTGGATATCTTAAGCCATGTCATATCTGC ACGTGGATCCATGAGCAGCTCAGGTGTAAA ACTGGATATCCTAGTCTTCTAGATATTCCA CTTCTATGCCCGTTTGACCG TAACACCTTTGTCCGACTGAGA ATCGGCTTCATAGGTCCTCTGT GCGTCCTTCATTGGGTTTT TGACAAACCATTGCGAGACG GTCCCTCACCAGGAATGACC CTTTCCGCGTACCAGTTCCA GCTGCTTCGCTTGTCTCCAC GCTCCACCCAACATCACCACTG ACGGATTTCCTTTACGGACACG GGCATTTATTAGGGAGACTGGCTTCA TCAGGTATTTCAGGACCTTCAGTTTGT
50 RACE of CgSOCS2 30 RACE of CgSOCS2 50 RACE of CgSOCS5 30 RACE of CgSOCS5 50 RACE of CgSOCS7 30 RACE of CgSOCS7 Adaptor of 50 RACE Adaptor of 30 RACE Vector for SOCS2-Flag Vector for SOCS5-Flag Vector for SOCS7-Flag Real-time-PCR of SOCS2 Real-time-PCR of SOCS5 Real-time-PCR of SOCS7 Real-time-PCR of GAPDH Real-time-PCR of EF1a Real-time-PCR of RPL13
“F” indicates forward primer and “R” indicates reverse primer.
each PCR reaction to confirm that only one PCR product was amplified and detected. The amplification efficiencies of the target and reference genes were verified and found to be approximately equal. The reactions were performed in triplicate, and the expression levels of the CgSOCS mRNAs were calculated using multiple controls, as described previously [24]. 2.4. Plasmid construction, cell culture and transient transfection Primer pairs (Table 1) containing BamHI and EcoRV restriction sites were designed to amplify the entire CgSOCS ORFs. After PCR amplification, the target fragments and vectors were digested with BamHI and EcoRV and then subcloned into the pCMV-N-Flag vector. Recombinant plasmids were transformed into DH5a competent cells, and the clones were verified by DNA sequencing. An NF-kB luciferase reporter vector was constructed by our laboratory previously. The pRL-TK Renilla luciferase plasmid (Promega, USA) was used as an internal control. HEK293T cells were cultured in Dulbecco's modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS, Gibco) and antibiotics (streptomycin and penicillin, Gibco) in a humidified atmosphere of 95% air and 5% CO2 at 37 C. Prior to transfection, the cells were seeded overnight, and transient transfection was conducted with Lipofectamine 2000 (Invitrogen, USA) according to the manufacturer's instructions. The cells were transfected with NF-kB reporter vectors, pRL-TK, and CgSOCS-Flag in a serum-free culture medium (Gibco, USA). After 4e6 h, the medium was replaced with a complete medium containing 10% FBS and antibiotics. Then, the transfected HEK293T cells were lysed for the luciferase assay.
2.5. Dual-luciferase reporter assays and statistical analysis Firefly and Renilla luciferase activities were measured using a dual-luciferase reporter assay system (Promega) according to the manufacturer's instructions. Briefly, 48 h post-transfection, HEK293T cells in 48-well plates were washed twice with 100 ml PBS and then lysed with 20 ml 1 passive lysis buffer at room temperature for 10 min. The cell lysate (20 ml) was transferred to a plate, and 100 ml of luciferase assay reagent II and 100 ml of Stop & Glo reagent were added in sequence; subsequently, the firefly and Renilla luciferase activities were measured. The firefly luciferase data were corrected for transfection efficiency based on the Renilla luciferase activity. The experimental results are reported as the average of triplicate assays and are expressed as fold changes relative to the control vector. The data obtained from luciferase reporter analysis was done using one-way ANOVA, followed by Tukey's test using the SPSS software package. And qPCR data was done using student's t test. Differences were considered statistically significant at p < 0.05 and 0.01. 3. Results 3.1. Full-length cDNA characterization and phylogenetic analysis of novel CgSOCS genes To find SOCS genes, the Pacific oyster genome database was searched using BlastP and the reported pearl oyster SOCS gene. Ultimately, three SOCS genes were identified and were designated as CgSOCS2, CgSOCS5, and CgSOCS7. Based on these sequences, three full-length Pacific oyster SOCS cDNA sequences were obtained
528
J. Li et al. / Fish & Shellfish Immunology 44 (2015) 525e532
using 50 and 30 RACE; the sequences were submitted to GenBank under accession No. KM975679eKM975681 (Supplementary Fig. S1). The complete CgSOCS2 cDNA is 1294 bp in length and includes a 99-bp 50 UTR, an 834-bp open reading frame (ORF), and a 361-bp 30 UTR. The CgSOCS5 gene contains a 100-bp 50 UTR, a 1347bp ORF and a 275-bp 30 UTR. The CgSOCS7 cDNA consists of a 1335bp ORF, a 214-bp 50 UTR, and a 556-bp 30 UTR. There are three RNA instability motifs (ATTTA) in the 30 UTR of CgSOCS2, and one in the 30 UTRs of CgSOCS5 and CgSOCS7. The molecular masses of the CgSOCS2 and CgSOCS5 proteins are 31.6 and 51.5 kDa, respectively, and the CgSOCS7 protein has a predicted mass of 50.4 kDa. The theoretical isoelectric points of CgSOCS2, CgSOCS5 and CgSOCS7 are 9.30, 6.40 and 6.38, respectively. Signal peptide prediction showed that none of the three CgSOCS have putative signal peptides. SMART analysis demonstrated that all three CgSOCS contain a Src homology 2 (SH2) domain and a SOCS box domain. To evaluate the molecular evolutionary relationships of the three Pacific oyster SOCS proteins, a phylogenetic tree was constructed based on the amino acid sequences of 60 SOCS family members using the Neighbor-Joining method with MEGA software (Fig. 1). There were two distinct groups in the phylogenetic tree that corresponded to the type I and type II subfamilies. The type I subfamily consisted of SOCS4-SOCS7. As expected, CgSOCS5 and CgSOCS7 grouped with the other known SOCS5 and SOCS7 proteins, and together they formed a subgroup within the Type I subfamily. However, CgSOCS5 and CgSOCS7 clustered separately from their vertebrate counterparts. The type II subfamily included CISH and SOCS1-SOCS3. The invertebrate SOCS2 proteins, including CgSOCS2, were first clustered with the SOCS1, and then formed an independent sister group to the branch of vertebrate SOCS2 and CISH. 3.2. The tissue distribution of CgSOCS genes and their temporal expression under PAMP challenge qRT-PCR was used to quantify CgSOCS expression in various healthy Pacific oyster tissues, including the hemocytes, digestive gland, gills, muscle, heart and gonad (Fig. 2). Expression analysis showed that all three SOCS genes were constitutively expressed in all examined tissues. The transcripts of all three SOCS genes were highly expressed in the hemocytes, gills, and digestive gland. The expression levels of CgSOCS2 and CgSOCS7 were lower in the muscle. In contrast, CgSOCS5 expression was lowest in the mantle. Because all three CgSOCS transcripts were relatively highly expressed in hemocytes, primary hemocyte cultures were used to examine whether the expression of these genes could be modulated with PAMP challenges (Fig. 3). After stimulation with poly (I: C), LPS, PGN, HKLM, and HKVA, the expression of CgSOCS2 and CgSOCS7 was significantly up-regulated. In contrast, b-1,3-glucan challenge had no significant effect on the expression of any of the CgSOCS at any time point examined. The expression of CgSOCS5 was differentially regulated by poly (I: C), LPS and HKVA challenges. The expression of CgSOCS5 quickly increased as early as 6 h post-poly (I: C) challenge, whereas a significant increase after LPS and HKVA challenges started after 12 h and peaked at 24 h post-challenge. 3.3. The effect of CgSOCS on NF-kB activation To assess the ability of the CgSOCS to enhance NF-kB transcriptional activity, dual-luciferase reporter assays were performed. The results revealed that relative to pcDNA3.1 alone, CgSOCS2 and CgSOCS7 activated the NF-кB luciferase reporter 5-fold and 7-fold, respectively (P < 0.05), in HEK293T cells (Fig. 4). However, overexpression of CgSOCS5 had no obvious effect on the activity of the NF-kB reporter gene.
4. Discussion Innate immunity represents the first line of defense against invading pathogens. Toll-like receptors (TLRs), NOD-like receptors (NLRs), and Rig-I-like receptors (RLRs) are essential for the activation of innate immunity [25e27]. Furthermore, cytokines mediate cell communication and are crucial for the induction of an appropriately regulated immune response. In mammals, SOCS function as negative regulators of cytokines by acting in classical negative feedback loops, attenuating signaling via a variety of mechanisms [28,29]. However, the potential functions of SOCS in invertebrate immune systems are still poorly characterized. In the present study, we reported the presence of three SOCS homologs in Pacific oysters using a homology search in the genome database and the SMARTRACE method. RNA instability motifs (ATTTA) are present within the 30 UTR of CgSOCS, which is in accord with previous reports on teleosts and mammals [30,31]. Moreover, signal peptide prediction showed that none of the three CgSOCS has a putative signal peptide, suggesting that they could be part of a family of intracellular proteins. Consistent with their mammalian counterparts, structural analysis of the CgSOCS genes showed that they possess a Src homology 2 (SH2) domain and a SOCS box domain, which enable these proteins to negatively regulate the JAK-STAT signaling pathway. This observation suggests that the two domains are highly evolutionarily conserved and are functionally important. Our phylogenetic analysis revealed that the SOCS gene family could be clearly divided into two subfamilies: types I and II. The type I SOCS subfamily consists of SOCS4, 5, 6, and 7, and the type II subfamily includes CISH and SOCS1, 2, and 3. CgSOCS5 and CgSOCS7 group with the other SOCS5 and SOCS7 proteins in separate clades, which is in agreement with previous studies [18,32]. Moreover, CgSOCS2, together with SOCS2 from the invertebrates P. fucata, R. philippinarum, Saccoglossus kowalevskii, H. discus discus, and Haliotis diversicolor, first clustered with the SOCS1 proteins and then formed an independent sister group to the vertebrate SOCS2 and CISH proteins. They might all originate from repeated duplication of one primordial SOCS gene. These results suggest that there were common ancestors of the type I and type II subfamilies, which is not consistent with a previous report that the type I subfamily members were more primitive than those of type II subfamily [32]. Expression pattern analysis of the CgSOCS genes in various tissues showed that the CgSOCS were constitutively expressed in all examined tissues and were highly expressed in immune-related tissues, such as the hemocytes, gills and digestive gland. This is in agreement with previous results in Oncorhynchus mykiss, E. sinensis, and R. philippinarum. A higher expression level of O. mykiss SOCS3 was detected in the head, kidney, spleen, intestine and gills [32]. In E. sinensis, a high expression level of SOCS2 was observed in the gills and hepatopancreas [18]. In R. philippinarum, a high expression level of SOCS2 was found in the gills and hemocytes [20]. Overall, the hemocytes, gills, and digestive gland, which are three important tissues in oyster innate immunity, are the major sites of CgSOCS expression. These expression characteristics indicate that the CgSOCS may play important roles in the innate immune system of the Pacific oyster. SOCS proteins have been identified as intracellular, inducible feedback inhibitors with crucial importance in the limitation of inflammatory responses in mammals [5]. However, few studies about the functions of SOCS in the immune defense responses of invertebrates, and especially marine invertebrates, have been reported. Therefore, we characterized the expression pattern of CgSOCS in hemocytes in response to stimulation with PAMPs. Overall, in C. gigas hemocytes, CgSOCS showed high expression and strong responses to multiple PAMPs. CgSOCS2 and CgSOCS7 expression increased significantly in response to all PAMP
J. Li et al. / Fish & Shellfish Immunology 44 (2015) 525e532
529
Fig. 1. Phylogenic analysis of the CgSOCS and selected SOCS family proteins using the Neighbor-Joining method in MEGA5 based on sequence alignments using ClustalW (1.81). Numbers indicate the bootstrap confidence values of 1000 replicates.
530
J. Li et al. / Fish & Shellfish Immunology 44 (2015) 525e532
Fig. 2. Relative expression levels of the CgSOCS in hemocytes, gonad, heart, adductor muscle, mantle, gills, and digestive gland. A) CgSOCS2, B) CgSOCS5, C) CgSOCS7. Vertical bars represent the mean ± S.D. (N ¼ 3).
challenges except b-1,3-glucan, indicating that CgSOCS have comprehensive roles in defense against viruses and bacteria but have lost these roles in combating fungi. CgSOCS5 had strong, broad responses to the LPS and HKVA challenges, but it did not respond to PGN and HKLM stimulation, suggesting the involvement of CgSOCS in the immune response against Gram-negative, but not Grampositive, bacteria. Similarly, previous studies have demonstrated
Fig. 3. The temporal expression of CgSOCS in response to PAMP challenges. A) CgSOCS2, B) CgSOCS5, C) CgSOCS7. Vertical bars represent the mean ± S.D. (N ¼ 5). One asterisk indicates a significant difference at p < 0.05, and two asterisks indicate a significant difference at p < 0.01 between the challenged and control groups at the same time point.
J. Li et al. / Fish & Shellfish Immunology 44 (2015) 525e532
531
of China (2013J2200095), and Joint Funds of NSFC-Guangdong of China (U1201215). Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.fsi.2015.03.022. References
Fig. 4. The effects of CgSOCS expression on the activity of an NF-kB reporter gene. NFkB reporter plasmids were co-transfected into HEK293T cells with the indicated quantities of CgSOCS plasmids. Luciferase assays used a dual-luciferase reporter assay system. One asterisk indicates a significant difference at p < 0.05, and two asterisks indicate a significant difference at p < 0.01.
increased expression of SOCS under LPS or poly(I:C)-stimulation in E. sinensis, P. fucata, H. discus discus, and R. philippinarum [18e20,33]. The significant up-regulation of CgSOCS in response to PAMPs indicated that CgSOCS were inducible, multifunctional factors that were involved in the immune defense response of Pacific oyster. To elucidate the involvement of CgSOCS in the regulation of the NF-kB signaling pathway, CgSOCS expression vectors, together with an NF-kB reporter gene, were used to assess this activation ability. Due to the absence of a bivalve mollusk cell lines and successful activated an NF-kB reporter gene in HEK293T cells in our previous studies, we tested the transcriptional activation activity of CgSOCS using HEK293T cells [34]. Dual-luciferase reporter assays showed that the over-expression of CgSOCS2 and CgSOCS7, but not of CgSOCS5, can activate the NF-kB reporter gene. This finding is in accordance with results obtained from pearl oyster and mouse, in which SOCS were also found to enhance NF-kB-dependent transactivation [33,35]. These results suggest that CgSOCS2 and CgSOCS7 can trigger the activation of the NF-кB signaling pathway in HEK293T cells, whereas CgSOCS5 might have lost this function. In conclusion, three SOCS genes, SOCS2, 5 and 7, have been identified in the Pacific oyster. Tissue-specific expression analysis showed that the CgSOCS were constitutively expressed in all examined tissues, with highest expression in immune-related tissues. The induction of the CgSOCS in response to PAMP challenges in C. gigas indicates that the CgSOCS are likely to be important components of the immune response to pathogen infection. Moreover, over-expression of CgSOCS2 and CgSOCS5 can enhance NF-кB reporter gene transcriptional activity. This evidence will provide new insights to better understand how cytokine signaling negatively regulates the immune system of the Pacific oyster. Acknowledgments This work was supported by the National Natural Science Foundation of China (41176150 and 41306145), the Program of the Pearl River Young Talents of Science and Technology in Guangzhou
[1] S. Ilangumaran, S. Ramanathan, R. Rottapel, Regulation of the immune system by SOCS family adaptor proteins, Semin. Immunol. 16 (2004) 351e365. [2] A. Yoshimura, T. Naka, M. Kubo, SOCS proteins, cytokine signalling and immune regulation, Nat. Rev. Immunol. 7 (2007) 454e465. [3] N.J. Kershaw, J.M. Murphy, I.S. Lucet, N.A. Nicola, J.J. Babon, Regulation of janus kinases by SOCS proteins, Biochem. Soc. Trans. 41 (2013) 1042e1047. [4] W.S. Alexander, Suppressors of cytokine signalling (SOCS) in the immune system, Nat. Rev. Immunol. 2 (2002) 410e416. [5] A. Dalpke, K. Heeg, H. Bartz, A. Baetz, Regulation of innate immunity by suppressor of cytokine signaling (SOCS) proteins, Immunobiology 213 (2008) 225e235. [6] L.N. Akhtar, E.N. Benveniste, Viral exploitation of host SOCS protein functions, J. Virol. 85 (2011) 1912e1921. [7] B.A. Croker, H. Kiu, S.E. Nicholson, SOCS regulation of the JAK/STAT signalling pathway, Semin. Cell Dev. Biol. 19 (2008) 414e422. [8] A. Yoshimura, T. Ohkubo, T. Kiguchi, N.A. Jenkins, D.J. Gilbert, N.G. Copeland, et al., A novel cytokine-inducible gene CIS encodes an SH2-containing protein that binds to tyrosine-phosphorylated interleukin 3 and erythropoietin receptors, EMBO J. 14 (1995) 2816e2826. [9] T.A. Endo, M. Masuhara, M. Yokouchi, R. Suzuki, H. Sakamoto, K. Mitsui, et al., A new protein containing an SH2 domain that inhibits JAK kinases, Nature 387 (1997) 921e924. [10] A. Mansell, R. Smith, S.L. Doyle, P. Gray, J.E. Fenner, P.J. Crack, et al., Suppressor of cytokine signaling 1 negatively regulates Toll-like receptor signaling by mediating Mal degradation, Nat. Immunol. 7 (2006) 148e155. [11] S. Gingras, E. Parganas, A. de Pauw, J.N. Ihle, P.J. Murray, Re-examination of the role of suppressor of cytokine signaling 1 (SOCS1) in the regulation of toll-like receptor signaling, J. Biol. Chem. 279 (2004) 54702e54707. [12] A. Baetz, S. Zimmermann, A.H. Dalpke, Microbial immune evasion employing suppressor of cytokine signaling (SOCS) proteins, Inflamm. Allergy Drug Targets 6 (2007) 160e167. [13] P.K. Wong, P.J. Egan, B.A. Croker, K. O'Donnell, N.A. Sims, S. Drake, et al., SOCS3 negatively regulates innate and adaptive immune mechanisms in acute IL1-dependent inflammatory arthritis, J. Clin. Invest. 116 (2006) 1571e1581. [14] B.M. Zhu, Y. Ishida, G.W. Robinson, M. Pacher-Zavisin, A. Yoshimura, P.M. Murphy, et al., SOCS3 negatively regulates the gp130-STAT3 pathway in mouse skin wound healing, J. Invest. Dermatol. 128 (2008) 1821e1829. [15] D.L. Krebs, D.J. Hilton, SOCS proteins: negative regulators of cytokine signaling, Stem Cells 19 (2001) 378e387. [16] J. Piessevaux, D. Lavens, T. Montoye, J. Wauman, D. Catteeuw, J. Vandekerckhove, et al., Functional cross-modulation between SOCS proteins can stimulate cytokine signaling, J. Biol. Chem. 281 (2006) 32953e32966. [17] J.S. Rawlings, K.M. Rosler, D.A. Harrison, The JAK/STAT signaling pathway, J. Cell Sci. 117 (2004) 1281e1283. [18] Y. Zhang, J. Zhao, H. Zhang, Y. Gai, L. Wang, F. Li, et al., The involvement of suppressors of cytokine signaling 2 (SOCS2) in immune defense responses of Chinese mitten crab Eriocheir sinensis, Dev. Comp. Immunol. 34 (2010) 42e48. [19] M. De Zoysa, J. Lee, Suppressor of cytokine signaling 2 (SOCS-2) homologue in disk abalone: cloning, sequence characterization and expression analysis, Fish Shellfish Immunol. 26 (2009) 500e508. [20] Y. Lee, J.Y. Choi, C. Oh, D.H. Kang, S.Y. Choi, G.J. Heo, et al., Molecular cloning and characterization of SOCS-2 from Manila clam Ruditapes philippinarum, Fish Shellfish Immunol. 36 (2014) 453e458. [21] Y. Zhang, Z. Zhou, L. Wang, R. Liu, L. Song, The suppressor of cytokine signaling 2 (SOCS2) modulating the neurotransmitters release in Eriocheir sinensis, Fish Shellfish Immunol. 35 (2013) 101e106. [22] X. He, Y. Zhang, Z. Yu, An Mpeg (macrophage expressed gene) from the Pacific oyster Crassostrea gigas: molecular characterization and gene expression, Fish Shellfish Immunol. 30 (2011) 870e876. [23] F. Yu, Y. Zhang, Z. Yu, Characteristics and expression patterns of the lipopolysaccharide-induced TNF-alpha factor (LITAF) gene family in the Pacific oyster, Crassostrea gigas, Fish Shellfish Immunol. 33 (2012) 899e908. [24] J. Vandesompele, K. De Preter, F. Pattyn, B. Poppe, N. Van Roy, A. De Paepe, et al., Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes, Genome Biol. 3 (2002). RESEARCH0034. [25] M. Yoneyama, T. Fujita, Function of RIG-I-like receptors in antiviral innate immunity, J. Biol. Chem. 282 (2007) 15315e15318. [26] D.J. Philpott, S.E. Girardin, Nod-like receptors: sentinels at host membranes, Curr. Opin. Immunol. 22 (2010) 428e434. [27] K. Takeda, S. Akira, Toll-like receptors in innate immunity, Int. Immunol. 17 (2005) 1e14.
532
J. Li et al. / Fish & Shellfish Immunology 44 (2015) 525e532
[28] A. Dalpke, K. Heeg, Suppressors of cytokine signaling proteins in innate and adaptive immune responses, Arch. Immunol. Ther. Exp. Warsz. 51 (2003) 91e103. [29] H. Yasukawa, A. Sasaki, A. Yoshimura, Negative regulation of cytokine signaling pathways, Annu. Rev. Immunol. 18 (2000) 143e164. [30] S. Wormald, J.G. Zhang, D.L. Krebs, L.A. Mielke, J. Silver, W.S. Alexander, et al., The comparative roles of suppressor of cytokine signaling-1 and -3 in the inhibition and desensitization of cytokine signaling, J. Biol. Chem. 281 (2006) 11135e11143. [31] Z.G. Xiao, H. Liu, J.P. Fu, W. Hu, Y.P. Wang, Q.L. Guo, Cloning of common carp SOCS-3 gene and its expression during embryogenesis, GH-transgene and viral infection, Fish Shellfish Immunol. 28 (2010) 362e371.
[32] T. Wang, C.J. Secombes, Rainbow trout suppressor of cytokine signalling (SOCS)-1, 2 and 3: molecular identification, expression and modulation, Mol. Immunol. 45 (2008) 1449e1457. [33] W.G. Liu, X.D. Huang, Q. Wang, M. Zhao, S.Z. Wu, M.X. He, Gene cloning and function analysis of cytokine-induced suppressor of cytokine signaling (SOCS) from pearl oyster Pinctada fucata, Fish Shellfish Immunol. 34 (2013) 849e854. [34] Y. Zhang, X. He, Z. Yu, Two homologues of inhibitor of NF-kappa B (IkappaB) are involved in the immune defense of the Pacific oyster, Crassostrea gigas, Fish Shellfish Immunol. 30 (2011) 1354e1361. [35] S.H. Park, K.E. Kim, H.Y. Hwang, T.Y. Kim, Regulatory effect of SOCS on NFkappaB activity in murine monocytes/macrophages, DNA Cell Biol. 22 (2003) 131e139.
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Short communication
Cloning and characterization of three suppressors of cytokine signaling (SOCS) genes from the Pacific oyster, Crassostrea gigas Jun Li a, Yang Zhang a, Yuehuan Zhang a, Ying Liu a, b, Zhiming Xiang a, Fufa Qu a, b, Ziniu Yu a, * a
Key Laboratory of Tropical Marine Bio-Resources and Ecology, South China Sea Institute of Oceanology, Chinese Academy of Sciences, 164 West Xingang Road, Guangzhou 510301, China University of Chinese Academy of Sciences, 19A Yuquan Road, Beijing 100049, China
b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 8 January 2015 Received in revised form 8 March 2015 Accepted 13 March 2015 Available online 21 March 2015
Members of the suppressor of cytokine signaling (SOCS) family are crucial for the control of a variety of signal transduction pathways that are involved in the immunity, growth and development of organisms. However, in mollusks, the identity and function of SOCS proteins remain largely unclear. In the present study, three SOCS genes, CgSOCS2, CgSOCS5 and CgSOCS7, have been identified by searching and analyzing the Pacific oyster genome. Structural analysis indicated that the CgSOCS share conserved functional domains with their vertebrate counterparts. Phylogenetic analysis showed that the three SOCS genes clustered into two distinct groups, the type I and II subfamilies, indicating that these subfamilies had common ancestors. Tissue-specific expression results showed that the three genes were constitutively expressed in all examined tissues and were highly expressed in immune-related tissues, such as the hemocytes, gills and digestive gland. The expression of CgSOCS can also be induced to varying degrees in hemocytes after challenge with pathogen-associated molecular patterns (PAMPs). Moreover, dualluciferase reporter assays showed that the over-expression of CgSOCS2 and CgSOCS7, but not CgSOC5, can activate an NF-kB reporter gene. Collectively, these results demonstrated that the CgSOCS might play an important role in the innate immune responses of the Pacific oyster. © 2015 Elsevier Ltd. All rights reserved.
Keywords: Suppressor of cytokine signaling PAMP challenge Crassostrea gigas
1. Introduction Cytokines are important secreted proteins that have essential roles in many biological processes, including growth and development, differentiation and immune responses [1]. The suppressor of cytokine signaling (SOCS) proteins are key physiological regulators of the immune system that can be exploited by pathogens to circumvent host responses [2]. They act as negative regulators of cytokine receptor signaling to control excessive cytokine effects, and they inhibit a variety of signal transduction pathways, particularly the Janus kinase/signal transducer and activator of transcription (JAK/STAT) pathway [3]. The mammalian SOCS family consists of eight members: SOCS1-7 and cytokine-inducible SH2containing protein (CISH); they all share a common structure
* Corresponding author. South China Sea Institute of Oceanology, Chinese Academy of Sciences, 164 West Xingang Road, Guangzhou 510301, China. Tel./ fax: þ86 20 8910 2507. E-mail address: [email protected] (Z. Yu). http://dx.doi.org/10.1016/j.fsi.2015.03.022 1050-4648/© 2015 Elsevier Ltd. All rights reserved.
including a central SH2 domain and a conserved C-terminal SOCS box [4,5]. However, they differ in the length and sequence of their N-terminal domains. Additionally, only SOCS1 and 3 possess a kinase inhibitory region (KIR), which is located at the N-terminus, immediately upstream of the central SH2 domain. Although most SOCS proteins act in a classical negative feedback loop to inhibit cytokine signal transduction, they can also be induced by various other stimuli, such as pathogen-associated molecular patterns (PAMPs), bacterial, and viral infections [6]. Previous studies have shown that SOCS proteins are key regulators of immune processes [2,5,7]. Among the SOCS family members, SOCS1, SOCS3 and CISH are well characterized. The first member of the family, CISH, was shown to inhibit erythropoietin (EPO) and IL-3 signaling. It was identified as an immediate early gene induced in hematopoietic cells in response to stimulation by a variety of cytokines, including erythropoietin (EPO), interleukin-2 (IL-2), IL-3, and granulocytemacrophage colony-stimulating factor (GM-CSF) [8]. The second member was initially discovered independently by three groups and termed SOCS1; it can bind to the JAK kinase domain and inhibit
526
J. Li et al. / Fish & Shellfish Immunology 44 (2015) 525e532
kinase activity [9]. SOCS1 mediates the polyubiquitination and degradation of TIRAP to prevent excessive p65/RelA phosphorylation and production of IL-6 and TNFa, without affecting IkB phosphorylation or MAP kinase activation [10,11]. Over-expression of SOCS1 predominantly inhibited type I IFN-dependent, secondarily induced genes, and double knockout of SOCS1 abolished LPS hypersensitivity [12]. SOCS3 was initially identified using a functional screen for inhibitors of cytokine signaling, and it acts in a negative feedback loop to suppress a number of intracellular pathways. Mice with SOCS3-deficient hematopoiesis are highly susceptible to inflammatory joint disease [13]. During wound repair, SOCS3 negatively regulates gp130-dependent signaling in keratinocytes and immune cells, and it prevents excessive neutrophil accumulation and production of macrophage-secreted MIP-1 at wound sites [14]. CISH, SOCS1 and SOCS3 were induced by a variety of immune cytokines, such as IL-2, IL-3, IL-4, IL-6, IFN-g, EPO, prolactin, G-CSF, leukemia inhibitory factor (LIF), growth hormones and lipopolysaccharide (LPS), indicating the existence of functional relationships among these factors [15]. SOCS-deficient mice showed that other SOCS members, such as SOCS2 and SOCS5-7, have effects on growth hormone signaling, glucose homeostasis, and brain development. More recently, SOCS2, SOCS6 and SOCS7 were found to act as a molecular bridge between a ubiquitin-protein isopeptide ligase complex and SOCS proteins, targeting them for proteasomal turnover, and stimulating cytokine signaling [16]. Although the SOCS family is well documented in mammals, there is sparse information about its existence and occurrence in invertebrate species. In Drosophila melanogaster, three SOCS homologs, SOCS-36E, SOCS-44A and SOCS-16D, were identified [17]. In Eriocheir sinensis, SOCS2 was cloned and found to be involved in immune defense responses [18]. Recently, a SOCS2 gene has been characterized in mollusks, including Pinctada fucata, Ruditapes philippinarum, and Haliotis discus discus; its expression pattern in response to infection indicates that SOCS2 is likely to be involved in immune defense in these organisms [19e21]. However, prior evidence indicates that only one SOCS gene exists in arthropods and mollusks; it is not yet known whether additional SOCS genes are present in these species. Therefore, we conducted a homology search for additional SOCS genes in Crassostrea gigas. Surprisingly, we discovered three novel SOCS homologs in the C. gigas genome database. Here, we report the analysis of these SOCS sequences, their expression profiles in response to different PAMP challenges and their transcriptional activity, which will provide insights into the evolution and function of the SOCS family in oysters.
RACE-ready cDNA. The primers for 50 and 30 RACE are listed in Table 1. The amplification reaction and PCR temperature profiles were as described previously [22]. The target PCR products were gel-purified using a Gel Extraction System (Omega, USA) and cloned into the pGEM-T Easy Vector (Promega, USA). The plasmid DNA was sequenced using universal forward and reverse primers with the BigDye Terminator kit and an ABI Prism 3730 DNA sequencer (Perkin Elmer, USA). The full-length cDNA sequences were obtained by combining the 30 - and 50 -end sequences. The CgSOCS sequences were analyzed using BLAST (http:// www.ncbi.nlm.nih.gov/blast) and the Expert Protein Analysis System (http://www.expasy.org/). Protein motifs were predicted with SMART (http://smart.embl-heidelberg.de). A Neighbor-Joining (NJ) phylogenetic tree was constructed using the MEGA5.0 package. The reliability of branching was tested using bootstrap re-sampling with 1000 pseudo-replicates.
2. Materials and methods
Total RNA was extracted from selected Pacific oyster tissues using TRIzol Reagent (Invitrogen, USA) following the manufacturer's protocol. The integrity of the RNA was checked with agarose gel electrophoresis. Reverse transcription reactions were performed on 1000 ng total RNA using PrimeScript RTase (Takara, Japan) with random 6-mers, following the manufacturer's instructions. Real-time PCR analysis was conducted to assess the abundance of CgSOCS mRNA transcripts in a variety of tissues and during PAMP challenge in the Pacific oyster. Three reference genes, EF1a, rpl13, and GAPDH, were used; all primers used for real-time PCR are listed in Table 1. Real-time PCR was performed with 2 Master Mix (Roche) on a LightCycler 480II (Roche). The total reaction volume was 20 ml, and each reaction contained 10 ml of 2 Master Mix, 1 ml each of the forward and reverse primers (10 mM), 1 ml of 1:10 diluted cDNA, and 7 ml of PCR-grade water. The PCR cycling procedure was as follows: 95 C for 10 s, then 40 cycles of 95 C for 5 s, 60 C for 20 s, 72 C for 20 s and 80 C for 20 s. Negative controls without cDNA templates were also included. A melting curve analysis of the amplification products was performed at the end of
2.1. Sequence retrieval, cloning and analysis of the full-length cDNAs of CgSOCS Bioinformatic screening of SOCS genes was conducted using BLASTP (http://blast.ncbi.nlm.nih.gov/Blast.cgi), the Pacific oyster genome database (http://oysterdb.cn) and the amino acid sequence of pearl oyster SOCS2 (JX863900). Based on the SOCS sequences from the genome database, a GeneRacer™ kit (Invitrogen, CA, USA) was used according to the manufacturer's instructions to obtain the 30 and 50 ends of the genes. Briefly, 5 mg of total RNA was isolated from Pacific oyster hemocytes, then treated with calf intestinal phosphatase to remove the 50 -phosphate from truncated RNAs and non-mRNAs, leaving a 50 -OH end. The total RNA was then treated with tobacco acid pyrophosphatase to remove the 50 cap from full-length mRNAs, leaving a 50 -phosphate, to which a GeneRacer™ RNA Oligo was ligated using T4 RNA ligase. Ligated mRNAs were then reverse transcribed using the GeneRacer™ Oligo(dT) Primer to obtain
2.2. Oysters, primary culture of hemocytes, PAMP challenge and sample collection Pacific oysters (two years old, shell height 10.00 cm ± 0.05 cm) were obtained from Qingdao, Shandong Province, China. The oysters were maintained in tanks at 23e25 C with circulating seawater for one week prior to the experiments and were fed twice daily with the marine algae Tetraselmis suecica and Isochrysis galbana. Primary cultured hemocytes were prepared for the PAMP challenge according to our previous work [23]. Mixed primary cultures of hemocytes (3 ml in each plate) were challenged by adding one of the following: phosphate-buffered saline (PBS, pH 7.4), 10 mg/ml Polyinosinic-polycytidylic acid (poly(I:C)), 10 mg/ml lipopolysaccharide (LPS), 10 mg/ml peptidoglycan (PGN), 10 mg/ml 1,3-beta-glucan (InvivoGen), 107 cells/ml heat-killed Listeria monocytogenes (HKLM), or 107 cells/ml heat-killed Vibrio alginolyticus (HKVA). Hemocytes from five replicates were harvested at 3, 6, 12 and 24 h after challenge for RNA isolation. Tissue from the gills, mantle, adductor muscle, digestive gland, gonad, and the hemocytes were carefully collected from three healthy oysters as parallel samples. The samples were combined with TRIzol (Invitrogen, USA), quickly frozen in liquid nitrogen, and then stored at 80 C until RNA isolation. 2.3. Isolation of total RNA and quantitative RT-PCR analysis of three CgSOCS
J. Li et al. / Fish & Shellfish Immunology 44 (2015) 525e532
527
Table 1 Sequences of primers used in this study. Primer
Sequence （5e3）
Comment
CgSOCS2-R1 CgSOCS2-R2 CgSOCS2-F1 CgSOCS2-F2 CgSOCS5-R1 CgSOCS5-R2 CgSOCS5-F1 CgSOCS5-F2 CgSOCS7-R1 CgSOCS7-R2 CgSOCS7-F1 CgSOCS7-F2 GR5P GR5NP GR3P GR3NP CgSOCS2-F3 CgSOCS2-R3 CgSOCS5-F3 CgSOCS5-R3 CgSOCS7-F3 CgSOCS7-R3 CgSOCS2-F4 CgSOCS2-R4 CgSOCS5-F4 CgSOCS5-R4 CgSOCS7-F4 CgSOCS7-R4 GAPDH-F GAPDH-R EF1a-F EF1a-R RPL13-F RPL13-R
AGCAGACTTTTGGCCTCCTGGCTA TCTTACTTTCGCTATTTAATTCACTCG TGGATAGTGACGAGAGAATTAGTGCTA AACCTAAACGAAACTGTGTAGTGGATT GGGCGTAGAGTTACAAACACTTCCTG GATGTCTGAATGAAATCGCTAATGCTG CGGAGGGAACCTTTTTGTTGAGAGAC CGCACAAGAGGAGTACCTGTTTTCAG TCTTTCATGCCCAATTCTGAAAGACT CTATTGCCCCTATTGGCAGTTTCATC TCCACCATACTCGGATAGAGCACCAC TACTTCATTCGCCCCTCTGGTCCTG CGACTGGAGCACGAGGACACTGA GGACACTGACATGGACTGAAGGAGTA GCTGTCAACGATACGCTACGTAACG CGCTACGTAACGGCATGACAGTG ACGTGGATCCATGGTGATGAAGATTTGTAT ACTGGATATCTCAGTGGATATAGGGATATT ACGTGGATCCATGACATCACACCCTCCACT ACTGGATATCTTAAGCCATGTCATATCTGC ACGTGGATCCATGAGCAGCTCAGGTGTAAA ACTGGATATCCTAGTCTTCTAGATATTCCA CTTCTATGCCCGTTTGACCG TAACACCTTTGTCCGACTGAGA ATCGGCTTCATAGGTCCTCTGT GCGTCCTTCATTGGGTTTT TGACAAACCATTGCGAGACG GTCCCTCACCAGGAATGACC CTTTCCGCGTACCAGTTCCA GCTGCTTCGCTTGTCTCCAC GCTCCACCCAACATCACCACTG ACGGATTTCCTTTACGGACACG GGCATTTATTAGGGAGACTGGCTTCA TCAGGTATTTCAGGACCTTCAGTTTGT
50 RACE of CgSOCS2 30 RACE of CgSOCS2 50 RACE of CgSOCS5 30 RACE of CgSOCS5 50 RACE of CgSOCS7 30 RACE of CgSOCS7 Adaptor of 50 RACE Adaptor of 30 RACE Vector for SOCS2-Flag Vector for SOCS5-Flag Vector for SOCS7-Flag Real-time-PCR of SOCS2 Real-time-PCR of SOCS5 Real-time-PCR of SOCS7 Real-time-PCR of GAPDH Real-time-PCR of EF1a Real-time-PCR of RPL13
“F” indicates forward primer and “R” indicates reverse primer.
each PCR reaction to confirm that only one PCR product was amplified and detected. The amplification efficiencies of the target and reference genes were verified and found to be approximately equal. The reactions were performed in triplicate, and the expression levels of the CgSOCS mRNAs were calculated using multiple controls, as described previously [24]. 2.4. Plasmid construction, cell culture and transient transfection Primer pairs (Table 1) containing BamHI and EcoRV restriction sites were designed to amplify the entire CgSOCS ORFs. After PCR amplification, the target fragments and vectors were digested with BamHI and EcoRV and then subcloned into the pCMV-N-Flag vector. Recombinant plasmids were transformed into DH5a competent cells, and the clones were verified by DNA sequencing. An NF-kB luciferase reporter vector was constructed by our laboratory previously. The pRL-TK Renilla luciferase plasmid (Promega, USA) was used as an internal control. HEK293T cells were cultured in Dulbecco's modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS, Gibco) and antibiotics (streptomycin and penicillin, Gibco) in a humidified atmosphere of 95% air and 5% CO2 at 37 C. Prior to transfection, the cells were seeded overnight, and transient transfection was conducted with Lipofectamine 2000 (Invitrogen, USA) according to the manufacturer's instructions. The cells were transfected with NF-kB reporter vectors, pRL-TK, and CgSOCS-Flag in a serum-free culture medium (Gibco, USA). After 4e6 h, the medium was replaced with a complete medium containing 10% FBS and antibiotics. Then, the transfected HEK293T cells were lysed for the luciferase assay.
2.5. Dual-luciferase reporter assays and statistical analysis Firefly and Renilla luciferase activities were measured using a dual-luciferase reporter assay system (Promega) according to the manufacturer's instructions. Briefly, 48 h post-transfection, HEK293T cells in 48-well plates were washed twice with 100 ml PBS and then lysed with 20 ml 1 passive lysis buffer at room temperature for 10 min. The cell lysate (20 ml) was transferred to a plate, and 100 ml of luciferase assay reagent II and 100 ml of Stop & Glo reagent were added in sequence; subsequently, the firefly and Renilla luciferase activities were measured. The firefly luciferase data were corrected for transfection efficiency based on the Renilla luciferase activity. The experimental results are reported as the average of triplicate assays and are expressed as fold changes relative to the control vector. The data obtained from luciferase reporter analysis was done using one-way ANOVA, followed by Tukey's test using the SPSS software package. And qPCR data was done using student's t test. Differences were considered statistically significant at p < 0.05 and 0.01. 3. Results 3.1. Full-length cDNA characterization and phylogenetic analysis of novel CgSOCS genes To find SOCS genes, the Pacific oyster genome database was searched using BlastP and the reported pearl oyster SOCS gene. Ultimately, three SOCS genes were identified and were designated as CgSOCS2, CgSOCS5, and CgSOCS7. Based on these sequences, three full-length Pacific oyster SOCS cDNA sequences were obtained
528
J. Li et al. / Fish & Shellfish Immunology 44 (2015) 525e532
using 50 and 30 RACE; the sequences were submitted to GenBank under accession No. KM975679eKM975681 (Supplementary Fig. S1). The complete CgSOCS2 cDNA is 1294 bp in length and includes a 99-bp 50 UTR, an 834-bp open reading frame (ORF), and a 361-bp 30 UTR. The CgSOCS5 gene contains a 100-bp 50 UTR, a 1347bp ORF and a 275-bp 30 UTR. The CgSOCS7 cDNA consists of a 1335bp ORF, a 214-bp 50 UTR, and a 556-bp 30 UTR. There are three RNA instability motifs (ATTTA) in the 30 UTR of CgSOCS2, and one in the 30 UTRs of CgSOCS5 and CgSOCS7. The molecular masses of the CgSOCS2 and CgSOCS5 proteins are 31.6 and 51.5 kDa, respectively, and the CgSOCS7 protein has a predicted mass of 50.4 kDa. The theoretical isoelectric points of CgSOCS2, CgSOCS5 and CgSOCS7 are 9.30, 6.40 and 6.38, respectively. Signal peptide prediction showed that none of the three CgSOCS have putative signal peptides. SMART analysis demonstrated that all three CgSOCS contain a Src homology 2 (SH2) domain and a SOCS box domain. To evaluate the molecular evolutionary relationships of the three Pacific oyster SOCS proteins, a phylogenetic tree was constructed based on the amino acid sequences of 60 SOCS family members using the Neighbor-Joining method with MEGA software (Fig. 1). There were two distinct groups in the phylogenetic tree that corresponded to the type I and type II subfamilies. The type I subfamily consisted of SOCS4-SOCS7. As expected, CgSOCS5 and CgSOCS7 grouped with the other known SOCS5 and SOCS7 proteins, and together they formed a subgroup within the Type I subfamily. However, CgSOCS5 and CgSOCS7 clustered separately from their vertebrate counterparts. The type II subfamily included CISH and SOCS1-SOCS3. The invertebrate SOCS2 proteins, including CgSOCS2, were first clustered with the SOCS1, and then formed an independent sister group to the branch of vertebrate SOCS2 and CISH. 3.2. The tissue distribution of CgSOCS genes and their temporal expression under PAMP challenge qRT-PCR was used to quantify CgSOCS expression in various healthy Pacific oyster tissues, including the hemocytes, digestive gland, gills, muscle, heart and gonad (Fig. 2). Expression analysis showed that all three SOCS genes were constitutively expressed in all examined tissues. The transcripts of all three SOCS genes were highly expressed in the hemocytes, gills, and digestive gland. The expression levels of CgSOCS2 and CgSOCS7 were lower in the muscle. In contrast, CgSOCS5 expression was lowest in the mantle. Because all three CgSOCS transcripts were relatively highly expressed in hemocytes, primary hemocyte cultures were used to examine whether the expression of these genes could be modulated with PAMP challenges (Fig. 3). After stimulation with poly (I: C), LPS, PGN, HKLM, and HKVA, the expression of CgSOCS2 and CgSOCS7 was significantly up-regulated. In contrast, b-1,3-glucan challenge had no significant effect on the expression of any of the CgSOCS at any time point examined. The expression of CgSOCS5 was differentially regulated by poly (I: C), LPS and HKVA challenges. The expression of CgSOCS5 quickly increased as early as 6 h post-poly (I: C) challenge, whereas a significant increase after LPS and HKVA challenges started after 12 h and peaked at 24 h post-challenge. 3.3. The effect of CgSOCS on NF-kB activation To assess the ability of the CgSOCS to enhance NF-kB transcriptional activity, dual-luciferase reporter assays were performed. The results revealed that relative to pcDNA3.1 alone, CgSOCS2 and CgSOCS7 activated the NF-кB luciferase reporter 5-fold and 7-fold, respectively (P < 0.05), in HEK293T cells (Fig. 4). However, overexpression of CgSOCS5 had no obvious effect on the activity of the NF-kB reporter gene.
4. Discussion Innate immunity represents the first line of defense against invading pathogens. Toll-like receptors (TLRs), NOD-like receptors (NLRs), and Rig-I-like receptors (RLRs) are essential for the activation of innate immunity [25e27]. Furthermore, cytokines mediate cell communication and are crucial for the induction of an appropriately regulated immune response. In mammals, SOCS function as negative regulators of cytokines by acting in classical negative feedback loops, attenuating signaling via a variety of mechanisms [28,29]. However, the potential functions of SOCS in invertebrate immune systems are still poorly characterized. In the present study, we reported the presence of three SOCS homologs in Pacific oysters using a homology search in the genome database and the SMARTRACE method. RNA instability motifs (ATTTA) are present within the 30 UTR of CgSOCS, which is in accord with previous reports on teleosts and mammals [30,31]. Moreover, signal peptide prediction showed that none of the three CgSOCS has a putative signal peptide, suggesting that they could be part of a family of intracellular proteins. Consistent with their mammalian counterparts, structural analysis of the CgSOCS genes showed that they possess a Src homology 2 (SH2) domain and a SOCS box domain, which enable these proteins to negatively regulate the JAK-STAT signaling pathway. This observation suggests that the two domains are highly evolutionarily conserved and are functionally important. Our phylogenetic analysis revealed that the SOCS gene family could be clearly divided into two subfamilies: types I and II. The type I SOCS subfamily consists of SOCS4, 5, 6, and 7, and the type II subfamily includes CISH and SOCS1, 2, and 3. CgSOCS5 and CgSOCS7 group with the other SOCS5 and SOCS7 proteins in separate clades, which is in agreement with previous studies [18,32]. Moreover, CgSOCS2, together with SOCS2 from the invertebrates P. fucata, R. philippinarum, Saccoglossus kowalevskii, H. discus discus, and Haliotis diversicolor, first clustered with the SOCS1 proteins and then formed an independent sister group to the vertebrate SOCS2 and CISH proteins. They might all originate from repeated duplication of one primordial SOCS gene. These results suggest that there were common ancestors of the type I and type II subfamilies, which is not consistent with a previous report that the type I subfamily members were more primitive than those of type II subfamily [32]. Expression pattern analysis of the CgSOCS genes in various tissues showed that the CgSOCS were constitutively expressed in all examined tissues and were highly expressed in immune-related tissues, such as the hemocytes, gills and digestive gland. This is in agreement with previous results in Oncorhynchus mykiss, E. sinensis, and R. philippinarum. A higher expression level of O. mykiss SOCS3 was detected in the head, kidney, spleen, intestine and gills [32]. In E. sinensis, a high expression level of SOCS2 was observed in the gills and hepatopancreas [18]. In R. philippinarum, a high expression level of SOCS2 was found in the gills and hemocytes [20]. Overall, the hemocytes, gills, and digestive gland, which are three important tissues in oyster innate immunity, are the major sites of CgSOCS expression. These expression characteristics indicate that the CgSOCS may play important roles in the innate immune system of the Pacific oyster. SOCS proteins have been identified as intracellular, inducible feedback inhibitors with crucial importance in the limitation of inflammatory responses in mammals [5]. However, few studies about the functions of SOCS in the immune defense responses of invertebrates, and especially marine invertebrates, have been reported. Therefore, we characterized the expression pattern of CgSOCS in hemocytes in response to stimulation with PAMPs. Overall, in C. gigas hemocytes, CgSOCS showed high expression and strong responses to multiple PAMPs. CgSOCS2 and CgSOCS7 expression increased significantly in response to all PAMP
J. Li et al. / Fish & Shellfish Immunology 44 (2015) 525e532
529
Fig. 1. Phylogenic analysis of the CgSOCS and selected SOCS family proteins using the Neighbor-Joining method in MEGA5 based on sequence alignments using ClustalW (1.81). Numbers indicate the bootstrap confidence values of 1000 replicates.
530
J. Li et al. / Fish & Shellfish Immunology 44 (2015) 525e532
Fig. 2. Relative expression levels of the CgSOCS in hemocytes, gonad, heart, adductor muscle, mantle, gills, and digestive gland. A) CgSOCS2, B) CgSOCS5, C) CgSOCS7. Vertical bars represent the mean ± S.D. (N ¼ 3).
challenges except b-1,3-glucan, indicating that CgSOCS have comprehensive roles in defense against viruses and bacteria but have lost these roles in combating fungi. CgSOCS5 had strong, broad responses to the LPS and HKVA challenges, but it did not respond to PGN and HKLM stimulation, suggesting the involvement of CgSOCS in the immune response against Gram-negative, but not Grampositive, bacteria. Similarly, previous studies have demonstrated
Fig. 3. The temporal expression of CgSOCS in response to PAMP challenges. A) CgSOCS2, B) CgSOCS5, C) CgSOCS7. Vertical bars represent the mean ± S.D. (N ¼ 5). One asterisk indicates a significant difference at p < 0.05, and two asterisks indicate a significant difference at p < 0.01 between the challenged and control groups at the same time point.
J. Li et al. / Fish & Shellfish Immunology 44 (2015) 525e532
531
of China (2013J2200095), and Joint Funds of NSFC-Guangdong of China (U1201215). Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.fsi.2015.03.022. References
Fig. 4. The effects of CgSOCS expression on the activity of an NF-kB reporter gene. NFkB reporter plasmids were co-transfected into HEK293T cells with the indicated quantities of CgSOCS plasmids. Luciferase assays used a dual-luciferase reporter assay system. One asterisk indicates a significant difference at p < 0.05, and two asterisks indicate a significant difference at p < 0.01.
increased expression of SOCS under LPS or poly(I:C)-stimulation in E. sinensis, P. fucata, H. discus discus, and R. philippinarum [18e20,33]. The significant up-regulation of CgSOCS in response to PAMPs indicated that CgSOCS were inducible, multifunctional factors that were involved in the immune defense response of Pacific oyster. To elucidate the involvement of CgSOCS in the regulation of the NF-kB signaling pathway, CgSOCS expression vectors, together with an NF-kB reporter gene, were used to assess this activation ability. Due to the absence of a bivalve mollusk cell lines and successful activated an NF-kB reporter gene in HEK293T cells in our previous studies, we tested the transcriptional activation activity of CgSOCS using HEK293T cells [34]. Dual-luciferase reporter assays showed that the over-expression of CgSOCS2 and CgSOCS7, but not of CgSOCS5, can activate the NF-kB reporter gene. This finding is in accordance with results obtained from pearl oyster and mouse, in which SOCS were also found to enhance NF-kB-dependent transactivation [33,35]. These results suggest that CgSOCS2 and CgSOCS7 can trigger the activation of the NF-кB signaling pathway in HEK293T cells, whereas CgSOCS5 might have lost this function. In conclusion, three SOCS genes, SOCS2, 5 and 7, have been identified in the Pacific oyster. Tissue-specific expression analysis showed that the CgSOCS were constitutively expressed in all examined tissues, with highest expression in immune-related tissues. The induction of the CgSOCS in response to PAMP challenges in C. gigas indicates that the CgSOCS are likely to be important components of the immune response to pathogen infection. Moreover, over-expression of CgSOCS2 and CgSOCS5 can enhance NF-кB reporter gene transcriptional activity. This evidence will provide new insights to better understand how cytokine signaling negatively regulates the immune system of the Pacific oyster. Acknowledgments This work was supported by the National Natural Science Foundation of China (41176150 and 41306145), the Program of the Pearl River Young Talents of Science and Technology in Guangzhou
[1] S. Ilangumaran, S. Ramanathan, R. Rottapel, Regulation of the immune system by SOCS family adaptor proteins, Semin. Immunol. 16 (2004) 351e365. [2] A. Yoshimura, T. Naka, M. Kubo, SOCS proteins, cytokine signalling and immune regulation, Nat. Rev. Immunol. 7 (2007) 454e465. [3] N.J. Kershaw, J.M. Murphy, I.S. Lucet, N.A. Nicola, J.J. Babon, Regulation of janus kinases by SOCS proteins, Biochem. Soc. Trans. 41 (2013) 1042e1047. [4] W.S. Alexander, Suppressors of cytokine signalling (SOCS) in the immune system, Nat. Rev. Immunol. 2 (2002) 410e416. [5] A. Dalpke, K. Heeg, H. Bartz, A. Baetz, Regulation of innate immunity by suppressor of cytokine signaling (SOCS) proteins, Immunobiology 213 (2008) 225e235. [6] L.N. Akhtar, E.N. Benveniste, Viral exploitation of host SOCS protein functions, J. Virol. 85 (2011) 1912e1921. [7] B.A. Croker, H. Kiu, S.E. Nicholson, SOCS regulation of the JAK/STAT signalling pathway, Semin. Cell Dev. Biol. 19 (2008) 414e422. [8] A. Yoshimura, T. Ohkubo, T. Kiguchi, N.A. Jenkins, D.J. Gilbert, N.G. Copeland, et al., A novel cytokine-inducible gene CIS encodes an SH2-containing protein that binds to tyrosine-phosphorylated interleukin 3 and erythropoietin receptors, EMBO J. 14 (1995) 2816e2826. [9] T.A. Endo, M. Masuhara, M. Yokouchi, R. Suzuki, H. Sakamoto, K. Mitsui, et al., A new protein containing an SH2 domain that inhibits JAK kinases, Nature 387 (1997) 921e924. [10] A. Mansell, R. Smith, S.L. Doyle, P. Gray, J.E. Fenner, P.J. Crack, et al., Suppressor of cytokine signaling 1 negatively regulates Toll-like receptor signaling by mediating Mal degradation, Nat. Immunol. 7 (2006) 148e155. [11] S. Gingras, E. Parganas, A. de Pauw, J.N. Ihle, P.J. Murray, Re-examination of the role of suppressor of cytokine signaling 1 (SOCS1) in the regulation of toll-like receptor signaling, J. Biol. Chem. 279 (2004) 54702e54707. [12] A. Baetz, S. Zimmermann, A.H. Dalpke, Microbial immune evasion employing suppressor of cytokine signaling (SOCS) proteins, Inflamm. Allergy Drug Targets 6 (2007) 160e167. [13] P.K. Wong, P.J. Egan, B.A. Croker, K. O'Donnell, N.A. Sims, S. Drake, et al., SOCS3 negatively regulates innate and adaptive immune mechanisms in acute IL1-dependent inflammatory arthritis, J. Clin. Invest. 116 (2006) 1571e1581. [14] B.M. Zhu, Y. Ishida, G.W. Robinson, M. Pacher-Zavisin, A. Yoshimura, P.M. Murphy, et al., SOCS3 negatively regulates the gp130-STAT3 pathway in mouse skin wound healing, J. Invest. Dermatol. 128 (2008) 1821e1829. [15] D.L. Krebs, D.J. Hilton, SOCS proteins: negative regulators of cytokine signaling, Stem Cells 19 (2001) 378e387. [16] J. Piessevaux, D. Lavens, T. Montoye, J. Wauman, D. Catteeuw, J. Vandekerckhove, et al., Functional cross-modulation between SOCS proteins can stimulate cytokine signaling, J. Biol. Chem. 281 (2006) 32953e32966. [17] J.S. Rawlings, K.M. Rosler, D.A. Harrison, The JAK/STAT signaling pathway, J. Cell Sci. 117 (2004) 1281e1283. [18] Y. Zhang, J. Zhao, H. Zhang, Y. Gai, L. Wang, F. Li, et al., The involvement of suppressors of cytokine signaling 2 (SOCS2) in immune defense responses of Chinese mitten crab Eriocheir sinensis, Dev. Comp. Immunol. 34 (2010) 42e48. [19] M. De Zoysa, J. Lee, Suppressor of cytokine signaling 2 (SOCS-2) homologue in disk abalone: cloning, sequence characterization and expression analysis, Fish Shellfish Immunol. 26 (2009) 500e508. [20] Y. Lee, J.Y. Choi, C. Oh, D.H. Kang, S.Y. Choi, G.J. Heo, et al., Molecular cloning and characterization of SOCS-2 from Manila clam Ruditapes philippinarum, Fish Shellfish Immunol. 36 (2014) 453e458. [21] Y. Zhang, Z. Zhou, L. Wang, R. Liu, L. Song, The suppressor of cytokine signaling 2 (SOCS2) modulating the neurotransmitters release in Eriocheir sinensis, Fish Shellfish Immunol. 35 (2013) 101e106. [22] X. He, Y. Zhang, Z. Yu, An Mpeg (macrophage expressed gene) from the Pacific oyster Crassostrea gigas: molecular characterization and gene expression, Fish Shellfish Immunol. 30 (2011) 870e876. [23] F. Yu, Y. Zhang, Z. Yu, Characteristics and expression patterns of the lipopolysaccharide-induced TNF-alpha factor (LITAF) gene family in the Pacific oyster, Crassostrea gigas, Fish Shellfish Immunol. 33 (2012) 899e908. [24] J. Vandesompele, K. De Preter, F. Pattyn, B. Poppe, N. Van Roy, A. De Paepe, et al., Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes, Genome Biol. 3 (2002). RESEARCH0034. [25] M. Yoneyama, T. Fujita, Function of RIG-I-like receptors in antiviral innate immunity, J. Biol. Chem. 282 (2007) 15315e15318. [26] D.J. Philpott, S.E. Girardin, Nod-like receptors: sentinels at host membranes, Curr. Opin. Immunol. 22 (2010) 428e434. [27] K. Takeda, S. Akira, Toll-like receptors in innate immunity, Int. Immunol. 17 (2005) 1e14.
532
J. Li et al. / Fish & Shellfish Immunology 44 (2015) 525e532
[28] A. Dalpke, K. Heeg, Suppressors of cytokine signaling proteins in innate and adaptive immune responses, Arch. Immunol. Ther. Exp. Warsz. 51 (2003) 91e103. [29] H. Yasukawa, A. Sasaki, A. Yoshimura, Negative regulation of cytokine signaling pathways, Annu. Rev. Immunol. 18 (2000) 143e164. [30] S. Wormald, J.G. Zhang, D.L. Krebs, L.A. Mielke, J. Silver, W.S. Alexander, et al., The comparative roles of suppressor of cytokine signaling-1 and -3 in the inhibition and desensitization of cytokine signaling, J. Biol. Chem. 281 (2006) 11135e11143. [31] Z.G. Xiao, H. Liu, J.P. Fu, W. Hu, Y.P. Wang, Q.L. Guo, Cloning of common carp SOCS-3 gene and its expression during embryogenesis, GH-transgene and viral infection, Fish Shellfish Immunol. 28 (2010) 362e371.
[32] T. Wang, C.J. Secombes, Rainbow trout suppressor of cytokine signalling (SOCS)-1, 2 and 3: molecular identification, expression and modulation, Mol. Immunol. 45 (2008) 1449e1457. [33] W.G. Liu, X.D. Huang, Q. Wang, M. Zhao, S.Z. Wu, M.X. He, Gene cloning and function analysis of cytokine-induced suppressor of cytokine signaling (SOCS) from pearl oyster Pinctada fucata, Fish Shellfish Immunol. 34 (2013) 849e854. [34] Y. Zhang, X. He, Z. Yu, Two homologues of inhibitor of NF-kappa B (IkappaB) are involved in the immune defense of the Pacific oyster, Crassostrea gigas, Fish Shellfish Immunol. 30 (2011) 1354e1361. [35] S.H. Park, K.E. Kim, H.Y. Hwang, T.Y. Kim, Regulatory effect of SOCS on NFkappaB activity in murine monocytes/macrophages, DNA Cell Biol. 22 (2003) 131e139.
