Fish & Shellfish Immunology 43 (2015) 249e256

Contents lists available at ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Full length article

Cloning and characterization of the proximal promoter region of rainbow trout (Oncorhynchus mykiss) interleukin-6 gene Merle D. Zante, Andreas Borchel, Ronald M. Brunner, Tom Goldammer, Alexander Rebl* Leibniz Institute for Farm Animal Biology (FBN), Institute of Genome Biology, Wilhelm-Stahl-Allee 2, 18196 Dummerstorf, Germany

a r t i c l e i n f o

a b s t r a c t

Article history: Received 29 October 2014 Received in revised form 15 December 2014 Accepted 18 December 2014 Available online 27 December 2014

Interleukin-6 (IL6) is a pleiotropic cytokine with important immunoregulatory functions. Its expression is inducible in immune cells and tissues of several fish species. We also found that IL6 mRNA abundance was significantly increased in spleen, liver, and gill of rainbow trout after experimental infection with Aeromonas salmonicida. Genomic DNA sequences of IL6 orthologs from three salmonid species revealed a conserved exon/intron structure and a high overall nucleotide identity of >88%. To uncover key mechanisms regulating IL6 expression in salmonid fish, we amplified a fragment of the proximal IL6 promoter from rainbow trout and identified in-silico conserved binding sites for NF-kB and CEBP. The activity of this IL6 promoter fragment was analyzed in the established human embryonic kidney line HEK-293. Luciferase- and GFP-based reporter systems revealed that the proximal IL6 promoter is activated by Escherichia coli. Essentially, both reporter systems proved that NF-kB p50, but not NF-kB p65 or CEBP, activates the IL6 promoter fragment. Truncation of this fragment caused a significant decrease in IL6 promoter activation. This characterization of the proximal promoter of the IL6-encoding gene provides basic knowledge about the IL6 gene expression in rainbow trout. © 2014 Elsevier Ltd. All rights reserved.

Keywords: Cytokines IL6 Luciferase reporter assay NF-kB p50 Teleost

1. Introduction The fish's ability to cope with pathogens is decisive for the commercial success in aquaculture. For the future development of better diagnostic tools and vaccines, the knowledge about basic principles of the teleost immune system is indispensable. Interleukins (IL) comprise the largest group of cytokines and are crucial components of both adaptive and innate immune responses [1]. They are synthesized and secreted by different cell types and have been shown to conduct pleiotropic functions. The proinflammatory interleukins IL1, IL6, and IL8 are immediateearly induced [2] upon the pathogen-depended activation of pattern recognition receptors (PRR) including the wellinvestigated family of Toll-like receptors (TLRs). Once the PRR is activated, a signaling cascade is triggered, which in turn activates

Abbreviations: Aa, amino acids; CEBP, CCAAT/enhancer-binding protein; CREB, cAMP response element-binding protein; GFP, green fluorescent protein; HEK, human embryonic kidney; LUC, luciferase; MCS, multiple cloning site; NF-kB, nuclear factor of kappa light chain gene enhancer in B cells; PBS, phosphate buffered saline; qRT-PCR, real-time quantitative reverse transcriptase polymerase chain reaction; TBP, TATA-binding protein; wt, wild-type. * Corresponding author. Tel.: þ49 3820868721. E-mail address: [email protected] (A. Rebl). http://dx.doi.org/10.1016/j.fsi.2014.12.026 1050-4648/© 2014 Elsevier Ltd. All rights reserved.

immune-relevant transcription factors [2], either AP1 transcriptional activators, interferon regulatory factors, CRE-binding proteins (CREB) or members of the nuclear factor kappa B (NF-kB) family [3]. The mammalian NF-kB proteins p65/RELA, RELB, REL, p50/NFKB1, and p52/NFKB2 share a highly conserved DNAbinding and a dimerization domain allowing for homo- or heterodimerization [4]. The canonical activating NF-kB dimer is composed of p50 and p65. Besides, the functional synergism of NF-kB p50:p65 and members of the CCAAT/enhancer-binding protein (CEBP) family has been reported [5,6]. CEBP proteins are as well equipped with a DNA-binding region and a dimerization domain to eventually regulate cellular differentiation and respond to inflammatory stimuli [7]. Several interleukins have been characterized in rainbow trout [8], including the proinflammatory chemokines IL6 [9], and multiple gene variants of IL1B [10,11] and IL8 [12e14]. IL6 occupies a central role in fish immunity [15,16] since it acts as a proinflammatory agent in response to microbial infections or parasites [17e20] promoting acute-phase reactions, hematopoiesis, and immune cell differentiation [21]. Besides, IL6 might also act as an energy sensor as demonstrated in mammals [22]. This pleiotropic interleukin is hence considered as a molecular marker to identify resistant fish and to monitor fish health and immune responses under the influence of drugs and vaccines [23].

250

M.D. Zante et al. / Fish & Shellfish Immunology 43 (2015) 249e256

The knowledge about the molecular regulation of interleukin promoters in fish is poor. However, studies on the promoter of the IL6-encoding gene have been carried out for Olive flounder Paralichthys olivaceus [24] and gilthead seabream Sparus aurata [25] revealing relevant binding sites for NF-kB and CEBPB (also known as NF-IL6) close to the translational start as reported for mammals one decade earlier [26,27]. We present here the genomic sequence of the IL6 gene from rainbow trout Oncorhynchus mykiss including the structure of its proximal promoter. Concluding from reporter gene assays, we provide evidence for its induction by Escherichia coli, mediated through NF-kB p50 in a cell model. 2. Materials and methods 2.1. Amplification of IL6-encoding genes from salmonids Genomic DNA was separately extracted from kidney tissue of rainbow trout (O. mykiss; strain Steelhead) and maraena whitefish (Coregonus maraena), respectively, using the DNeasy Blood & Tissue Kit (Qiagen, Hilden, Germany). Genomic DNA extracted from male Atlantic salmon (Salmo salar) was purchased from Zyagen (GFS190M; Zyagen, San Diego, CA, USA). For identification of the exon/ intron structure of the trout IL6-encoding gene, the oligonucleotide pairs OM_IL6-PCR_F and -R (Table 1) were derived from the published cDNA sequence (GenBank accession DQ866150; [9]). A ~1920-bp fragment of trout IL6 gene was amplified in a standard PCR utilizing HotStarTaq® Plus DNA Polymerase (Qiagen) and then sequenced (Applied Biosystems® 3130 Genetic Analyzer; Life Technologies, Karlsruhe, Germany). This sequence was used to derive oligonucleotides for the isolation of IL6 genes from salmon and whitefish (Table 1) utilizing the Q5® Hot Start High-Fidelity 2X Master Mix (New England BioLabs®, Ipswich, MA, USA) following a touch-down PCR protocol. Each nucleotide position was sequenced at least three times. NCBI and Ensembl BLAST searches were conducted to find ortholog sequences for exon/intron structure comparisons. 2.2. Cloning of the proximal promoter sequence of rainbow trout IL6 gene DNA isolated from trout kidney served as template for establishing Genome Walking libraries for rainbow trout with the BD GenomeWalker™ Universal Kit (BD Biosciences, Erembodegem, Belgium) as instructed in the kit manual. In brief, libraries were constructed using the restriction enzymes EcoRV, DraI, PvuII and StuI. The obtained fragments were ligated to linker sequences. A

primary PCR was performed utilizing HotStarTaq® Plus DNA Polymerase (Qiagen) and the outer adapter primer AP1 and the genespecific oligonucleotide OM_IL6_R1 (Table 1). The secondary PCR applied the inner adapter primer AP2 combined with a further gene-specific oligonucleotide OM_IL6_R2 (Table 1). The retrieved ~960-bp amplificate was cloned into the pGEM®-T Easy Vector (Promega, Mannheim, Germany) and sequenced. To validate the authenticity of that proximal promoter sequence, we amplified a fragment from genomic rainbow trout DNA using the oligonucleotides OM_IL6_PromGene_F and -R (Table 1) in a standard PCR reaction and sequenced it. The MatInspector program (Genomatix Software GmbH, Munich, Germany; http://www.genomatix.de) [28] predicted putative 50 cis-regulatory elements in this proximal promoter fragment. 2.3. Quantification of infection-modulated expression of trout IL6 gene To quantify the modulation of IL6 mRNA abundance in trout during infection, rainbow trout (strain Steelhead) had been infected with lethal doses of Aeromonas salmonicida ssp. salmonicida (wildtype strain JF 2267) as described previously [29]. In brief, one group of fish (n ¼ 30) was infected by peritoneal injection with 200 ml PBS (Phosphate buffered saline) containing 1  107 A. salmonicida; a control group (n ¼ 5) received 200 ml PBS only. Peritoneal injection and anaesthetization of rainbow trout were approved by the Animal Care Committee of the State Mecklenburg Western Pommerania (Landesamt für Landwirtschaft, Lebensmittelsicherheit und Fischerei, Mecklenburg-Vorpommern, Germany; LALLF M-V/TSD/ 7221.3-2.5-008/10). Total RNA was extracted from spleen, liver, and gills of four trout per time point (0, 6, 12, and 72 hours postinfection; hpi) (RNeasy® Mini Kit; Qiagen). Samples were individually transcribed into cDNA using an oligo-d(T) primer [25 pmol/ml] and the Super Script™ II kit (Invitrogen/Life Technologies, Karlsruhe, Germany). A cDNA equivalent of 75 ng total RNA was quantitatively analyzed on the LightCycler® 96 System (Roche, Basel, Switzerland) using the SensiFAST™ SYBR No-ROX Kit (Bioline, Luckenwalde, Germany). Oligonucleotides with a primer efficiency of 89% amplified a 174-bp fragment of the target gene IL6 (Table 1). EEF1A1 was used as an endogenous housekeeping reference gene for data normalization [30]. Melting curve analyses indicated for every sample single products (TmIL6: ~85  C). Additionally, PCR products were visualized on 3% agarose gels in order to assess product size and quality. Standard curves were generated based on the crossing point (CP) values of 10-fold dilutions of the respective PCR-generated fragments (103 to 106 copies). The absolute copy number was calculated on the basis of linear regression of the

Table 1 Gene-specific primers used in the present study. Application

Primer name

Sequence (50 / 30 )a

Position within GenBank entry

Isolation of trout genomic IL6 sequence

OM_IL6-PCR_F OM_IL6-PCR_R SS_IL6-PCR_F SS_IL6-PCR_R CM_IL6-PCR_F CM_IL6-PCR_R OM_IL6-LC_F OM_IL6-LC_R OM_IL6_R1 OM_IL6_R2 OM_IL6-ProxProm_F OM_IL6-PromGene_R OM_IL6-Xho_F OM_IL6-Hind_R

CAGGAGCATCACTGGACACAGA GGAAGTCTTTGCCCCTCTTTCC AGCATCACTGGACACAGAGCC ACACTGCAAGTTTCTGTTCCAGG CAGAGCCTACAAATAATTAACTGGAAC ATAACACACCCTCTGCCCACA CAGCTTCTTCTTCAGCACGTTAA CGTAGACACCTCACCCAGAAC GCAAGGTGGTTACCTCGTGG TCCGGAGGTCATGAGCTCAGC ATCTGTGATGAATTGAGAGAATTC CTGAAAGGAGGGGAAGAGGAGAA CCGCTCGAGATCTGTGATGAATTGAGAGAATTC ACTGAAGCTTGCTCTGTGTCCAGTGATGCTCC

725e746 in HF913655 2663e2642 in HF913655 Flanking sequence LN624512

Isolation of salmon genomic IL6 sequence Isolation of whitefish genomic IL6 sequence Quantification of trout IL6 transcripts Genome Walking for trout IL6 gene Validation of trout IL6 promoter sequence Wild-type IL6 promoter reporter assay a

Restriction sites are underlined.

Flanking sequence LN624511 2171e2196 in HF913655 2548e2528 in HF913655 1061e1042 in HF913655 961e941 in HF913655 1e24 in HF913655 878e856 in HF913655 1e24 in HF913655 748e727 in HF913655

M.D. Zante et al. / Fish & Shellfish Immunology 43 (2015) 249e256

standard curve (coefficient of determination, R2 ¼ 0.9994). Each target gene expression value was divided by the geometric mean of the reference gene values. Student's t-test was used to evaluate the significance of different mean values. p < 0.05 were considered as significant, p < 0.01 as highly significant. 2.4. Generation of IL6 promoter-driven reporter constructs We designed oligonucleotides to flank the IL6 promoter fragment from rainbow trout with restriction sites for XhoI (OM_IL6_Xho_F1, Table 1) and HindIII (OM_IL6_Hind_R1), in order to insert this fragment into promoterless reporter vectors, either the green fluorescent protein (GFP) expression vector pAcGFP1-1 (Clontech/Takara, Saint-Germain-en-Laye) or the firefly luciferase (LUC) expression vector pGL3-Basic (Promega). The PCR-generated IL6 promoter fragment was first subcloned into pGEM®-T Easy Vector (Promega). Subsequently, the fragment was retrieved by XhoI and HindIII restriction at 37  C overnight, purified (High Pure PCR Product Purification Kit; Roche) and inserted in frame into the multiple cloning site (MCS) of the reporter vectors, previously double-digested with the same restriction enzymes. This 748-bp promoter subclone (wild-type IL6; 693 to þ57 bp) was the starting point for establishing a shorter variant (‘short IL6’ construct; 232 to þ57 bp) employing a KpnI restriction site at position 227 to 232 within the proximal IL6 promoter fragment and the 30 -flanking HindIII restriction site. The resulting 289-bp fragment was also cloned into both reporter vectors. All plasmid DNAs used for transfection experiments were prepared with endotoxin-free solutions and water using the EndoFree® Plasmid Maxi Kit (Qiagen, Hilden, Germany) or the ZR Plasmid Miniprep™ e Classic (Zymo Reseach, Freiburg, Germany). These constructs were additionally sequenced to validate their correctness. 2.5. Functional characterization of the IL6 promoter using a heterologous HEK-293 cell system The human embryonic kidney cell line HEK-293 does not express TLR2 and several other PRRs, while it features the required downstream factors allowing a productive signal transduction. This cell line has therefore been widely used to investigate molecular mechanisms regulating pathogen-specific signal transduction, also in fish [32e34]. Transient expression of immune factors from cattle in HEK-293 revealed that the E. coli-induced massive NF-kB activation is mediated by TLR2 signaling [29,35] and allows in turn the activation of promoter fragments from rainbow trout [14,31]. To this end, we transfected HEK-293 cells with a trout IL6 promoter construct together with the bovine TLR2 expression clone (constructed as described in Ref. [35]) to investigate the impact of the Gram-negative microorganism E. coli on the activation of the respective promoter fragment. Alternatively, we determined the potential of distinct transcription factors to induce the proximal IL6 promoter. These transcription factors included NF-kB p50, p65, and CEBPB in pGL3-Basic vector (Promega), which have been constructed as described in Ref. [36]. 2.5.1. HEK-293 cell culture and transfection HEK-293 cells were cultured in Eagle's Minimum Essential Medium (EMEM; SigmaeAldrich, Taufkirchen, Germany) supplemented with 10% fetal calf serum (FCS; PAN, Aidenbach, Germany), 1% non-essential amino acids (NEAA; Biochrom AG, Berlin, Germany), and 2 mM L-glutamine (Biochrom AG). The cells were maintained in 5% CO2 at 37  C.

251

For the visualization of successful promoter induction, 1000 ng of the wild-type (wt) or short IL6 promoter in the GFP reporter plasmid AcGFP1-1 were either co-transfected with 1000 ng of plasmids expressing the bovine factors NF-kB p50, p65, and CEBPB or with 100 ng TLR2 expression plasmid for subsequent stimulation with E. coli, as described below. Control cells were transfected with promoterless pAcGFP1-1 together with the respective factorencoding plasmids. Twenty-four hours post-transfection, cells were observed using live-cell imaging technique. To quantify the IL6 promoter-driven LUC expression, we cotransfected 50 ng of the LUC reporter plasmid (wt- or short IL6 promoter in pGL3-Basic) and 103000 ng of plasmids expressing the bovine factors NF-kB p50, p65, and CEBPB, either single or in various combinations. In a second approach, HEK cells were transfected with 50 ng of LUC reporter plasmid DNA alone or together with 100 ng bovine TRL2 for later E. coli stimulation. Filling up with the empty expression vector pcDNA3.1(þ) ensured that the total DNA amount of transfected DNA was kept constant. Endotoxin-free plasmid DNAs were diluted in serum-free EMEM (SigmaeAldrich). Lipofectamine™ 2000 Transfection Reagent (Life Technologies) was added to the DNA mix, incubated and added to the HEK-293 cells as per instructions of manufacturer. Twenty-four hours post-transfection, cells were either harvested for luciferase measurements or induced with 30 mg heat-inactivated E. coli (strain XL1 blue; Stratagene, La Jolla, CA, USA) per ml medium (about 1  107 bacteria/ml). Half of the cultures were kept as unstimulated controls. Cells were harvested 24 h later for luciferase measurements. 2.5.2. Live-cell imaging Fluorescence microscopic observation was performed 24 h posttransfection to examine the expression of the green fluorescent protein AcGFP. In case of stimulation with heat-inactivated E. coli, HEK-293 cells were observed 24 h post-transfection. Cells were analyzed with the confocal microscope Zeiss Axio Observer Z1 (Carl Zeiss Microscopy, Oberkochen, Germany) with a 10 DIC objective. The presented experiments were conducted at least three times. 2.5.3. Luciferase assay Luciferase assays were performed on the Lumat LB 9501 luminometer (Berthold GmbH, Bad Wildbad, Germany) using the Dual-Luciferase® Reporter Assay System (Promega, Mannheim, Germany). Ten microliter cell lysate were diluted in 100 ml Luciferase Assay Reagent II (LAR II) to measure the relative light units (RLU). RLU data were normalized against the protein content determined at the NanoDrop ND-1000 Spectrophotometer (NanoDrop Technologies, Wilmington, Delaware, USA) and are given below as relative average values ± standard deviations (SD). Obtained results are based on at least three independent transfection experiments performed in triplicate. GraphPad Prism® v5.01 (GraphPad Software, La Jolla, CA, USA) was used to evaluate the significance of different mean values with one-way analysis of variance (ANOVA) followed by Tukey's posthoc test choosing significance levels equal to 0.001, 0.01, or 0.05. 3. Results and discussion 3.1. The exon/intron structure of IL6 orthologs is conserved in bony fish IL6 is a major cytokine mediator of the acute-phase or stress response [37] in mammals and fish [16,21]. The cDNA sequence of the IL6-encoding gene from rainbow trout O. mykiss was discovered in 2007 [9] and published under GenBank accession code

252

M.D. Zante et al. / Fish & Shellfish Immunology 43 (2015) 249e256

Table 2 IL6 exon and intron lengths (in bp) and sequence identities (in %) in trout O. mykiss compared to its orthologs in salmon S. salar and whitefish C. maraena. Gaps were excluded from identity calculation. (For better readability, intron characteristics were printed in italics.). Sequence length (bp) O. mykiss exon 1a intron 1 exon 2 intron 2 exon 3 intron 3 exon 4 intron 4 exon 5b cDNA gDNA a b

S. salar

Sequence identity (%) O. mykiss

S. salar

C. maraena

19 90 194 657 111 288 144 204 192

19 102 203 679 111 295 144 226 192

C. maraena 19 103 203 121 111 296 144 198 192

100 100 100 100 100 100 100 100 100

95 92 95 91 97 93 97 93 97

89 79 90 89 94 89 94 83 94

660 1899

669 1971

669 1387

100 100

97 94

93 88

50 UTR was excluded for sequence comparison. 30 UTR was excluded for sequence comparison.

DQ866150. Complementing this structural information, we investigated the genomic organization of trout IL6 gene (deposited as HF913655). A 2668-bp fragment was amplified and sequenced revealing the presence of five exons (19 bp, 194 bp, 111 bp, 144 bp, 192 bp; Table 2; Suppl. Fig. 1, first row) interrupted by four introns (90 bp, 657 bp, 288 bp, 204 bp). Our subsequent analyses on genomic IL6 sequences from Atlantic salmon S. salar (deposited as LN624512) and maraena whitefish C. maraena (deposited as LN624511) revealed that the IL6 gene structure is conserved among salmonid fishes (Table 2). Exon 1, exon 3, exon 4 and exon 5 share the same lengths. Not only the exonic sequences are highly conserved with identities of not less than 89%, also the introns share a high degree of identity (at least 79%; Table 2), though in part introns vary strikingly in length. For instance, intron 2 is 558 bp shorter in whitefish IL6 gene compared to its ortholog in salmon. Nonetheless, all intronic flanking sequences follow the GT-AG splice recognition rule. Extending the comparison of genomic IL6 gene structures to orthologs from Atlantic halibut (Hippoglossus hippoglossus) [38], seabream (S. aurata) [39], Olive flounder (P. olivaceus) [40], pufferfish (Takifugu rubripes) [20], chicken (Gallus gallus) (AJ250838), and human (Homo sapiens) (NG_011640), indication is provided that the IL6-encoding sequence of almost all species is distributed across five exons, except for chicken (Suppl. Fig. 1). The length of the IL6 exons is similar in teleosts, however, only the length of exon 4 is conserved (comprising 144 bp). The length of the introns is variable, though smaller than 700 bp in each case. Altogether, IL6 gene structure is comparatively well-conserved among teleosts, while other cytokine genes such as IL1B or IL21 have obviously undergone exon fusion events in several fish species, reviewed in Ref. [8].

3.2. IL6 mRNA abundance is increased in various tissues after infection with A. salmonicida Fig. 1. IL6 mRNA abundance in trout after infection with A. salmonicida. Concentration of IL6 transcripts in spleen (dashed line, box symbols), liver (full line, circles), and gills (dotted line, triangles) at various times after infection was determined using quantitative Real-time PCR. The lines were fitted to the mean values (transcript numbers per 1 mg total RNA) at any one time. Asterisks above (spleen, liver) and below (gills) the symbols represent significant increase in IL6 copy number compared to 0 h control trout with p < 0.05 (*) and p < 0.01 (**), as determined by Student's t-test.

We used the information about the IL6 gene structure for designing oligonucleotides (spanning intron 4), in order to measure the level of IL6-encoding transcripts in rainbow trout before and after infection with high doses (1  107 cfu) of viable A. salmonicida bacteria. Quantitative Real-time PCR showed that IL6 transcript number was increased already 6 h post-infection (hpi) in spleen (37.5 ± 14.3-fold, p ¼ 0.03), liver (7.2 ± 4.0-fold, p ¼ 0.009), and gills (17.0 ± 9.0-fold, p ¼ 0.1) compared to PBS-injected controls

Fig. 2. Prediction of functional elements in the proximal promoter of the IL6-encoding gene from rainbow trout. Nucleotide positions are given relative to the transcriptional start (þ1). ‘Motif 1 to 5’ denote a repetitive 46-bp sequence at the 50 end of the isolated promoter fragment. Identical nucleotide positions within these repetitive motifs are highlighted with black underlay. Brackets indicate putative binding sites for NF-kB, CREB, CEBP, and TBP factors. An arrow marks the restriction site for KpnI (underlined) used for the generation of the ‘short IL6 promoter’ reporter constructs.

M.D. Zante et al. / Fish & Shellfish Immunology 43 (2015) 249e256

revealing a 56-fold higher IL6 mRNA abundance in spleen compared to gills of infected fish (Fig. 1). At later time points, IL6 copy number decreased in all tissues investigated within 72 hpi, although not recovering to the pre-infection level. This data together with findings of other researchers [23,25,38] indicate once more that the promoter of the teleostean IL6encoding gene is activated in different tissues at an early stage of infection. 3.3. The proximal promoter of the IL6-encoding gene from trout features binding sites for NF-kB and CEBP

253

this wt-IL6 reporter construct and the bovine TLR2 expression plasmid and cultured for 24 h in the presence of heat-inactivated E. coli (parallel to non-stimulated controls). Confocal microscopy revealed that AcGFP expression was clearly detectable in E. colistimulated cells, whereas non-stimulated cells showed only unspecific fluorescence signals (Fig. 3(A and B)). In a second step, the wt-IL6 promoter fragment was inserted into a LUC reporter vector, to validate and quantify this initial observation. Indeed, heat-killed E. coli provoked a 1.9-fold increment in IL6 promoter-driven LUC expression over the level of unstimulated control cells (p ¼ 0.005) and cells not having been co-transfected with TLR2 expression plasmids (p ¼ 0.002)

To uncover key factors regulating the IL6 expression in rainbow trout, we used Genome Walker methodology generating an IL6 gene fragment. This comprised a 691-bp sequence upstream of the transcriptional start, which had previously been determined by Iliev and co-workers [9]. Strikingly, the 50 end of this proximal promoter fragment includes the threefold repetition of a 46-bp motif with the consensus sequence ATCTGKGATGAATTGRGAGAAYTMCCMCAACCCTGAGCTAACTGTT (ambiguity bases follow the standard IUPAC nucleotide codes). A subsequent fourth repetition comprises only the first 33 bp (Fig. 2). Four binding sites for NF-kB (in antisense orientation) and one binding site for CEBP (in sense orientation) were predicted through the use of the MatInspector program. Three of those NF-kB sites are located within the repetitive sequence motifs (from positions 677 to 663; 632 to 618; and 540 to 526; ‘matrix similarity’ matching score: >0.8) (Fig. 2). The fourth NF-kB site overlaps with the binding motif for CEBP (from positions 60 to 34; ‘matrix similarity’ matching score: >0.94). These overlapping elements are directly followed by the consensus TATA box motif 50 -TATAAA-30 (from positions 33 to 28) recognized by TATA-binding proteins (TBP). Moreover, two cAMP responsive elements (CRE) were identified (Fig. 2; positions 409 to 395 and 316 to 296, ‘matrix similarity’ matching score: 0.89 and 0.74, respectively). The close adjacency of binding sites for CRE-binding proteins (CREB) and NF-kB/CEBP factors is obviously a shared feature in the proximal IL6 gene promoters from seabream S. aurata [25], flounder P. olivaceus [24] and also from mammals [41]. Nevertheless, the most essential activators of the IL6 promoter are presumably NF-kB and CEBP factors [42]. Partially overlapping NF-kB and CEBPbinding sites, located in close proximity to the transcriptional start site is a common, evolutionary conserved feature of promoters in cytokine and acute-phase genes [43]. So far, this composite NF-kB/ CEBP-binding motif upstream of the IL6-encoding gene has only been reported for mammals [26,27,44]. In seabream and flounder, NF-kB- and CEBP-binding sites are reported to be separated by about 110 bp [24,25]. However, the authors used a different software tool (TFSEARCH) to predict binding sites for transcriptional activators. The MatInspector program [28] analyzing the flounder's IL6 promoter fragment (DQ884914) revealed yet the presence of an overlapping CEBP/NF-kB-binding motif from positions 54 to 37 (‘matrix similarity’ matching score: >0.98). These alternate results based on different algorithms for predicting conserved motifs emphasize the necessity to corroborate in-silico results with experimental structure/function data. 3.4. The proximal promoter of the IL6-encoding gene is activated in response to E. coli We wanted to examine if TLR-mediated pathogen signal transduction activates the proximal promoter of the IL6-encoding gene. To this end, we inserted the proximal IL6 promoter into pAcGFP1-1, a promoterless vector, which allows monitoring of transcription from specific promoters. HEK-293 cells were co-transfected with

Fig. 3. Pathogen-dependent stimulation of IL6 promoter activity. HEK-293 cells were co-transfected with the wt-IL6-AcGFP construct and the vector expressing bovine TLR2. Parallel to the non-stimulated controls (A), cells were cultured with 30 mg/ml inactivated E. coli bacteria for 24 h (B) and GFP expression was visualized under confocal microscope. For IL6 promoter-driven LUC expression analysis (C), HEK cells were either transfected only with wt-IL6-LUC construct (hatched bar) or together with the vectors expressing bovine TLR2 (as indicated). Cells were stimulated with 30 mg/ ml E. coli for 24 h (black bar), control cultures remained unstimulated (gray bars). Error bars indicate SD. Double asterisks denote a statistically significant difference over controls (p < 0.01, using Student's t-test). The results are representative of three independent experiments, performed in triplicate.

254

M.D. Zante et al. / Fish & Shellfish Immunology 43 (2015) 249e256

(Fig. 3(C)). This IL6 promoter activation obviously depends on TLR signaling as we observed that the IL6 promoter fragment was not inducible in HEK cells lacking the TLR2 expression construct (data not shown). These results provide evidence for the inducibility of the proximal trout IL6 promoter and correspond to previous studies demonstrating that the transcriptional activation of the IL6 promoter in seabream and flounder is induced through pathogenassociated molecular patterns [24,25]. 3.5. NF-kB p50 activates the proximal promoter of the IL6-encoding gene Further reporter gene assays were employed to identify transcription factors with relevance for the activation of the trout IL6 gene. Preceding investigations proved the crucial importance of the synergistic interaction of NF-kB p50:p65 and CEBPB for the expression of IL6 in mammals [44] and in flounder [24]. As the proximal promoter fragment of the trout IL6-encoding gene harbors also binding sites for these factors, HEK-293 cells were cotransfected with the wt-IL6-AcGFP reporter construct together with vectors expressing either the mammalian NF-kB p65 or p50 factor or the mammalian CEBPB factor. Confocal microscopy revealed 24 h post-transfection that NF-kB p50 mediates a strong induction of the proximal IL6 promoter (Fig. 4, “wt-IL6-driven”). In contrast, a truncated IL6 promoter version, which lacks three 50 located NF-kB binding sites, though still bearing the overlapping NF-kB/CEBP site, was only modestly activated (Fig. 4, “short IL6driven”). In order to quantitatively determine the impact of potential transcription factors on IL6 promoter activity, we co-transfected the wt-IL6-LUC reporter construct together with vectors expressing NF-kB p50, p65 and CEBPB, either alone or in combination into HEK-293 cells (Fig. 5). Our analyses confirmed that only NF-kB p50 clearly enhanced the activity of trout wt-IL6 promoter (13.4 ± 4.1fold; p < 0.0001; Fig. 5(A), upper panel). The combination of NF-kB p50 with p65 and CEBPB decreased the impact of the p50 subunit on IL6 promoter activation down to about one-third. Transfection of increasing amounts (0.01e1 mg) of the vector expressing NF-kB p50 revealed that the activation of the wt-IL6 promoter occurs in a dose-dependent fashion with R2 ¼ 0.91

(Fig. 5(B)). On the other hand, also high amounts (1, 2, 3 mg) of both NF-kB p65 (Fig. 5(C)) and CEBPB factors (Fig. 5(D)) failed to activate the wt-IL6 promoter from trout. Assuming a prevalent importance of the NF-kB-binding sites, we wanted to assess to what extent the activation potential changes, when the IL6 promoter is truncated resulting in the loss of three 50 located NF-kB sites (short IL6 promoter). Consistent with our previous observation (Fig. 4), the short IL6 promoter was only slightly induced by NF-kB p50 (3.2 ± 0.6-fold; Fig. 5(A), lower panel) accounting for one quarter of that activation achieved on the wt-IL6 promoter fragment with its four putative NF-kB-binding sites. NFkB p65 induced both, wt- and short IL6 promoter at almost the same low level (2.4 ± 0.7-fold over controls). This observation was unexpected, as it had been demonstrated earlier that the IL6 promoter from flounder is strongly induced by NF-kB p65 [24]. The p65 subunit contains an extremely active transcriptional activation domain, whereas the p50 subunit does not [45]. Hence, NF-kB p50 might rather serve as a binding platform for further transcription factors [46,47] that apparently also contribute to the overall inducibility of this promoter. In this connection, reference should be made to the fact that we also found binding sites for CRE-binding proteins in the proximal promoter of the trout IL6 gene (Fig. 2). Indeed, TLR signaling activates both, CREB and NF-kB p50 [3,48] and crosstalk of both factors has been reported for mammals [49]. Prospective studies on fish IL6 promoters should consider the CREB/NF-kB p50 interaction. Regardless of potential transcription factor interactions, we demonstrated in a previous study that the bovine transcription factor NF-kB p50, but not p65 activates the trout IL8 promoter [14]. It has also been shown that the significance of NF-kB factors on cytokine promoters depends on the cell type: NF-kB p65 homodimers induce the IL8 promoter in human HEK-293 cells, but repress it in bovine mammary epithelial cells [36]. When activated through immune stimuli, bovine IL8 promoter rapidly recruits NFkB p50 replacing the p65 homodimer by a NF-kB p50:65 heterodimer [36]. We could not observe any impact of the bovine CEBPB factor on the activation of the trout IL6 promoter fragment. To exclude that binding of that mammalian CEBPB factor to the fish CEBP-binding site was impaired maybe due to species-specific conformational alterations, we substituted in parallel transfection assays the

Fig. 4. IL6 promoter-driven GFP expression mediated by NF-kB p50. HEK-293 cells were transfected with a GFP reporter plasmid (either the promoterless AcGFP1-1 plasmid or derivatives containing the wt- or the short IL6 promoter fragment; as indicated on the left margin) either alone (“control”) or together with expression plasmids for NF-kB p50, p65 and CEBPB (as indicated above the microscopic pictures) and visualized with a confocal microscope. The shown pictures are representative of at least three individual experiments.

M.D. Zante et al. / Fish & Shellfish Immunology 43 (2015) 249e256

255

Fig. 5. Impact of overexpressed transcription factors on trout IL6 promoter activity. (A) Schemes of the LUC reporter constructs are given on the left. Binding sites for CEBP (squares) and NF-kB (ovals) are indicated. HEK-293 cells were co-transfected with the wt- or short IL6 promoter-driven reporter constructs (upper or lower panel, respectively) and vectors expressing the bovine transcription factors NF-kB p50 (black columns), p65 (gray), CEBPB (black/white hatched), and combinations of these factors as indicated. Controls were transfected with empty vector. The activation of wt-IL6 promoter construct through increasing concentrations of NF-kB p50 (B), p65 (C), and CEBPB (D) was determined under comparative experimental settings. Control cultures (0 mg) were transfected only with the reporter construct. Graphs depict fold-change values (from three experiments, each assayed in triplicate) relative to the controls. Error bars indicate SD. Asterisks (***) denote statistical significance with p < 0.001 compared to controls, assessed with one-wayANOVA, followed by Tukey's post-hoc test.

expression plasmids encoding bovine CEBPB for constructs encoding trout CEBPB with obtaining similar results (not shown). This is in line with our previous findings about the functional conservation of the CEBPB factor in mammal and trout [14]. In the past few years, we performed reporter assays to investigate promoters of three innate immune genes from rainbow trout, SAA, IL8, and IL6. These promoters share overlapping binding motifs for NF-kB and for CEBPB located closely to the transcriptional start. These transcription factors are reported to synergistically activate gene expression in mammals as mentioned above. Though the respective binding motifs are structurally well-conserved in those three trout promoter fragments [43], they obviously failed to bind those transcription factors in our HEK-293 cell system. The overlapping NF-kB/CEBPB motif of the proximal SAA promoter was only inducible through NF-kB p65 [31], while the corresponding motif of the proximal IL8 promoter was activated through CEBPA [14]. The present study shows that neither NF-kB p65 nor CEBP factors allow a significant IL6 expression. Altogether, this indicates that either our inter-species HEK cell model is a less suitable tool to resolve issues regarding early immune mechanisms in trout or that these early immune

mechanisms underwent changes having affected decisive details of immune regulation during evolution. 4. Conclusions IL6 exerts a variety of physiological responses; particularly it is involved in inflammatory responses. We and others detected significantly increased amounts of IL6 transcripts early after infection of rainbow trout. Our analyses revealed that the transcriptional activation of the IL6 gene is induced by E. coli, mediated through NF-kB p50 and most likely further interaction factors. This characterization of the proximal promoter from trout IL6-encoding gene provides basic knowledge for a more detailed analysis in subsequent studies, which ought to utilize relevant model cells from salmonid fish. Acknowledgments € pel, A. Deike, We are grateful to L. Falkenthal, I. Hennings, B. Scho r and B. and M. Fuchs for excellent technical assistance. T. Koryta €llner (Friedrich-Loeffler-Institut, Institut für Immunologie, Ko

256

M.D. Zante et al. / Fish & Shellfish Immunology 43 (2015) 249e256

Greifswald, Insel Riems, Germany) are also gratefully acknowledged for performing the infection trial. We are indebted to Prof. H.-M. Seyfert for providing bovine expression plasmids as well as heat-inactivated E. coli and for helpful discussions during experimental performance. This work is funded by the European Social Fund (ESF) and the Ministry of Education, Science and Culture of Mecklenburg-Western Pomerania (Grant # AU11040 e DIREFO2). Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.fsi.2014.12.026. References [1] Kaiser P, Rothwell L, Avery S, Balu S. Evolution of the interleukins. Dev Comp Immunol 2004;28:375e94. [2] D'Elia RV, Harrison K, Oyston PC, Lukaszewski RA, Clark GC. Targeting the “cytokine storm” for therapeutic benefit. Clin Vaccine Immunol 2013;20: 319e27. [3] O'Neill LA, Golenbock D, Bowie AG. The history of Toll-like receptorsdredefining innate immunity. Nat Rev Immunol 2013;13:453e60. [4] Napetschnig J, Wu H. Molecular basis of NF-kB signaling. Annu Rev Biophys 2013;42:443e68. [5] Stein B, Baldwin Jr AS. Distinct mechanisms for regulation of the interleukin-8 gene involve synergism and cooperativity between C/EBP and NF-kappa B. Mol Cell Biol 1993;13:7191e8. [6] Mukaida N, Mahe Y, Matsushima K. Cooperative interaction of nuclear factorkappa-b-regulatory and cis-regulatory enhancer binding protein-like factor binding-elements in activating the Interleukin-8 gene by pro-inflammatory cytokines. J Biol Chem 1990;265:21128e33. [7] Lekstrom-Himes J, Xanthopoulos KG. Biological role of the CCAAT/enhancerbinding protein family of transcription factors. J Biol Chem 1998;273: 28545e8. [8] Secombes CJ, Wang T, Bird S. The interleukins of fish. Dev Comp Immunol 2011;35:1336e45. [9] Iliev DB, Castellana B, Mackenzie S, Planas JV, Goetz FW. Cloning and expression analysis of an IL-6 homolog in rainbow trout (Oncorhynchus mykiss). Mol Immunol 2007;44:1803e7. [10] Zou J, Grabowski PS, Cunningham C, Secombes CJ. Molecular cloning of interleukin 1beta from rainbow trout Oncorhynchus mykiss reveals no evidence of an ice cut site. Cytokine 1999;11:552e60. [11] Pleguezuelos O, Zou J, Cunningham C, Secombes CJ. Cloning, sequencing, and analysis of expression of a second IL-1beta gene in rainbow trout (Oncorhynchus mykiss). Immunogenetics 2000;51:1002e11. [12] Laing KJ, Zou JJ, Wang TH, Bols N, Hirono I, Aoki T, et al. Identification and analysis of an interleukin 8-like molecule in rainbow trout Oncorhynchus mykiss. Dev Comp Immunol 2002;26:433e44. [13] Fujiki K, Gauley J, Bols NC, Dixon B. Genomic cloning of novel isotypes of the rainbow trout interleukin-8. Immunogenetics 2003;55:126e31. r T, Goldammer T, Seyfert H-M. The proximal promoter [14] Rebl A, Rebl H, Koryta of a novel interleukin-8-encoding gene in rainbow trout (Oncorhynchus mykiss) is strongly induced by CEBPA, but not NF-kB p65. Dev Comp Immunol 2014;46:155e64. [15] Varela M, Dios S, Novoa B, Figueras A. Characterisation, expression and ontogeny of interleukin-6 and its receptors in zebrafish (Danio rerio). Dev Comp Immunol 2012;37:97e106. [16] Chen H-H, Lin H-T, Foung Y-F, Han-You Lin J. The bioactivity of teleost IL-6: IL6 protein in orange-spotted grouper (Epinephelus coioides) induces Th2 cell differentiation pathway and antibody production. Dev Comp Immunol 2012;38:285e94. [17] Heinecke RD, Buchmann K. Inflammatory response of rainbow trout Oncorhynchus mykiss (Walbaum, 1792) larvae against Ichthyophthirius multifiliis. Fish Shellfish Immunol 2013;34:521e8. € bis JM, Verleih M, Krasnov A, Jaros J, et al. Transcriptome [18] Rebl A, Koryt ar T, Ko profiling reveals insight into distinct immune responses to Aeromonas salmonicida in gill of two rainbow Trout strains. Mar Biotechnol (NY) 2014;16: 333e48. [19] Deshmukh S, Kania PW, Chettri JK, Skov J, Bojesen AM, Dalsgaard I, et al. Insight from molecular, pathological, and immunohistochemical studies on cellular and humoral mechanisms responsible for vaccine-induced protection of rainbow trout against Yersinia ruckeri. Clin Vaccine Immunol 2013;20: 1623e41. [20] Bird S, Zou J, Savan R, Kono T, Sakai M, Woo J, et al. Characterisation and expression analysis of an interleukin 6 homologue in the Japanese pufferfish, Fugu rubripes. Dev Comp Immunol 2005;29:775e89. [21] Jawa RS, Anillo S, Huntoon K, Baumann H, Kulaylat M. Analytic review: interleukin-6 in surgery, trauma, and critical care: part I: basic science. J Intensive Care Med 2011;26:3e12.

[22] Pedersen BK. Muscular interleukin-6 and its role as an energy sensor. Med Sci Sports Exerc 2012;44:392e6. [23] Raida MK, Buchmann K. Bath vaccination of rainbow trout (Oncorhynchus mykiss Walbaum) against Yersinia ruckeri: effects of temperature on protection and gene expression. Vaccine 2008;26:1050e62. [24] Kong HJ, Nam B-H, Kim Y-O, Kim W-J, Cho HK, Lee CH, et al. Characterization of the flounder IL-6 promoter and its regulation by the p65 NF-kappaB subunit. Fish Shellfish Immunol 2010;28:961e4. [25] Castellana B, Marín-Juez R, Planas JV. Transcriptional regulation of the gilthead seabream (Sparus aurata) interleukin-6 gene promoter. Fish Shellfish Immunol 2013;35:71e8. [26] Libermann TA, Baltimore D. Activation of interleukin-6 gene expression through the NF-kappa B transcription factor. Mol Cell Biol 1990;10:2327e34. [27] Akira S, Isshiki H, Sugita T, Tanabe O, Kinoshita S, Nishio Y, et al. A nuclear factor for IL-6 expression (NF-IL6) is a member of a C/EBP family. EMBO J 1990;9:1897e906. [28] Cartharius K, Frech K, Grote K, Klocke B, Haltmeier M, Klingenhoff A, et al. MatInspector and beyond: promoter analysis based on transcription factor binding sites. Bioinformatics 2005;21:2933e42. €llner B, Yang W, et al. Char[29] Brietzke A, Goldammer T, Rebl H, Koryt ar T, Ko acterization of the interleukin 1 receptor-associated kinase 4 (IRAK4)encoding gene in salmonid fish: the functional copy is rearranged in Oncorhynchus mykiss and that factor can impair TLR signaling in mammalian cells. Fish Shellfish Immunol 2014;36:206e14. [30] Bowers RM, Lapatra SE, Dhar AK. Detection and quantitation of infectious pancreatic necrosis virus by real-time reverse transcriptase-polymerase chain reaction using lethal and non-lethal tissue sampling. J Virol Methods 2008;147:226e34. [31] Rebl A, Rebl H, Liu S, Goldammer T, Seyfert H-M. Salmonid Tollip and MyD88 factors can functionally replace their mammalian orthologues in TLRmediated trout SAA promoter activation. Dev Comp Immunol 2011;35:81e7. [32] Skjaeveland I, Iliev DB, Strandskog G, Jørgensen JB. Identification and characterization of TLR8 and MyD88 homologs in Atlantic salmon (Salmo salar). Dev Comp Immunol 2009;33:1011e7. [33] Zhang C-Z, Yin Z-X, He W, Chen W-J, Luo Y-W, Lu Q-X, et al. Cloning of IRAK1 and its upregulation in symptomatic mandarin fish infected with ISKNV. Biochem Biophys Res Commun 2009;383:298e302. [34] Li Y-W, Mo X-B, Zhou L, Li X, Dan X-M, Luo X-C, et al. Identification of IRAK-4 in grouper (Epinephelus coioides) that impairs MyD88-dependent NF-kB activation. Dev Comp Immunol 2014;45:190e7. [35] Yang W, Molenaar AJ, Kurts-Ebert B, Seyfert HM. NFKB factors are essential, but not the switch, for pathogen-related induction of the bovine betadefensin 5-encoding gene in mammary epithelial cells. Mol Immunol 2006;43:210e25. [36] Liu S, Shi X, Bauer I, Günther J, Seyfert HM. Lingual antimicrobial peptide and IL-8 expression are oppositely regulated by the antagonistic effects of NF-kB p65 and C/EBPb in mammary epithelial cells. Mol Immunol 2011;48:895e908. [37] Pickup JC, Mattock MB, Chusney GD, Burt D. NIDDM as a disease of the innate immune system: association of acute-phase reactants and interleukin-6 with metabolic syndrome X. Diabetologia 1997;40:1286e92. [38] Øvergård A-C, Nepstad I, Nerland AH, Patel S. Characterisation and expression analysis of the Atlantic halibut (Hippoglossus hippoglossus L.) cytokines: IL-1b, IL-6, IL-11, IL-12b and IFNg. Mol Biol Rep 2012;39:2201e13. [39] Castellana B, Iliev DB, Sepulcre MP, MacKenzie S, Goetz FW, Mulero V, et al. Molecular characterization of interleukin-6 in the gilthead seabream (Sparus aurata). Mol Immunol 2008;45:3363e70. [40] Nam B-H, Byon J-Y, Kim Y-O, Park E-M, Cho Y-C, Cheong J. Molecular cloning and characterisation of the flounder (Paralichthys olivaceus) interleukin-6 gene. Fish Shellfish Immunol 2007;23:231e6. [41] Dendorfer U, Oettgen P, Libermann TA. Multiple regulatory elements in the interleukin-6 gene mediate induction by prostaglandins, cyclic AMP, and lipopolysaccharide. Mol Cell Biol 1994;14:4443e54. [42] Xia C, Cheshire JK, Patel H, Woo P. Cross-talk between transcription factors NF-kappa B and C/EBP in the transcriptional regulation of genes. Int J Biochem Cell Biol 1997;29:1525e39. [43] Rebl A, Goldammer T, Seyfert H-M. Toll-like receptor signaling in bony fish. Vet Immunol Immunopathol 2010;134:139e50. [44] Matsusaka T, Fujikawa K, Nishio Y, Mukaida N, Matsushima K, Kishimoto T, et al. Transcription factors NF-IL6 and NF-kappa B synergistically activate transcription of the inflammatory cytokines, interleukin 6 and interleukin 8. Proc Natl Acad Sci U S A 1993;90:10193e7. [45] O'Shea JM, Perkins ND. Regulation of the RelA (p65) transactivation domain. Biochem Soc Trans 2008;36:603e8. [46] LeClair KP, Blanar MA, Sharp PA. The p50 subunit of NF-kappa B associates with the NF-IL6 transcription factor. Proc Natl Acad Sci U S A 1992;89: 8145e9. [47] Agrawal A, Cha-Molstad H, Samols D, Kushner I. Transactivation of C-reactive protein by IL-6 requires synergistic interaction of CCAAT/enhancer binding protein beta (C/EBP beta) and Rel p50. J Immunol 2001;166:2378e84. [48] Mellet M, Atzei P, Jackson R, O'Neill LA, Moynagh PN. Mal mediates TLRinduced activation of CREB and expression of IL-10. J Immunol 2011;186: 4925e35. [49] He B, Weber GF. Synergistic activation of the CMV promoter by NF-kappaB P50 and PKG. Biochem Biophys Res Commun 2004;321:13e20.